ID: 900513199

View in Genome Browser
Species Human (GRCh38)
Location 1:3069864-3069886
Sequence CCGCGGAGCCGGGTGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 294}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900513199_900513214 1 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513214 1:3069888-3069910 CGCAGGGGCAGGGGTGGCGACGG 0: 1
1: 0
2: 4
3: 58
4: 794
900513199_900513211 -8 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513211 1:3069879-3069901 CTCCGCGGGCGCAGGGGCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 330
900513199_900513217 23 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513217 1:3069910-3069932 GCGGGACAGCCGCAGCCACTTGG 0: 1
1: 0
2: 0
3: 5
4: 107
900513199_900513219 25 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513219 1:3069912-3069934 GGGACAGCCGCAGCCACTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 174
900513199_900513216 5 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513216 1:3069892-3069914 GGGGCAGGGGTGGCGACGGCGGG 0: 1
1: 0
2: 7
3: 109
4: 864
900513199_900513218 24 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513218 1:3069911-3069933 CGGGACAGCCGCAGCCACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
900513199_900513209 -10 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513209 1:3069877-3069899 GGCTCCGCGGGCGCAGGGGCAGG 0: 1
1: 1
2: 2
3: 46
4: 513
900513199_900513215 4 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513215 1:3069891-3069913 AGGGGCAGGGGTGGCGACGGCGG 0: 1
1: 0
2: 8
3: 92
4: 1069
900513199_900513210 -9 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513210 1:3069878-3069900 GCTCCGCGGGCGCAGGGGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 222
900513199_900513213 -5 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513213 1:3069882-3069904 CGCGGGCGCAGGGGCAGGGGTGG 0: 1
1: 1
2: 6
3: 121
4: 1097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900513199 Original CRISPR CCGCGGAGCCGGGTGGGCGC CGG (reversed) Intronic