ID: 900513014

View in Genome Browser
Species Human (GRCh38)
Location 1:3069318-3069340
Sequence GCGCCGCGCCGCCGGGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 490}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900513005_900513014 4 Left 900513005 1:3069291-3069313 CCAAAAGTAAGTCTCCCGCGCTC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG 0: 1
1: 0
2: 6
3: 54
4: 490
900513004_900513014 28 Left 900513004 1:3069267-3069289 CCAAGGCGAGGGCGAGGAAGCTA 0: 1
1: 0
2: 0
3: 5
4: 103
Right 900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG 0: 1
1: 0
2: 6
3: 54
4: 490
900513007_900513014 -10 Left 900513007 1:3069305-3069327 CCCGCGCTCGGCCGCGCCGCGCC 0: 1
1: 0
2: 15
3: 61
4: 469
Right 900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG 0: 1
1: 0
2: 6
3: 54
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900513014 Original CRISPR GCGCCGCGCCGCCGGGGCCC GGG Intronic
900112445 1:1014172-1014194 GGACCGTGCTGCCGGGGCCCAGG - Exonic
900283911 1:1890494-1890516 GACCCGCGCCCCCGGGGCCCCGG + Intronic
900511682 1:3063760-3063782 GCCGCGCGCGGGCGGGGCCCTGG - Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900787083 1:4655783-4655805 GCGCCTCCTCCCCGGGGCCCGGG + Intronic
901022194 1:6261086-6261108 GCGCCGGGCGGCCGGGGGCGGGG + Intergenic
901109555 1:6784696-6784718 GCGCCGCGTCCCCACGGCCCCGG - Intergenic
901109836 1:6785644-6785666 GCCCGGCGCCGCCGATGCCCGGG - Intronic
901540075 1:9910040-9910062 GCGCGGCGCGGCGCGGGCCCGGG + Intronic
901678753 1:10901433-10901455 GCCCCGCCCCCCAGGGGCCCTGG + Intergenic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
903044171 1:20553348-20553370 GCGCAGCGCCGCCGGGGGTTCGG + Exonic
903184675 1:21622430-21622452 GTGCCGCCCCGGCGGGGGCCGGG - Intronic
903250994 1:22052985-22053007 GGGGCGCGCGGCCGGGGCTCGGG + Intronic
903349749 1:22710703-22710725 GCGCGCGGCCGCCGGGGGCCGGG + Intergenic
903493100 1:23743962-23743984 GCGCCGCTCCGCGGGGAGCCGGG - Intronic
904171041 1:28592427-28592449 GGGCGGCGCCGGCGGGGCCCCGG + Intronic
904181439 1:28669097-28669119 CGGCCGCGCCGCCGGGGCTCGGG + Intronic
905167018 1:36088768-36088790 GCGCCGCGACTCCGGGCCGCTGG + Intergenic
905448979 1:38045356-38045378 GCAGCGCGCCGGCGGGGGCCCGG + Exonic
905548576 1:38818392-38818414 CCGCCGCGCAGCCGCGGACCCGG - Intergenic
906524335 1:46485747-46485769 GCGGCCCGCGGCCGGGCCCCCGG + Intergenic
906640571 1:47438423-47438445 CCGCCGCGGCGCCTGGCCCCGGG - Exonic
906917186 1:50023989-50024011 GCGCCGCGGGGGCGGGGCCTTGG - Intergenic
907341337 1:53738328-53738350 GCGCCGCGGCGCGGGGGCCTGGG - Intergenic
907450314 1:54542148-54542170 GCCTGGCGCCGGCGGGGCCCAGG + Intergenic
908014226 1:59814877-59814899 TGGCAGCGCGGCCGGGGCCCAGG + Exonic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
911133799 1:94418316-94418338 CCGCCGCGCCGCCCGCGCTCTGG - Intergenic
912716890 1:111989572-111989594 GCTCGGCGCCTCCGCGGCCCCGG - Intergenic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
914022825 1:143885093-143885115 GTGGCGCCGCGCCGGGGCCCGGG - Intergenic
914490002 1:148146129-148146151 GGCCCGCGCCCCCGGGCCCCAGG - Intronic
914661312 1:149793037-149793059 GTGGCGCCGCGCCGGGGCCCGGG - Intronic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
914919710 1:151838797-151838819 GCACTGCGCCGCCCGGGTCCGGG + Exonic
915213330 1:154325567-154325589 GCCCCGCTCCCCCGGGGCCTCGG - Intronic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916179145 1:162069540-162069562 GCGTCGCGCGGCCGGGGGCGCGG + Intergenic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
919789771 1:201283665-201283687 GTGGCGCGCGGCCGGGGCCTAGG - Exonic
920002324 1:202808244-202808266 GCGCTGCCCCTCGGGGGCCCGGG - Exonic
920655120 1:207868902-207868924 CCGGAGCGCGGCCGGGGCCCTGG + Intergenic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
922234558 1:223713021-223713043 CCTCCGCGCCGCCAGAGCCCGGG + Intronic
923126690 1:231040003-231040025 GAGCTGAGCCGCGGGGGCCCGGG - Exonic
923400713 1:233613833-233613855 GGGCTGGGCTGCCGGGGCCCGGG - Intergenic
924101884 1:240612088-240612110 GCCCCGCGCCGCGCGGTCCCAGG + Exonic
924778366 1:247126685-247126707 GCGCCGCGCCAGCAGGGACCCGG - Intronic
924783292 1:247171735-247171757 GCGCCGCGCCAGCAGGGACCCGG + Intronic
1063418204 10:5890185-5890207 GCTCCGCCCCGCCGCAGCCCCGG - Intronic
1063469451 10:6272722-6272744 GCACAGCGCGGCTGGGGCCCAGG - Intergenic
1063663886 10:8050656-8050678 GCGCCGGGGCTCCGGGGCTCCGG + Intergenic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065214899 10:23439571-23439593 GCGCGGCGCCGGCGGCTCCCGGG - Exonic
1065533630 10:26697749-26697771 GCTCCGCGCCGCCGGCTTCCAGG - Exonic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1067407454 10:46036132-46036154 GCTCCACGCTGCCCGGGCCCAGG - Intronic
1067474470 10:46556753-46556775 CCACCGCCCCGCCGCGGCCCGGG + Intergenic
1067830972 10:49610805-49610827 GCGCGGCGCTGCAGGAGCCCCGG + Exonic
1069019145 10:63465992-63466014 GCTGCGCGCCGCCGCTGCCCGGG - Intergenic
1069738360 10:70672380-70672402 GCGCCCCGCCCCCGGGCGCCCGG + Intergenic
1070032784 10:72692789-72692811 GGGCGGCCCCGCCGGGGTCCTGG - Intronic
1072562332 10:96587223-96587245 GCGCCGAGCAGGCTGGGCCCCGG + Intronic
1073138032 10:101230301-101230323 GCTGCGCTCCGCCCGGGCCCCGG + Intergenic
1073265625 10:102226679-102226701 GCGCCCCGGCCCCGGGGCCCTGG - Intronic
1073363607 10:102919077-102919099 ACCCCGAGCCGCCGGCGCCCAGG - Exonic
1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG + Intergenic
1075330478 10:121570333-121570355 GCTCCGCGCAGCCTGGGGCCAGG - Intronic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1075492089 10:122880014-122880036 GCGCCGGGCCGCCGGCGACCGGG + Intergenic
1075498854 10:122953990-122954012 GCGCCGGGCCGACGGGGACGGGG - Intronic
1075521844 10:123148091-123148113 CCTCCGCGCCGCCGGAGACCCGG + Intergenic
1075697510 10:124447674-124447696 GCGCCGCGCCGTCGGCACCCGGG + Exonic
1076373946 10:129971490-129971512 GCGCAGCCCAGGCGGGGCCCTGG - Intergenic
1076374211 10:129972760-129972782 GGGCCGGGTTGCCGGGGCCCCGG - Intergenic
1076985973 11:236359-236381 TCGCCCCGCCCCCGGCGCCCCGG + Exonic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077227799 11:1445941-1445963 GTGCCGCGCAGCCAGGGCCCAGG - Intronic
1077386192 11:2270579-2270601 GCGCCGCGCCTGCGGAGACCTGG - Exonic
1077419895 11:2445159-2445181 GCGCTGCCCCGCCGGGCGCCTGG - Exonic
1078180006 11:9003716-9003738 GCGCGAAGCCGCCGGGGCCGGGG + Intronic
1078594449 11:12674566-12674588 GCGCGGCGGGGCCCGGGCCCGGG + Intergenic
1080802075 11:35618562-35618584 CCGCCTCGCCGCCGGGACCCGGG + Exonic
1081636882 11:44727325-44727347 CCGCCGCGCCCCCGGGGACCTGG + Intronic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082028685 11:47589839-47589861 CCGCCGCCCCGCCGGGCCTCGGG - Exonic
1083272945 11:61581145-61581167 GGGCGGCGCCGGCGGTGCCCCGG - Intronic
1083610163 11:64000617-64000639 AGGCCGCGCCGCCAGGGCCCAGG + Intronic
1083610169 11:64000628-64000650 GAGCCGCCCTGCCTGGGCCCTGG - Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083901777 11:65646807-65646829 GCGGGTCGCCGCCGGGGCTCAGG + Exonic
1083922038 11:65786508-65786530 ATCCCGCGCCGCCTGGGCCCAGG + Intergenic
1084028396 11:66466922-66466944 GCGCGGAGCCGCCGCGGGCCGGG + Exonic
1084045995 11:66568131-66568153 GCGCCGCACGGGCGGGGCCTTGG - Intronic
1084083405 11:66843528-66843550 GCGCTGGGCGGCCTGGGCCCCGG + Exonic
1084385807 11:68841980-68842002 GCCCCGCCCCGCCGAGGCCCCGG - Intronic
1084646862 11:70463918-70463940 CAGCCGCGCCGGCCGGGCCCAGG - Intergenic
1085205820 11:74731336-74731358 CCGCCGCCCCGCCGGGCCCCAGG - Intronic
1085503064 11:77040028-77040050 GCGCCTCGTCCTCGGGGCCCGGG - Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1092743233 12:11649858-11649880 GCGGCGCGGCGCGGGGACCCGGG - Exonic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1095206105 12:39442669-39442691 GCTGCGCGGCGCCGGGTCCCTGG - Intronic
1095951522 12:47784309-47784331 GGCCCGCTCCTCCGGGGCCCTGG - Intronic
1096191535 12:49623356-49623378 CCCCCGCGCCGCCGCGTCCCGGG - Intronic
1096253783 12:50050910-50050932 GCGGCCCAGCGCCGGGGCCCCGG + Intergenic
1098828537 12:75330312-75330334 GCGCCGCGGAGCCGGTTCCCTGG - Intronic
1100869551 12:98895356-98895378 GCGCGGCTCCGCGGGTGCCCAGG + Intronic
1101409552 12:104457311-104457333 GCCCCGCGCCTCCCGGGCTCCGG + Exonic
1101466945 12:104958434-104958456 GCACCGCCCCGCCCGGACCCCGG + Intronic
1101865180 12:108515295-108515317 GCTCCGGGCCGCCGGCTCCCGGG - Exonic
1102046554 12:109833317-109833339 GAGCCGCCCCTCCCGGGCCCGGG + Intronic
1102884077 12:116508535-116508557 CCGCCGCGCCGCCGCGGCTCTGG + Intergenic
1102973553 12:117190157-117190179 GCCCCGCGCCCCCCGGGGCCGGG - Intronic
1103392494 12:120584689-120584711 GCGCCGCGCAGCGGGGACCCGGG - Intergenic
1103400611 12:120640789-120640811 GCGGCGCGGCGCGGGGCCCCCGG - Exonic
1103474810 12:121210434-121210456 CAGCCGCCGCGCCGGGGCCCCGG + Intronic
1103474819 12:121210445-121210467 GCCTCCCGCCCCCGGGGCCCCGG - Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1104001543 12:124863678-124863700 GCGCTGGGCTGCCGGGGCGCTGG - Exonic
1105004167 12:132710821-132710843 GCGGAGCGCCGTCGGGGCCGTGG + Exonic
1105492638 13:20903051-20903073 GCACCGCGAGGCCGGGGCGCCGG - Intergenic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1112216348 13:97434377-97434399 GGGGCGGGCCGCCGGGGCCGGGG + Exonic
1112450291 13:99501688-99501710 GCGCCGCTCCGGCGCGGGCCAGG - Exonic
1113775600 13:112943383-112943405 GCGGCGCGGAGCCGGGGACCGGG - Intronic
1113779720 13:112969172-112969194 GCGCTGCGCCGCGGGGGGCGGGG - Intronic
1113950516 13:114069025-114069047 GGGCCGCGCGTCCGAGGCCCTGG - Intronic
1114483295 14:23048216-23048238 GCGCCACGTCGGCGGGGCCGGGG + Exonic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1121103273 14:91264481-91264503 GCGCCGGGCGGCCGGGGCGAGGG - Intergenic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1122145173 14:99684515-99684537 TCCCCGGGCCGCCGCGGCCCAGG + Exonic
1122226907 14:100285608-100285630 TCTCCGCGCCCCCGTGGCCCTGG - Intergenic
1122624231 14:103075886-103075908 GCGCCCCGCAGCCGCGCCCCGGG + Intergenic
1122917309 14:104865160-104865182 GCGCCGCCCCGCCGGAAACCAGG - Intergenic
1122975341 14:105168581-105168603 GCGCCGCGGCGCGCGGGCCTGGG + Exonic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1202898203 14_GL000194v1_random:22000-22022 GCGCTGCGCCCCGGGGACCCTGG - Intergenic
1202899731 14_GL000194v1_random:28155-28177 GCGCTGCGCCCCAGGGACCCTGG - Intergenic
1124129406 15:26971245-26971267 GCGCCGCGCCAGGGGGTCCCCGG + Intergenic
1124652333 15:31483282-31483304 GCGCCGCGCCGCTCAGGGCCGGG + Exonic
1124848122 15:33311176-33311198 GCGCCGCGGTGCCGGGTGCCCGG + Intronic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1126466174 15:48963290-48963312 GACCCGCGCCGCCGGGAGCCTGG - Exonic
1126736573 15:51737321-51737343 AGGGCGCGCCGCCGCGGCCCGGG - Intronic
1126800818 15:52295404-52295426 GCGTCGCCCCTCCAGGGCCCCGG - Intronic
1128067929 15:64775774-64775796 GCGCCCCGCGGCCGGGGCCGGGG - Intergenic
1128109533 15:65067888-65067910 GCGCCCGCCCGTCGGGGCCCAGG + Exonic
1129116648 15:73368557-73368579 GCGGCGCGCCGCCCGGCTCCAGG + Exonic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1129644716 15:77419766-77419788 GCGCGGCACCGGCGGGGCGCGGG + Intronic
1129752741 15:78077358-78077380 CCGCCGCCTCGTCGGGGCCCTGG + Exonic
1130023650 15:80251965-80251987 GCGCCGCGGCAGCGGGTCCCGGG + Intergenic
1130115406 15:81001345-81001367 GCGCCGGGCCGCCGGGCGCGCGG + Exonic
1130411834 15:83654221-83654243 GCGCCGAGCCCGCGCGGCCCCGG + Exonic
1131055399 15:89371736-89371758 GCGCGGCCTCGCCTGGGCCCTGG - Intergenic
1131085898 15:89575557-89575579 GTGCCGCCGCCCCGGGGCCCCGG - Exonic
1131144049 15:90000471-90000493 GCGCCCCGGGGCCGAGGCCCAGG + Intergenic
1131466123 15:92655891-92655913 GCGGAGCGCAGCCGGGACCCAGG - Exonic
1131493567 15:92883077-92883099 GGGTCCAGCCGCCGGGGCCCGGG - Intergenic
1131846105 15:96492014-96492036 GCGCAGCGCCAGCGGGCCCCCGG + Intergenic
1132522201 16:397084-397106 GCGCCGGGCCACGGGGGTCCGGG + Intronic
1132527694 16:425803-425825 CCGCCGCGCCGCCGGGCCGAGGG + Exonic
1132560225 16:590125-590147 GCCCCGCCCCGCCCGCGCCCGGG - Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132849852 16:2020099-2020121 GCGCGCGGCCGCCGGGCCCCTGG + Exonic
1132856660 16:2048040-2048062 GCGCCGCGCCACCGCGCTCCGGG - Exonic
1132897745 16:2236967-2236989 ACGCCGCCCCGCCCCGGCCCGGG - Intronic
1132968634 16:2673657-2673679 GAGCCCCGCCCCCGGGGCCCTGG - Intergenic
1133021640 16:2969492-2969514 GCGCAGCGCCGGAGGGGCGCGGG + Exonic
1133218507 16:4307802-4307824 GCGGGGCGCCGCCGGTGACCCGG - Intergenic
1133784426 16:8963594-8963616 GCCTCCCGCCGCCGGGGCCGGGG + Intronic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134149927 16:11797409-11797431 GCGCGTCGACGCCGGGGCTCCGG - Intergenic
1135016137 16:18926327-18926349 GGCCCACGTCGCCGGGGCCCCGG + Exonic
1135400343 16:22162538-22162560 ACGCAGCGCCGCGGGAGCCCGGG + Intergenic
1136188248 16:28600729-28600751 GCGCCGCGCCGCACGGGCGATGG - Intergenic
1136190720 16:28613723-28613745 GCGCCGCGCCGCACGGGCGATGG - Intronic
1136333228 16:29595261-29595283 GGCCCACGACGCCGGGGCCCCGG + Intergenic
1136365194 16:29806439-29806461 GCCCCGCGGGGCCGGGGCCGGGG - Intronic
1136414723 16:30096166-30096188 GCGCCGTCCCCCCCGGGCCCGGG + Exonic
1136505195 16:30698588-30698610 GCGCACCGGCCCCGGGGCCCCGG - Intronic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1139364817 16:66427009-66427031 GCACCGCGGCGCCGCGGCCCGGG - Intergenic
1139364822 16:66427020-66427042 GCGCCGCGGTGCTGAGGCCCGGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1140033883 16:71358733-71358755 GCTCCGCGCCGGCTGGGCTCTGG - Exonic
1140442563 16:74999062-74999084 GCGCCGCCCCGCTCGGTCCCGGG - Exonic
1140661044 16:77191512-77191534 CCTCCGCGCCCCCGGGGGCCGGG - Exonic
1141132294 16:81444763-81444785 GCGCCGGGCTCCCGGAGCCCGGG - Intergenic
1141972347 16:87492460-87492482 GCGGGGCGCCGGGGGGGCCCGGG + Intergenic
1142070889 16:88090863-88090885 GGGCCGCGCCGCCCAGGCCTGGG + Intronic
1142134501 16:88445441-88445463 AAGCCTCGCCGCAGGGGCCCAGG - Intergenic
1142200791 16:88760214-88760236 GCTCCGCTCCCCCGGGGCGCTGG + Intronic
1142395354 16:89828588-89828610 GCGCAGGGCGGCCGGAGCCCTGG + Exonic
1142412477 16:89923586-89923608 GCGCCGGGCGGCCGGGACGCGGG + Intronic
1142670571 17:1485822-1485844 GCCCCGCGCTTCAGGGGCCCGGG - Intronic
1142810694 17:2394234-2394256 GCCGAGGGCCGCCGGGGCCCGGG + Intronic
1143016163 17:3892396-3892418 GCGCTGCGGCTTCGGGGCCCGGG - Intronic
1143030475 17:3964485-3964507 GCCCCGCGCCGCCCCGCCCCGGG - Intergenic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143485375 17:7251322-7251344 GAGCTGGGCCGCGGGGGCCCCGG - Exonic
1143780469 17:9226277-9226299 GAGCTTCGCCGCCGGGGCCTCGG + Intronic
1143830289 17:9645638-9645660 CTGCCGCGTCCCCGGGGCCCAGG - Exonic
1144527181 17:15999990-16000012 GCGCCGCACGGCCGGGGCCCAGG + Exonic
1145190608 17:20840780-20840802 GGCCCGCGCCCCCGGGCCCCAGG - Intronic
1145243592 17:21253282-21253304 GCGCGGCGCCGGCGGGGGCCGGG + Exonic
1146445397 17:32928414-32928436 GGGACGCGCCGCACGGGCCCCGG - Intronic
1147139577 17:38453775-38453797 GAGCCGCGGGCCCGGGGCCCGGG - Intronic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147179435 17:38674870-38674892 CCTCCCCGCCGCCTGGGCCCGGG - Exonic
1147393210 17:40122454-40122476 GCGCGGCTCCTCCGGGGCCCGGG - Intronic
1147612852 17:41811918-41811940 CCGCCGCGCCGCCGGCTCTCCGG + Exonic
1147661909 17:42121257-42121279 GGGCTGCGCAGCCGGGGCCGGGG + Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148323707 17:46771707-46771729 GCGGCCCGGCGCCGGGGCCGGGG - Intronic
1148603040 17:48908541-48908563 GCGCCGGGGCGGCGGGCCCCGGG + Exonic
1148852511 17:50561748-50561770 GGGCCGCACCGCCGGGGGTCGGG + Intronic
1149568108 17:57653490-57653512 GCACCCCGCCCCCGGGGCCCGGG - Intronic
1149610389 17:57954958-57954980 GCCCCCCGCGCCCGGGGCCCGGG + Intronic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150217149 17:63477104-63477126 GCCTCGGGCCGCCGGGGGCCGGG + Intergenic
1150675889 17:67245525-67245547 GCGCCGCGCCGCGGGCGGCAAGG - Intronic
1150802210 17:68291349-68291371 GCGACGCGGGGCCGGGGCGCGGG - Intronic
1150830078 17:68511734-68511756 GGCCAGCGCCGCCCGGGCCCCGG - Intergenic
1151370788 17:73645047-73645069 GCGCCGCGTCCCCGGAGCCGGGG - Intergenic
1151743653 17:76000598-76000620 GTGCAGCGCCGGCGGGGGCCAGG + Intronic
1151755733 17:76074461-76074483 GCGCCGCGCCGCAGGGAGCACGG - Intronic
1151854398 17:76710773-76710795 GCGGGACGGCGCCGGGGCCCCGG + Exonic
1151882985 17:76905946-76905968 GCCCCGCCCCCCCGGGGCACCGG - Intronic
1152125544 17:78444560-78444582 GGGCCCCGCCCCCGAGGCCCAGG - Intronic
1152245494 17:79182892-79182914 GCGCCGGGCCGCTGGGGACTCGG - Intronic
1152363853 17:79844288-79844310 GCGACGCGCGGCCGCGGCTCCGG - Intergenic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152628616 17:81399681-81399703 GAGCAGCGCGGCCGGGGCCCGGG - Exonic
1152748334 17:82051406-82051428 GCGCGGAGCCTCCGGGGGCCTGG + Intronic
1153900677 18:9614671-9614693 GCGGGGCGCGGCCGGGGGCCCGG - Intronic
1154174504 18:12076623-12076645 GCGCGGCCCCGCCGGCGTCCGGG + Intergenic
1156350442 18:36297672-36297694 GCCCCCCGCGGCCGGAGCCCGGG + Intergenic
1157610416 18:48951871-48951893 GCGCCGAGCCGCCGAGCGCCCGG - Intergenic
1157842135 18:50968271-50968293 GCGCCGGGCGGCCGAGGCTCCGG - Intronic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160164047 18:76495099-76495121 GGGCTGCGCCGCAGGGGCCGCGG - Intronic
1160204467 18:76822177-76822199 GCCCCGCGCCTCCGTGGCCCGGG - Exonic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160668388 19:344391-344413 GCGCCGCGGGGCCCGGGCCGGGG + Intronic
1160727250 19:622789-622811 CCTCCGCGCGGCCGGGTCCCCGG - Intronic
1160765362 19:805246-805268 GGCCCGTGCCGCCGGGGCTCCGG - Intronic
1160794924 19:940887-940909 GCGCCGGGCCAGCTGGGCCCTGG + Intronic
1160853515 19:1205960-1205982 GGGACGCGCCGCCCGGGGCCCGG + Intronic
1160864012 19:1249342-1249364 GCGCCTCGTGGCCGGGGTCCCGG - Intronic
1160961910 19:1725850-1725872 ACCACGCGCGGCCGGGGCCCGGG - Intergenic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160996707 19:1885358-1885380 GGCCCGCGCCCCCGGGCCCCAGG + Exonic
1161066466 19:2240921-2240943 GCTCCGCTCCTCCTGGGCCCTGG + Intronic
1161101820 19:2425278-2425300 GCCCCGCACCACCGCGGCCCCGG - Intronic
1161682445 19:5686994-5687016 GCTCCGCTCCTCCGCGGCCCCGG + Intronic
1161698468 19:5783005-5783027 GCGCCACTCCCCCGGGGCCCAGG - Exonic
1161851760 19:6740860-6740882 GCGCCGCCCCGGCGTGGCGCGGG - Intronic
1162470919 19:10871651-10871673 CCGCCGCTGCGCCCGGGCCCAGG - Exonic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162572010 19:11479629-11479651 AGGCCGGGCCCCCGGGGCCCTGG + Intronic
1162746385 19:12801132-12801154 GCGCCGCCCGGAGGGGGCCCAGG - Intronic
1162802316 19:13118355-13118377 GCCCCGCTGCGCCGGGGCCTCGG - Exonic
1162833089 19:13299007-13299029 CCGCCGAGCCGCTGGGGTCCCGG + Exonic
1163102595 19:15107376-15107398 GGGCGGCGCGGCCGGAGCCCGGG + Intergenic
1163262272 19:16198331-16198353 GCTCCCCGGCGCCGGGGCCGGGG + Intronic
1163663921 19:18594408-18594430 ACGCCCCGCCGCCCGGGCCCGGG + Exonic
1165065484 19:33225855-33225877 GCCCCGGGCGGCGGGGGCCCGGG + Intergenic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165157307 19:33796338-33796360 GCGCCTTCCCGCCGGGGCCGCGG - Intronic
1165349367 19:35268036-35268058 GCGCCGCGTCCCGGGGGCACCGG + Intergenic
1165851454 19:38852219-38852241 GCCGCGCGCGGCCGGGGGCCAGG - Intronic
1165939827 19:39409609-39409631 GCGCGGCGCCCCCGACGCCCGGG - Intergenic
1166677446 19:44748539-44748561 GCGCGGCGCGGGCGGGGCGCAGG + Exonic
1166986115 19:46660827-46660849 GCGCCGGGCCGCAGCGGCCCTGG - Exonic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1167328802 19:48841293-48841315 GGGCCGGGCCACCGGGGCCTAGG + Exonic
924962367 2:46284-46306 ACGCCGCGCGGCCGGCGCGCAGG - Exonic
925725212 2:6865415-6865437 CAGCCGCGCCGCCCGGACCCGGG + Exonic
925725367 2:6865948-6865970 GAGCCGCGCACCTGGGGCCCCGG - Intronic
926012963 2:9423198-9423220 GGGCCGCGCTCCCGGGGCGCGGG - Exonic
926095684 2:10079810-10079832 GCGCAGCGCGACCGGCGCCCAGG + Intronic
927215851 2:20667442-20667464 GCGGCGCGCGGCGCGGGCCCGGG - Exonic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927714289 2:25342123-25342145 GCTCCGCAGCGCCGGGGCCGGGG - Intronic
929218040 2:39436857-39436879 GCCGCGCGCCGCCGAGGCCGTGG - Intronic
929701900 2:44169316-44169338 CGGCCGCGCCGCCGAGGCCCCGG + Intronic
932790986 2:74654392-74654414 GCGCGGCCCCGCCCGGGTCCCGG + Exonic
933684633 2:85133495-85133517 GAGCCGAGCCGCCTGCGCCCCGG + Exonic
933684638 2:85133506-85133528 GCGCTGCCCGGCCGGGGCGCAGG - Exonic
934079009 2:88452155-88452177 CCGCCGCGCCCGCGGGGCCCGGG - Exonic
934661338 2:96145202-96145224 GCGCCGCGCGGCCAGTGCCTTGG - Exonic
935149032 2:100417413-100417435 GCGCGGCGCCCCCAGGGCCAGGG - Exonic
936433292 2:112482316-112482338 GCGCCGCGCGCCCGGGCCGCCGG - Exonic
936976145 2:118224369-118224391 GCGCCGGGCCGCCGGGTCACCGG + Intergenic
936976187 2:118224535-118224557 GGGCCGCCCCGCCGGGCGCCAGG + Intergenic
937208620 2:120252987-120253009 GCGCGGCGCCCGCGGGCCCCGGG + Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941104906 2:161341153-161341175 GCGGGACGGCGCCGGGGCCCCGG + Intronic
942043368 2:172085239-172085261 GCCGCGGGCCGCAGGGGCCCCGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
944221855 2:197310926-197310948 GAGCCGCGCAGCCCGGCCCCCGG + Intronic
946622457 2:221573610-221573632 CCGCCCGGCCGCCGGGACCCAGG - Intronic
947602615 2:231463962-231463984 GGGCCGCGCCGCGTGGGTCCTGG - Intronic
947748643 2:232522040-232522062 GCGCGGCGCCGCCCGGGGCCTGG + Exonic
948140601 2:235669909-235669931 GCGCCGCGCCGCCCGAGTGCCGG - Intronic
948393339 2:237627574-237627596 GCGCCGCCCCGGCCCGGCCCCGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
1168795897 20:610066-610088 GCCGCCCGCCCCCGGGGCCCGGG + Exonic
1168795904 20:610077-610099 GCGCGGCGCGGCCCGGGCCCCGG - Exonic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169113166 20:3046078-3046100 GCGCTGAGCCGCCTGGGCGCGGG + Exonic
1169483462 20:6006288-6006310 GCGCGGCGCCGCTTGGGCTCCGG + Exonic
1170150490 20:13221673-13221695 GAGCCGCGCTGCCGGGCTCCCGG + Intergenic
1170890061 20:20368802-20368824 GCGGCCCGCGGCCCGGGCCCCGG + Exonic
1170924723 20:20712495-20712517 CTGCCCCGCCGGCGGGGCCCGGG - Intergenic
1172015428 20:31870257-31870279 GCGCCGGGCCGCGGCGGCCGGGG + Intronic
1172245598 20:33443402-33443424 GCGCCGCGGAGCCGGGCGCCGGG - Exonic
1173791974 20:45833889-45833911 GCGCCGCGCCCCAGGGGTCCGGG - Exonic
1174204251 20:48827773-48827795 GCGCCGCGGCGCCAGGGGCCCGG + Exonic
1175859709 20:62143645-62143667 TCGCCGCGCCTCCGGGCCCGCGG - Intergenic
1176029861 20:63006726-63006748 TGGCCGCGCCGCCTGGGCTCGGG + Exonic
1176068914 20:63216002-63216024 CCGCCGCCCGGCCGGCGCCCGGG - Exonic
1176194640 20:63831458-63831480 GCGCCGCGCCGCGGGGTCGCAGG + Intergenic
1176617891 21:9037989-9038011 GCGCTGCGCCCCGGGGACCCTGG - Intergenic
1176619106 21:9042929-9042951 GCGCTGCGCCCCAGGGACCCTGG - Intergenic
1178457806 21:32771708-32771730 GCTCGGCGCTGCCGGGGCCGCGG - Exonic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178534984 21:33403627-33403649 GCGTCCCGCCGCGGAGGCCCAGG - Intronic
1179661523 21:42879086-42879108 CCGCGGCGCCGGCGGGGACCGGG - Intronic
1179953376 21:44724072-44724094 GCGCCGCGCCTAAGGGGACCAGG + Intergenic
1180132420 21:45835199-45835221 AGGCCCCGCCCCCGGGGCCCAGG - Intronic
1180871412 22:19149224-19149246 GTGGCGCGCAGCCGCGGCCCGGG - Intronic
1180871682 22:19150240-19150262 GCGGCGAGCCGCCGGGGTGCCGG - Exonic
1180910588 22:19447377-19447399 GCGCCGGAACGCCGAGGCCCAGG - Exonic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181082802 22:20425611-20425633 GGGCCGCGCCGAGGTGGCCCTGG - Exonic
1181121675 22:20671210-20671232 GGCCCGCGCCCCCGGGCCCCAGG + Intergenic
1181334643 22:22118250-22118272 GGCCCGCGCCCCCGGGCCCCAGG + Intergenic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1181567980 22:23751233-23751255 GCGCGAAGCCGCCCGGGCCCCGG + Intergenic
1182903848 22:33920440-33920462 CCGCCGCCGCGCCGGAGCCCGGG - Intronic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183294144 22:37019818-37019840 GCGCCGCGCCGCGGGGGCCATGG + Intronic
1183607105 22:38872260-38872282 GCGCCGCAGCGCCCAGGCCCCGG + Exonic
1184523758 22:45009734-45009756 GCGCCGCGGCGCCGAGCCCTCGG + Intronic
1184593829 22:45502745-45502767 GCCCCTCGCAGCCGGGGTCCGGG + Intronic
1184663454 22:45976057-45976079 GCCCCGCCCGCCCGGGGCCCTGG - Intronic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185038089 22:48489966-48489988 GGGCCGCGCCACCCGGGGCCTGG - Intronic
1185278753 22:49961037-49961059 GCGCGGGGCCGGCGGGGCCGGGG + Intronic
950253919 3:11488530-11488552 GCGCCGCTGCGCTGCGGCCCGGG - Intronic
950549055 3:13655400-13655422 GCGCCGGGCGGCCGGGGCGCCGG - Intergenic
951543636 3:23806122-23806144 CGGCCGCGCCGCCGGGCCTCGGG + Intronic
954717532 3:52533920-52533942 GCCCCGCCCCGCCGGGTCCGGGG - Intronic
954912668 3:54122336-54122358 GCGCCGCGCGGGCGGGGACTCGG - Intergenic
961013403 3:123449812-123449834 CCCCCGCGCCGCCCGGGCCTCGG + Intergenic
961259798 3:125593138-125593160 GTGGGGCGCCGCCGCGGCCCTGG - Intronic
961305690 3:125958254-125958276 GCGCCGCGGGGCTCGGGCCCTGG - Intergenic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
962316760 3:134364069-134364091 GCGAGGCGCCGACGGGACCCGGG + Intronic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963189016 3:142448132-142448154 GCCTCGCGCGGCCGGGGCCGCGG + Intergenic
964118969 3:153162643-153162665 GCGCAGCCCCGACGGGGCCGCGG + Exonic
966852742 3:184174831-184174853 CCGCCGCCCCGCCCCGGCCCCGG - Intronic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
966878929 3:184338823-184338845 GCTCCGCGCAGCTGCGGCCCAGG - Intronic
967924141 3:194633231-194633253 GCGGCGCGGGGCCGGGGACCTGG + Exonic
968382281 4:107425-107447 CGGCCGGGGCGCCGGGGCCCTGG - Intergenic
968434092 4:576141-576163 GCGCCGCGCGGCCGGACCGCCGG + Intergenic
968509461 4:989018-989040 GCGCCGAGACTACGGGGCCCTGG - Exonic
968556593 4:1248995-1249017 GCGCTGCGCCGCCGCGAGCCCGG + Exonic
968756111 4:2417455-2417477 GCGCCGCGGGGTCGGGGTCCGGG - Intronic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
969873078 4:10116597-10116619 CCGCCGCGCTGCCCCGGCCCCGG - Intronic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
971018961 4:22515753-22515775 GCGCGGCCCCGCCGGCGTCCGGG + Exonic
971272155 4:25160206-25160228 CCGCCGCGACCCCGGGGCTCTGG - Intronic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
976257050 4:83109996-83110018 GCGGCGCGCCGCTGGGGACTCGG + Intronic
981033868 4:140151668-140151690 GCACCGCGCCGCCCGGGTGCTGG - Intronic
981688515 4:147481252-147481274 CCGCCGCCGCGCCGGAGCCCGGG + Exonic
982291849 4:153789427-153789449 CCCGCGTGCCGCCGGGGCCCGGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984776216 4:183483368-183483390 CCGCCGCGCCACCGCTGCCCAGG - Intergenic
985128930 4:186723259-186723281 GCGCGGGGCTGCCGGGTCCCTGG - Intronic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
987099839 5:14581964-14581986 GCCCCGCCCCGCCCGGCCCCAGG - Intronic
987374011 5:17217831-17217853 GCCCCGCGCCGCCGCGGACCCGG + Intronic
988564844 5:32312727-32312749 GCGCCGCGCAGGCGGGGCGTCGG - Intronic
990954649 5:61330944-61330966 GCGCCGCGCACCCGGGTGCCGGG + Intergenic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
992627532 5:78648823-78648845 GCGGCGCGGGGCCGGGGCCTGGG - Exonic
992690608 5:79236954-79236976 GCCGAGCTCCGCCGGGGCCCGGG - Exonic
996308542 5:122077768-122077790 CCTCAGCGCCGCCGGGACCCGGG - Exonic
996948265 5:129095164-129095186 GCCCCGAGCCGCCCGGGACCCGG + Intronic
998095673 5:139394473-139394495 GCGCCGCGCCCGCCAGGCCCCGG - Exonic
998463273 5:142324652-142324674 GCGCCGTGCCGGCCGGGCCGAGG + Intronic
998517704 5:142770703-142770725 GCGGCGGGCGGCCCGGGCCCCGG + Exonic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
999248366 5:150167213-150167235 GCGCAGCCCCTCGGGGGCCCGGG + Exonic
999768432 5:154757008-154757030 GCGCCGCGCCGGCGGCCCGCGGG + Intronic
1001653288 5:173329863-173329885 GCGCCCCGCCGCGGAGACCCAGG - Intergenic
1002190178 5:177473733-177473755 GCGCCGCCCCGGCCCGGCCCAGG + Intronic
1003099028 6:3163106-3163128 GCGCCGCGGCCCCTGGACCCCGG - Intergenic
1003645539 6:7910659-7910681 GCGCTGGGGCGCCCGGGCCCAGG - Exonic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004614882 6:17280825-17280847 GCGGCGCGGCGCTGGGGCTCGGG - Intergenic
1004650269 6:17600940-17600962 GCCCCGCGGCCCCGGGGCTCAGG - Exonic
1006535612 6:34696650-34696672 CCGCCGCGCCGCCGGGCCCGGGG + Exonic
1006642647 6:35496928-35496950 GGGCCGCTCCGCCGGGCCCGAGG + Exonic
1006665186 6:35688569-35688591 TCGCCGCGCCCCAGGGGCCGCGG - Intronic
1006677809 6:35776748-35776770 TGGCCCCGCCGCCGGGGCACTGG + Intronic
1006834130 6:36986374-36986396 GTGGCGGGCAGCCGGGGCCCCGG + Intergenic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007390424 6:41547107-41547129 GCTCCGGCCCGCTGGGGCCCGGG - Intronic
1007431486 6:41779822-41779844 GCCCGGCGCCGCCCGGGCCGCGG - Exonic
1007557901 6:42782434-42782456 TCCCAGCGCTGCCGGGGCCCCGG + Intronic
1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG + Intergenic
1008952105 6:57172492-57172514 GCGCGGCGCCCGCGGGGCTCGGG - Exonic
1009975550 6:70667689-70667711 GCGCCGAACCTACGGGGCCCGGG - Intergenic
1011607373 6:89118093-89118115 GGGCGGCGCCGGCGCGGCCCAGG + Intergenic
1013117784 6:107115477-107115499 GCGCCGGGCCGCCTGGGTCCCGG - Intergenic
1013230565 6:108158019-108158041 GCGCCGCCCCCCCGCGCCCCCGG + Intronic
1013359593 6:109382121-109382143 TCGCCGTGCGGGCGGGGCCCGGG - Intronic
1014079577 6:117270981-117271003 GCGCCGCGTGGGCCGGGCCCGGG + Exonic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1015149246 6:130019924-130019946 GTGCCGCGCCGCGCCGGCCCGGG + Intronic
1015149344 6:130020221-130020243 GCGCCGCGGCGGCGGGGCGGGGG + Intronic
1015776812 6:136822804-136822826 GCGCCGCGCAGCTGGGGCCGGGG + Intronic
1016923209 6:149317053-149317075 GCGCCGCGCGGGTGGGGTCCGGG - Intronic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1017253023 6:152302158-152302180 GCGCAGAGCCGCGCGGGCCCGGG + Intronic
1017671832 6:156777195-156777217 CCGCCGAGCCGCCCCGGCCCCGG + Intergenic
1017738204 6:157381903-157381925 GGGCCGCGGCGCCGCGGCTCGGG + Exonic
1017880631 6:158560310-158560332 GCGCCGTGCCGCAGGGTCCCTGG + Intronic
1017913935 6:158818348-158818370 GCGCCTCCTCGCCGGGGGCCCGG - Intronic
1018694819 6:166383020-166383042 GCGCCGCGCCGCCCGGCTCTCGG + Intergenic
1018853914 6:167662340-167662362 GGGCCGCGCAGTCGGGACCCTGG + Intergenic
1019399650 7:844903-844925 GTGCAGCACCCCCGGGGCCCTGG - Intronic
1019594986 7:1854315-1854337 GGGACGAGCTGCCGGGGCCCAGG - Intronic
1019765099 7:2844178-2844200 GCCGCGCCCCGCCGGCGCCCGGG + Exonic
1020105531 7:5420760-5420782 GGCTCGTGCCGCCGGGGCCCCGG + Intronic
1020136893 7:5592709-5592731 GCTCCGCGCGGGAGGGGCCCCGG - Intergenic
1021600179 7:22356829-22356851 GCGGAGCGCCGCTGGGGGCCGGG - Exonic
1021716942 7:23469623-23469645 CCGGCGCCCCGCCCGGGCCCAGG - Intronic
1021958729 7:25852359-25852381 GCGCCGCGCCCCCCGGACTCTGG + Intergenic
1022106114 7:27199293-27199315 GTGCCGGGCCTCGGGGGCCCCGG - Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023965736 7:44962313-44962335 GTGCCAAGCCGCCGTGGCCCAGG - Intergenic
1024043806 7:45574426-45574448 GCGGCGAGGCGCCGGGGCGCGGG - Intronic
1026000453 7:66556646-66556668 GCGCCGCGCCGCCTGAACCTGGG - Intergenic
1026817016 7:73521552-73521574 GCTCCTCGCCGGCGAGGCCCCGG + Intronic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1027421114 7:78019381-78019403 CCGCCGTCGCGCCGGGGCCCTGG - Exonic
1027592538 7:80134700-80134722 GTGGCGCGGCGCCGGGGTCCGGG + Intronic
1029286405 7:99468812-99468834 ACGCAGAGCCGCCGGAGCCCAGG + Intergenic
1029390681 7:100272045-100272067 GCGCCGAGCTCCCGGGTCCCCGG - Exonic
1029423483 7:100483600-100483622 ACGCCGCTCCGCCGGGGCCGGGG + Intergenic
1029849403 7:103446284-103446306 GCGCTGGGACGCCGGGGCGCGGG + Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1033477214 7:141702263-141702285 GCGCCTCCGCGGCGGGGCCCCGG - Intergenic
1034201428 7:149285326-149285348 TCGCGGGGCCGCCGGGGCTCGGG - Intronic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1034434804 7:151058318-151058340 GCGCTGGGCCGCCAGTGCCCGGG - Exonic
1035153392 7:156893196-156893218 GCGCCGCGCAGTCGGGGGCGGGG + Exonic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035355161 7:158272250-158272272 GAGCCGCGTCTCCGGGGCCCGGG + Intronic
1035450265 7:158973441-158973463 GCGCCGCGCCCTCGGGGAGCCGG - Intergenic
1035450270 7:158973455-158973477 GCGCGGCGCGTCCGTGGCCCAGG + Intergenic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1037803861 8:22049009-22049031 GGGCCGCGCCGCGCGAGCCCAGG - Intronic
1037807530 8:22066896-22066918 GCGCGGCGCCGCCCCGGGCCGGG + Intronic
1037903826 8:22703770-22703792 GCCCCCCGCCGCCCGGGCCGCGG + Intergenic
1039996875 8:42541732-42541754 ACGCGGCCCCGCCGGGGACCGGG - Intronic
1040567549 8:48581533-48581555 GCGCAGGGCCGGCGTGGCCCTGG + Intergenic
1043472594 8:80578046-80578068 GCGCCTCCCCTCCGGGGGCCTGG + Intergenic
1044569318 8:93700215-93700237 ACGCCGGTCCGCCGGGGACCAGG - Intronic
1044999812 8:97869423-97869445 GCGCCGGGGCCCCGGGGCGCTGG - Intronic
1045564350 8:103298738-103298760 GCGCAGCGCAGGCGGTGCCCGGG + Intronic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1047687066 8:127315671-127315693 GCGCCGCTGCGCTGCGGCCCGGG + Intergenic
1049446075 8:142632266-142632288 GCCCAGGGCCGCCGGGGCGCTGG + Intergenic
1049452646 8:142670228-142670250 GGGGCGCGCGGCCTGGGCCCCGG + Intronic
1049766637 8:144358210-144358232 TGGCCGCGGCGCTGGGGCCCCGG + Exonic
1049807345 8:144546980-144547002 GCCCCGTGTCTCCGGGGCCCTGG - Intronic
1050472375 9:6007414-6007436 GGGCCGCGCAGCGGGGGCCGGGG - Exonic
1052494649 9:29212184-29212206 GCACCGCGCCGCGGGGACGCAGG - Intergenic
1053153428 9:35757095-35757117 GCGCCGCCCGGCCGGGCCTCCGG - Exonic
1053206589 9:36191234-36191256 TCGCCGTGCGGCTGGGGCCCGGG - Exonic
1053306209 9:36986345-36986367 GCGCGGCCGCGGCGGGGCCCGGG - Intronic
1053643678 9:40109355-40109377 GCGCTGCGCCCCAGGGACCCTGG + Intergenic
1053762475 9:41356135-41356157 GCGCTGCGCCCCAGGGACCCTGG - Intergenic
1054324533 9:63706586-63706608 GCGCTGCGCCCCAGGGACCCTGG + Intergenic
1054541072 9:66267252-66267274 GCGCTGCGCCCCAGGGACCCTGG - Intergenic
1056350238 9:85741963-85741985 GCGCCGCGCTGACGTTGCCCGGG - Intronic
1056992343 9:91423719-91423741 GGGCCGGGCCTCCGGGGCCGCGG + Exonic
1057432165 9:95004739-95004761 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057432189 9:95004791-95004813 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057490463 9:95516276-95516298 GGGCTGCGCCGCCTGGGCGCGGG - Intronic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1058923530 9:109640489-109640511 GCGCCGCGCCGCCAGTCCCAGGG + Intergenic
1059176686 9:112175023-112175045 GCACCGCGCCGGCCCGGCCCAGG + Intronic
1059390987 9:113999365-113999387 GCGAGGCGCAGGCGGGGCCCTGG + Intronic
1059483634 9:114611309-114611331 GCTCCGCTCCGCCGCGGGCCCGG + Exonic
1060479261 9:124008595-124008617 GCGCCACGGAGCCGGGGCCGCGG - Intronic
1060811650 9:126614023-126614045 GCGCGGCGCAGCGGGGTCCCGGG - Intergenic
1060811771 9:126614365-126614387 GCTCTCCGCCGCCGCGGCCCTGG - Intergenic
1060945779 9:127568788-127568810 GCGCCGCGCCACGCGCGCCCAGG - Intronic
1061052242 9:128203692-128203714 TCGCCGCGCCGTCAGTGCCCCGG - Intronic
1061087779 9:128409318-128409340 GCACCGCCTCGCCGGGGCTCCGG + Intergenic
1061129948 9:128703066-128703088 GCGTCGCGGGGCCGGGGCCAGGG - Intronic
1061489814 9:130938727-130938749 GCCCCGCGCCGGGGCGGCCCGGG + Exonic
1061863462 9:133479336-133479358 CCGGCGCTCCGCGGGGGCCCCGG - Intergenic
1062022605 9:134326535-134326557 GCTCCCCGCCGCCCGGGCCCGGG + Intronic
1062049094 9:134437998-134438020 GCCCCGCACCACCGGAGCCCGGG - Intronic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062447489 9:136601811-136601833 TCCCCTCTCCGCCGGGGCCCTGG + Intergenic
1062491691 9:136808047-136808069 GCGCTCCGCCGCCGGGACCCCGG + Exonic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062620993 9:137422689-137422711 GCGCCTCCCTGCAGGGGCCCTGG - Intronic
1190229970 X:48574619-48574641 GCGCCGCGCCGGCCGTGACCGGG + Intronic
1190732857 X:53236166-53236188 GCGCTGCGCCACAGGGGGCCTGG - Intronic
1195716870 X:107826438-107826460 GCGCCCCCTCGCCGCGGCCCTGG + Intronic
1196683907 X:118495294-118495316 GCCCCTAGCCGCCTGGGCCCTGG + Intergenic
1197709339 X:129654647-129654669 GCGCCGGCTCGCCGGGGCCGCGG - Exonic
1199699626 X:150365553-150365575 GCCCCTCGCCGCCGGAGCTCAGG + Intronic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200115356 X:153767574-153767596 CCGCCGCGGGGCCCGGGCCCAGG + Exonic
1200115437 X:153767841-153767863 CCTCTGCGCCGCTGGGGCCCCGG - Exonic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic
1201151270 Y:11096828-11096850 GCGCTGCGCCCCGGGGACCCTGG - Intergenic