ID: 900511466

View in Genome Browser
Species Human (GRCh38)
Location 1:3062968-3062990
Sequence CAAATCCTGCAGAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900511466_900511474 -10 Left 900511466 1:3062968-3062990 CCCTCCACACTCTGCAGGATTTG No data
Right 900511474 1:3062981-3063003 GCAGGATTTGGGGTGCTGGGTGG No data
900511466_900511477 27 Left 900511466 1:3062968-3062990 CCCTCCACACTCTGCAGGATTTG No data
Right 900511477 1:3063018-3063040 CGAGTCTGCGCGAAACCTCCGGG No data
900511466_900511476 26 Left 900511466 1:3062968-3062990 CCCTCCACACTCTGCAGGATTTG No data
Right 900511476 1:3063017-3063039 TCGAGTCTGCGCGAAACCTCCGG No data
900511466_900511475 2 Left 900511466 1:3062968-3062990 CCCTCCACACTCTGCAGGATTTG No data
Right 900511475 1:3062993-3063015 GTGCTGGGTGGTGTCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900511466 Original CRISPR CAAATCCTGCAGAGTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr