ID: 900510947

View in Genome Browser
Species Human (GRCh38)
Location 1:3060829-3060851
Sequence CTGTGTTTGGAAAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900510947_900510954 -8 Left 900510947 1:3060829-3060851 CCAGCTTCCTTTTCCAAACACAG No data
Right 900510954 1:3060844-3060866 AAACACAGTGCAAGGGGCCTGGG No data
900510947_900510953 -9 Left 900510947 1:3060829-3060851 CCAGCTTCCTTTTCCAAACACAG No data
Right 900510953 1:3060843-3060865 CAAACACAGTGCAAGGGGCCTGG No data
900510947_900510956 24 Left 900510947 1:3060829-3060851 CCAGCTTCCTTTTCCAAACACAG No data
Right 900510956 1:3060876-3060898 ACTGCTGTGTCCTCGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900510947 Original CRISPR CTGTGTTTGGAAAAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr