ID: 900507760

View in Genome Browser
Species Human (GRCh38)
Location 1:3038254-3038276
Sequence ACTGATGTGCAGACGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900507760_900507768 16 Left 900507760 1:3038254-3038276 CCTACCTCCGTCTGCACATCAGT No data
Right 900507768 1:3038293-3038315 CTGTCACATGACCTTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507760 Original CRISPR ACTGATGTGCAGACGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr