ID: 900509615

View in Genome Browser
Species Human (GRCh38)
Location 1:3052396-3052418
Sequence CCCGCCCAACACAACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900509615_900509622 -2 Left 900509615 1:3052396-3052418 CCCTCAGAGTTGTGTTGGGCGGG No data
Right 900509622 1:3052417-3052439 GGGAGGTTTCGGGACCATTCAGG No data
900509615_900509627 29 Left 900509615 1:3052396-3052418 CCCTCAGAGTTGTGTTGGGCGGG No data
Right 900509627 1:3052448-3052470 GAGGTGACAAATGTGGGAAGAGG No data
900509615_900509623 10 Left 900509615 1:3052396-3052418 CCCTCAGAGTTGTGTTGGGCGGG No data
Right 900509623 1:3052429-3052451 GACCATTCAGGAAGCTTTTGAGG No data
900509615_900509625 22 Left 900509615 1:3052396-3052418 CCCTCAGAGTTGTGTTGGGCGGG No data
Right 900509625 1:3052441-3052463 AGCTTTTGAGGTGACAAATGTGG No data
900509615_900509626 23 Left 900509615 1:3052396-3052418 CCCTCAGAGTTGTGTTGGGCGGG No data
Right 900509626 1:3052442-3052464 GCTTTTGAGGTGACAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900509615 Original CRISPR CCCGCCCAACACAACTCTGA GGG (reversed) Intergenic
No off target data available for this crispr