ID: 900513199

View in Genome Browser
Species Human (GRCh38)
Location 1:3069864-3069886
Sequence CCGCGGAGCCGGGTGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 294}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900513199_900513215 4 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513215 1:3069891-3069913 AGGGGCAGGGGTGGCGACGGCGG 0: 1
1: 0
2: 8
3: 92
4: 1069
900513199_900513217 23 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513217 1:3069910-3069932 GCGGGACAGCCGCAGCCACTTGG 0: 1
1: 0
2: 0
3: 5
4: 107
900513199_900513211 -8 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513211 1:3069879-3069901 CTCCGCGGGCGCAGGGGCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 330
900513199_900513214 1 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513214 1:3069888-3069910 CGCAGGGGCAGGGGTGGCGACGG 0: 1
1: 0
2: 4
3: 58
4: 794
900513199_900513209 -10 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513209 1:3069877-3069899 GGCTCCGCGGGCGCAGGGGCAGG 0: 1
1: 1
2: 2
3: 46
4: 513
900513199_900513218 24 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513218 1:3069911-3069933 CGGGACAGCCGCAGCCACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
900513199_900513213 -5 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513213 1:3069882-3069904 CGCGGGCGCAGGGGCAGGGGTGG 0: 1
1: 1
2: 6
3: 121
4: 1097
900513199_900513210 -9 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513210 1:3069878-3069900 GCTCCGCGGGCGCAGGGGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 222
900513199_900513219 25 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513219 1:3069912-3069934 GGGACAGCCGCAGCCACTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 174
900513199_900513216 5 Left 900513199 1:3069864-3069886 CCGGCGCCCACCCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 45
4: 294
Right 900513216 1:3069892-3069914 GGGGCAGGGGTGGCGACGGCGGG 0: 1
1: 0
2: 7
3: 109
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900513199 Original CRISPR CCGCGGAGCCGGGTGGGCGC CGG (reversed) Intronic
900244646 1:1631514-1631536 CCGGGGAGCCGGGAAGGGGCGGG - Intergenic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
900595469 1:3478333-3478355 CAGGGGAGCCGGGTGGGACCTGG + Intronic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901641119 1:10693763-10693785 CGGCGGGGCCGGGTGGGGGCCGG - Intronic
902585809 1:17438195-17438217 CAGGGTAGACGGGTGGGCGCAGG - Intronic
902600903 1:17539730-17539752 CCTCGGAGCGCGGCGGGCGCGGG + Intergenic
903628113 1:24745663-24745685 CCCCGCAGCCGGGAGGGAGCCGG - Intronic
903628153 1:24745782-24745804 CCTCGGAGGCGGGAAGGCGCGGG - Intronic
905517177 1:38570279-38570301 CCGCGGGGCAGGCCGGGCGCAGG + Intergenic
905846915 1:41241664-41241686 CGGCGGGGCCGGGTGGGCCGGGG - Intronic
905912126 1:41662299-41662321 ACGCGGCGCGGGGTGGGCGCGGG + Intronic
905990667 1:42334914-42334936 CCGCGTTGCGGGGTGGGCGGCGG - Exonic
906262698 1:44406124-44406146 CCGCGGAGCCGGCTGTGTGTGGG - Intronic
907767367 1:57424159-57424181 GCGGGGCGCCGGGCGGGCGCGGG - Intronic
910759278 1:90718800-90718822 CTGCGGTGTCGGGCGGGCGCGGG + Intergenic
915519859 1:156435804-156435826 CCGCAGAGCCGCGGGTGCGCGGG + Intergenic
916052387 1:161045545-161045567 CCGCGGAGCAGCTGGGGCGCGGG - Intronic
916792577 1:168136902-168136924 ACGCGGACCCGGGCGGGCGCAGG + Intronic
917433994 1:175000288-175000310 GCGCGGGACCGGGTGGCCGCAGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918015941 1:180632424-180632446 CAGCGGAGCCGGGAGGCGGCCGG - Intronic
918238797 1:182604127-182604149 CTGGGGACCTGGGTGGGCGCGGG - Intronic
922419830 1:225452080-225452102 CCCTGAAGCGGGGTGGGCGCGGG - Intergenic
922757282 1:228103355-228103377 CGGCGAAGCCGAGTGGGCGCGGG - Exonic
1063371488 10:5525538-5525560 CCCAGGAGCATGGTGGGCGCCGG - Exonic
1068335723 10:55630679-55630701 CTGCGGTGCCGGGCGGGCTCAGG + Intergenic
1068783308 10:60944234-60944256 CCTGGGAGCGGGGTGGGGGCAGG - Exonic
1070257675 10:74825680-74825702 CCGGGGACCCGGGTGGCCGGAGG + Intronic
1070328790 10:75403901-75403923 GGGCTGAGCCGGGTGCGCGCGGG + Intergenic
1070768479 10:79069464-79069486 CCGCGCAGCCGGGAGCTCGCCGG - Intronic
1072913423 10:99522803-99522825 CGGCGGAGCCGGGAATGCGCTGG - Intergenic
1073435405 10:103513096-103513118 CAGCAAAGCCGGGTGGGCACCGG - Intronic
1073456196 10:103638154-103638176 CAACGGAGCAGGGTGGGCACAGG - Intronic
1073577524 10:104639066-104639088 CCGCAGGCCCAGGTGGGCGCGGG - Intergenic
1075259402 10:120949647-120949669 CCGCGGTGCCGACTGGGCGCGGG - Intergenic
1075693754 10:124418784-124418806 CGGGGGAGGCGGGCGGGCGCGGG - Intronic
1076035601 10:127196502-127196524 CCGCGGAGCCGGGCGGCCAGAGG + Intronic
1076631950 10:131856752-131856774 CAGAGGAGCGGGGTGGGCGGGGG + Intergenic
1076734659 10:132453228-132453250 TCGCGGGGCAGGGCGGGCGCTGG + Intergenic
1076821641 10:132942674-132942696 CCGCGGAGCTGGCGGGGGGCAGG - Intronic
1076908197 10:133373560-133373582 CGGCGGGGCCTGGAGGGCGCTGG - Exonic
1077034054 11:486388-486410 CCCCGGGGCCAGGTGGGCACAGG - Intronic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077327456 11:1969882-1969904 CCGGGGAGCGGGGTGCACGCGGG + Intronic
1077544885 11:3165010-3165032 CCGCGGGGCCGGTCGCGCGCTGG - Intronic
1077635950 11:3841247-3841269 CCGCGGAGGCTGGTGGGGGCGGG - Intergenic
1078660023 11:13278483-13278505 CCGCGAGGCTGGGTGGGGGCGGG + Intronic
1083660064 11:64247756-64247778 CTGCGGAGCCGACTGGGCGGCGG - Intergenic
1083747085 11:64742676-64742698 CTGCGGAGCAGGGTGGGTCCGGG + Intronic
1083768518 11:64853746-64853768 CGTCGGAGCCGGTGGGGCGCGGG + Exonic
1083970456 11:66070871-66070893 CGGGGGAGCGGGGTGGCCGCCGG + Intronic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084972993 11:72781595-72781617 CAGCGACGCCGGGCGGGCGCGGG + Intronic
1085470057 11:76752230-76752252 CCGCAGAGCCCGCTGGGAGCTGG - Intergenic
1089442799 11:118530920-118530942 CCGCGGACCCGGGCGTCCGCGGG + Exonic
1089479098 11:118791022-118791044 CCTCGGAGCGGGGCGGGGGCGGG - Intronic
1089632918 11:119794591-119794613 ACGGGGAGCCGGGTGGGTGTGGG + Intergenic
1090736912 11:129618249-129618271 CCGCGCAGTCGGCGGGGCGCGGG - Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1202810438 11_KI270721v1_random:25062-25084 CCGGGGAGCGGGGTGCACGCGGG + Intergenic
1091550302 12:1531027-1531049 CCGCGGGGCCGGGAAGGCGGAGG - Intronic
1092524288 12:9300205-9300227 CTGCTGAGCTGTGTGGGCGCTGG + Intergenic
1092542975 12:9431607-9431629 CTGCTGAGCTGTGTGGGCGCTGG - Intergenic
1096077744 12:48815556-48815578 CGGCGGAGCCCGGCGGGCGTGGG + Intronic
1100329321 12:93570286-93570308 GGGAGGAGCCGGGTGGGTGCGGG + Intronic
1101391399 12:104303689-104303711 CCGCGGAGCGTGCTGGGGGCGGG + Intronic
1102651755 12:114447442-114447464 CCGCGGTGCCGGGCGGTCTCCGG - Intergenic
1103261632 12:119593817-119593839 CGGCGGCGCCGGGAGGGCGGAGG - Exonic
1103604719 12:122078432-122078454 GCGCGGAGCGGGGCGGGGGCGGG + Intergenic
1104841577 12:131828408-131828430 CCGCGGAGAGCGGAGGGCGCCGG + Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1112761120 13:102694457-102694479 CCGCGCAGCAGCCTGGGCGCCGG - Exonic
1113443218 13:110345990-110346012 CCCCGGAGCTGGGTGTGGGCAGG - Intronic
1113742681 13:112722286-112722308 CCGGGGAGGAGGGTGGGCCCGGG + Intronic
1114673911 14:24428955-24428977 CCTGGGGGCCGGGTGGGCCCAGG - Exonic
1116437574 14:44912218-44912240 CGCCGGTTCCGGGTGGGCGCTGG + Intergenic
1117156997 14:52951202-52951224 GCGCGGCGCCGGGAGGGCGGGGG - Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1117722140 14:58638273-58638295 CGGCGGAGCCCGAGGGGCGCTGG + Exonic
1119765875 14:77187433-77187455 CCTCGGAACCTGGTGGGGGCGGG - Intronic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122116023 14:99527687-99527709 CTGCTGAGCTGGGTGGGCACTGG - Intronic
1122264049 14:100538519-100538541 CCGGGGAGCCGGGCGGTCCCCGG + Exonic
1122545057 14:102517354-102517376 CCGCGGACCGCGCTGGGCGCAGG + Intergenic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122840838 14:104461851-104461873 CCGGGCAGCCGGGAGGGCGCAGG - Intergenic
1122880872 14:104689914-104689936 GCGCGGAGCCGGGGGGGCCAGGG - Intronic
1124342850 15:28901291-28901313 CCCCAGAGCTGGGTGGGGGCTGG - Intronic
1124469223 15:29968604-29968626 GCGCGGAGCGGGGCGGGGGCCGG - Intronic
1124629513 15:31328458-31328480 CCGCCGGGCCGGATGGGCGGGGG - Intronic
1125722269 15:41851003-41851025 CCGCTGAGCCAGGTGGCTGCTGG + Intronic
1126348310 15:47718575-47718597 ACCGGGAGCCGGGTGGGCGGTGG - Exonic
1128099839 15:64989735-64989757 CCGTGGAGGCGGCTGGGCCCGGG + Exonic
1128526769 15:68417631-68417653 CCGCAGGGCCTGGTGGGCCCTGG - Intronic
1129082336 15:73052234-73052256 GCGCGGAGCCGAGGGGGTGCGGG + Intronic
1129523124 15:76198227-76198249 CTGCAGAGCCGGGTTGGCCCTGG + Intronic
1129791204 15:78341629-78341651 CCAGGGACCCGGGCGGGCGCGGG - Intronic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1132522335 16:397488-397510 CCGCAGAGCCGGACGGGCACTGG - Intronic
1132542962 16:519921-519943 CCGTGGGGCAGGCTGGGCGCAGG - Intronic
1132552923 16:560701-560723 TCGCGGGGCCGGCTGGACGCGGG + Intronic
1132583258 16:694807-694829 CCCCGGAGCCGGGAGGCGGCTGG + Intronic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1133038312 16:3046685-3046707 CCGCTGGGTCGGGTGGGCCCGGG - Exonic
1133285565 16:4689009-4689031 CCTCGGAGCCTGGTGGCCACAGG - Exonic
1134024670 16:10944730-10944752 TCGCGGAGCTGGGTGGGCGGGGG + Exonic
1135404760 16:22190258-22190280 CCGTGGAGCCGCGGGGCCGCCGG - Exonic
1137257581 16:46789916-46789938 GGGCGGAGCTGGGTGGGCGGTGG - Intronic
1137300564 16:47144115-47144137 GCTGGGAGCCGGCTGGGCGCGGG + Intergenic
1137475973 16:48810719-48810741 CCCCGGGCCTGGGTGGGCGCAGG - Intergenic
1139890602 16:70251308-70251330 TCCAGGAGCCAGGTGGGCGCGGG + Exonic
1141709148 16:85687982-85688004 ACGCAAAGCCGGGCGGGCGCGGG + Intronic
1141765921 16:86060088-86060110 CCGCGGAGCAGGGAGGGCCCTGG - Intergenic
1142114157 16:88347795-88347817 CCCAGGAGGCGGGTGGGTGCTGG - Intergenic
1142199867 16:88755948-88755970 CCTCGGAGCGGGGAGGGCGGGGG + Intronic
1142263753 16:89054288-89054310 CTGGGGAGCAGGGTGGCCGCAGG - Intergenic
1143247748 17:5500567-5500589 GCGCGGGACGGGGTGGGCGCAGG - Intronic
1143747095 17:9002974-9002996 CAGGGGAGCCGGGTGGCCGCGGG + Intergenic
1144828959 17:18121296-18121318 GCGGCGAGCCGGGTGGGCCCAGG - Exonic
1145251917 17:21301447-21301469 CCGCCAAGCCGGGTGGGTGTGGG + Intronic
1147258832 17:39197204-39197226 CTGCGGAGCGGGGAGGGGGCGGG - Intronic
1148021681 17:44557658-44557680 CCAAGGAGCCGGGTGGGGGGCGG + Exonic
1148081101 17:44968089-44968111 GCGCGGAGCCTGGGGAGCGCCGG + Intergenic
1148132440 17:45270339-45270361 CAGAGGAGGCAGGTGGGCGCAGG - Intronic
1148406913 17:47423875-47423897 TCCCGGAGCAGGGTGGGCGGCGG - Intronic
1148582423 17:48752922-48752944 CCGGGGTGCCGGGTGGGGGCAGG + Intergenic
1148733450 17:49851425-49851447 CCAGGGCGCCGGGTGGGCGCAGG + Intergenic
1149430361 17:56592698-56592720 GCGCGGAGCCGGGCGGGCTAGGG + Intergenic
1150784675 17:68152662-68152684 CCGCAGACCCGGGTGGTCCCAGG + Intergenic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1152891367 17:82883465-82883487 CCAAGGAGCCTGGTGGGGGCCGG + Intronic
1152924096 17:83079732-83079754 CCGGCGAGCCGGGCGGGGGCGGG - Exonic
1156171845 18:34494371-34494393 CGGCGGGGGCGGGTGGGCACGGG + Intronic
1156275701 18:35581422-35581444 GCGCGCATCCGGGTGAGCGCCGG + Intronic
1157094874 18:44679206-44679228 CCGGGGAGCGGGAGGGGCGCTGG + Intergenic
1159028509 18:63208342-63208364 TCGGGGAGCCGGGTGGGCGGGGG - Intronic
1159511203 18:69400674-69400696 CCGGGGAGCCGGGTGGGGAGCGG + Intergenic
1160745439 19:709100-709122 CCGCGGTGCCGGGCGGGGGCGGG - Exonic
1160831185 19:1105534-1105556 CCGCAGAGGCGGGTGGGTGGGGG + Intronic
1160874135 19:1289535-1289557 CCTCAGAGCAGGGTGGACGCAGG + Intronic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1161164940 19:2781649-2781671 CCTCGGAGCTGGGTGGTCTCGGG - Intronic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161637033 19:5395366-5395388 CGGTGGAGCCCGGTGGGGGCCGG + Intergenic
1161770699 19:6229193-6229215 AAGCGGAGCCAGGAGGGCGCTGG + Intronic
1161865313 19:6828715-6828737 CGGTGGAGCCGGGTGGGCCAGGG + Intronic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1163282098 19:16324566-16324588 CCGGGGAGACGGGCGGGGGCGGG + Intergenic
1163329513 19:16627782-16627804 CCCCGAAGCCCGGTGGGCGAGGG + Intronic
1163597073 19:18226381-18226403 CCGGGGACCGGGGCGGGCGCGGG + Intronic
1163830329 19:19544483-19544505 CCGCGGAGCCGGGCGCACGGAGG - Exonic
1164639200 19:29812205-29812227 CCGGGGAGCTGGGTGGGGGCGGG + Intronic
1164648101 19:29873618-29873640 GCGCGGGGCCGGGTCGGAGCGGG - Intergenic
1165305647 19:35000900-35000922 CCGCGGAGCCCTGGGCGCGCCGG + Intronic
1165386623 19:35513883-35513905 TCGGGGAGCTGGGTGGGGGCAGG + Intergenic
1165851440 19:38852194-38852216 CCGAGCAGCGGGGTGGGGGCGGG - Intronic
1166294647 19:41883105-41883127 CGGAGGTGCCGGGCGGGCGCGGG + Intergenic
1166790418 19:45395781-45395803 CCGCGGAGCCCAGCGAGCGCCGG + Exonic
1166836047 19:45668721-45668743 ACGTGGAGCCGCGGGGGCGCGGG + Intronic
1167080763 19:47274895-47274917 GCGCGGAGCCGAGTGGGCTGCGG + Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167613293 19:50517546-50517568 CGGCGGGGCCGGGCGGGCGAGGG - Exonic
1167743623 19:51338950-51338972 CCGCTGAGCCGGGGGTGGGCGGG + Exonic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926154955 2:10448470-10448492 GCGCGGAGCTGGTGGGGCGCCGG + Exonic
926189964 2:10721332-10721354 CGGCTGAGCCGGGTGGGAGTCGG - Intergenic
926784707 2:16508224-16508246 GCGCCGAGCCGGGCGGGAGCGGG - Intergenic
927472356 2:23385716-23385738 CCGGGGTCGCGGGTGGGCGCAGG - Exonic
927714077 2:25341524-25341546 GCCCGGAGCCGGGCGGGGGCGGG + Intronic
927809466 2:26173426-26173448 CCGGGGAGCTGGGAGGGTGCGGG - Intronic
929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG + Intergenic
930700820 2:54456654-54456676 CCGGGGAGCCGCGTGGGGGCAGG + Intronic
931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG + Intronic
931804078 2:65787974-65787996 CCGAGGAGCAGGGTGGGGGTTGG - Intergenic
932495749 2:72144969-72144991 TGGCGGAGCCGGCCGGGCGCGGG + Intronic
935112459 2:100105244-100105266 CGGCGGACCCGGGTGGGTGCGGG + Intronic
936581477 2:113704460-113704482 CCGCGGAGCAGGGGGCGCTCTGG + Intergenic
938177202 2:129144552-129144574 GCGCAGTTCCGGGTGGGCGCGGG - Intergenic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941112114 2:161427167-161427189 CCGGGGAGCCAGGGGGGTGCCGG + Intronic
941816297 2:169799133-169799155 CGGCGGAGCCGAGGGGGCGCGGG + Intronic
942447248 2:176086148-176086170 CTGCGGAGCAGGGAGGGAGCAGG - Intergenic
943060497 2:183037946-183037968 CGGCGGAGGCGGGCGGGCCCGGG - Intronic
946692527 2:222319989-222320011 CCCGGGAGCCGGGAGGGAGCTGG - Intergenic
946727117 2:222671727-222671749 CCGCAGAGCAGCGTGGGTGCAGG + Intronic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
947735797 2:232454758-232454780 CCGGGAAGCCAGGAGGGCGCAGG + Intergenic
948927842 2:241110795-241110817 CCCTAGAGCCTGGTGGGCGCTGG - Intronic
949004325 2:241636892-241636914 CCGCAGGGCCGGGTCGGGGCGGG + Intronic
1168878165 20:1185288-1185310 CGGCGCAGCCCGGAGGGCGCGGG + Intronic
1169113166 20:3046078-3046100 GCGCTGAGCCGCCTGGGCGCGGG + Exonic
1170026024 20:11890841-11890863 CCGCCGAGCCCGCCGGGCGCTGG + Exonic
1171175892 20:23050489-23050511 CTGCGGCGCCGGGTAGGGGCGGG + Intergenic
1172284660 20:33732177-33732199 CCGCGGGGCGGGAGGGGCGCGGG + Intronic
1172474452 20:35226654-35226676 GCGCGGAGGCGGGGGCGCGCTGG + Exonic
1172702662 20:36862816-36862838 CCGGGGAGGCGGGCGGCCGCGGG + Exonic
1172864826 20:38087915-38087937 CTGCGGAGCCTGGTGGATGCTGG + Intronic
1174339667 20:49887891-49887913 CCTCGGAGCCGGAGGGGCCCTGG - Exonic
1175470316 20:59222715-59222737 CCGCGGAGCGAGGAGGGAGCCGG - Intronic
1175715617 20:61252773-61252795 CGGCGGAGCAGGGTGGGAGTGGG + Intronic
1175794315 20:61762042-61762064 CAGCAGAGCCAGGTGGGCCCTGG - Intronic
1175889944 20:62311594-62311616 GCGGTGAGCCTGGTGGGCGCTGG - Exonic
1175968477 20:62671900-62671922 CGCCGTGGCCGGGTGGGCGCGGG - Exonic
1175975530 20:62708703-62708725 GCGCAGAGCCGGGAGGGCGCGGG + Intergenic
1176048048 20:63102803-63102825 CAGCGGGGCCGGGTGGGCTGGGG - Intergenic
1176247042 20:64102354-64102376 ACACGGGGCGGGGTGGGCGCGGG - Intergenic
1176550088 21:8217180-8217202 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176569015 21:8400215-8400237 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176576929 21:8444450-8444472 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1178900042 21:36591477-36591499 CAGGGGAGCCAGGTGGGCGATGG - Intergenic
1178916699 21:36709024-36709046 CTGCGGAGCCGGGGAGGCGGCGG + Intronic
1179982129 21:44901116-44901138 CCTCCAGGCCGGGTGGGCGCTGG - Intronic
1183577399 22:38700765-38700787 GCTGCGAGCCGGGTGGGCGCGGG - Intronic
1183586405 22:38755608-38755630 CCGCGGACCCGGGTGGAGGCTGG + Intronic
1183709263 22:39492787-39492809 CCTCTGGGCCGGGTGGGCACTGG + Intergenic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184557429 22:45240907-45240929 GAGCGGAGCCGGGGGCGCGCGGG - Intergenic
1185080679 22:48707905-48707927 CCGCGGAGCCCGGGTGGCGTCGG - Intronic
1185175763 22:49325636-49325658 CCCGGGAGCAGGGTGGGGGCAGG - Intergenic
1185281936 22:49975961-49975983 TCGGGGAGCCGGGCAGGCGCAGG + Intergenic
1185405285 22:50644730-50644752 CCAAGGAGCAGGGTGGGGGCAGG - Intergenic
1203254978 22_KI270733v1_random:133506-133528 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203263034 22_KI270733v1_random:178585-178607 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
949905149 3:8852836-8852858 CCAAGGAGCAGGGTGGGGGCTGG - Intronic
952970914 3:38649661-38649683 CCGCGGAGCCGAGACGGCGGCGG - Exonic
953631899 3:44625141-44625163 CCGGTGAGCGGGGTGGGCTCGGG + Intronic
954223981 3:49171234-49171256 CCGCGGAGGTGGGCAGGCGCCGG + Intergenic
955356656 3:58237712-58237734 GCGCGGCGCCGGGTCGGGGCGGG + Exonic
957096906 3:75785354-75785376 CCGCGGACCCTGGCGGGGGCTGG - Intronic
961301563 3:125925255-125925277 CCGGTGAGCAGGGTGGGCTCGGG + Intergenic
961365109 3:126394795-126394817 CCGCGGGACAGGGAGGGCGCGGG - Intergenic
961653024 3:128426698-128426720 GCCCGGAGACGGGTGGGCCCAGG - Intergenic
962498543 3:135966132-135966154 CCGCGGAGGAGGGTAGGCGGGGG + Intronic
964118816 3:153162097-153162119 CCGCGGGGCCGGGAGGGGGCGGG - Intergenic
964801607 3:160564955-160564977 CGGCGGAGCCGGCCCGGCGCGGG - Intronic
965404100 3:168249455-168249477 CCGCGGCGGGGGCTGGGCGCTGG - Intergenic
966402694 3:179563275-179563297 ACGGCGAGCCGGGTGGGCTCCGG - Intronic
968090550 3:195895912-195895934 GCGCGGAGCCGGCTGAGCGCAGG - Intronic
968505107 4:967869-967891 CCGCGGAGCCGGGTGAGGTGCGG - Exonic
968571933 4:1346681-1346703 CCGCCCAGACGGGCGGGCGCGGG - Intergenic
968599853 4:1503738-1503760 CCGGGGAGCCGGGGGAGCCCGGG - Intergenic
968652897 4:1767134-1767156 CCCCGGAGGCGGGCGGGCGGAGG - Intergenic
968662226 4:1803412-1803434 GCGCAGAGCCGGGCGGGTGCAGG - Intronic
969297027 4:6276239-6276261 CCCCGGACCCGGATGGGCCCTGG - Intronic
969368599 4:6716185-6716207 CTGCGCAGTCGGGTGGTCGCGGG + Exonic
969379139 4:6782882-6782904 CCCCTCGGCCGGGTGGGCGCGGG + Intronic
972204787 4:36758964-36758986 CAGCGGAGCGGGGTGGGGGGTGG - Intergenic
979455424 4:120922094-120922116 CAGCGGAGCAGCGTGCGCGCGGG + Intronic
981531950 4:145761919-145761941 CCGAGGGGCCGGGCGGGGGCTGG - Intronic
984503609 4:180589768-180589790 GCGAGGAGCCGGGCGGGGGCAGG - Intergenic
985532546 5:442734-442756 CCGCGGACTGAGGTGGGCGCCGG - Exonic
985616745 5:927251-927273 CCGCGGCTCTGGGTGGGCGCGGG + Intergenic
985696717 5:1345027-1345049 CCGCGGCGCCAGGTGGGAGCGGG - Exonic
985973362 5:3394399-3394421 CCGTGGAGCCGGGCTGGCGGCGG - Intergenic
985988395 5:3536118-3536140 CAGCGTAGCCGGGTCAGCGCGGG - Intergenic
986330524 5:6713666-6713688 ACGCGGCGCGGGGCGGGCGCGGG - Intergenic
992671909 5:79069679-79069701 CCGCGGGGCCGGCGGGGCGGGGG + Intronic
992939561 5:81750226-81750248 GGGCGGGGGCGGGTGGGCGCCGG - Intronic
996404100 5:123089874-123089896 CCGCGGAACCGGGCGGCCGCCGG + Intronic
998134672 5:139668416-139668438 CCTGGGACCCGGGCGGGCGCCGG - Intronic
998262078 5:140639391-140639413 GCGAGGAGCGGGGTGGGTGCTGG - Intronic
998583574 5:143404054-143404076 CCGCGGAGCTGGGCGGGGGCGGG - Intronic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
999328307 5:150656845-150656867 CCGCGGAGCCCGTTGCCCGCCGG + Intronic
1000351290 5:160354867-160354889 CTGGGGGGCCGGGTGGGCCCTGG + Exonic
1001633894 5:173196288-173196310 CCTCGGAGCCAGGGAGGCGCTGG + Intergenic
1002355706 5:178627226-178627248 CCCCGGGACCGGGTGGGCGGGGG - Intronic
1002580975 5:180209242-180209264 GCGCGGAGCGGGCGGGGCGCGGG + Intergenic
1002637847 5:180617000-180617022 CAGTGGAGCCAGGTGGGCTCAGG + Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003290737 6:4776486-4776508 CCGCGGGGCCGGGCGGGCTGGGG - Exonic
1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG + Intergenic
1006598537 6:35211090-35211112 CCCCTGAGCCTGGTGGGCCCTGG + Intergenic
1007432836 6:41786526-41786548 CCGCGGCGCGGGGTGGGTTCGGG - Intronic
1011762835 6:90586943-90586965 GTCCGGAGGCGGGTGGGCGCGGG - Exonic
1013330390 6:109094838-109094860 CCGCGGAGCTGGCGGGGCGGCGG + Intergenic
1013441822 6:110179278-110179300 CCGCGGATGGGGGTGGGGGCCGG + Intronic
1014230347 6:118895194-118895216 CCGCGCCGCGGGCTGGGCGCCGG + Intronic
1017737975 6:157381129-157381151 CCTCCGGGCCGGGTGGGCGGTGG - Exonic
1019279521 7:192915-192937 CCGCGGAGCCGGGCGCGCGGGGG - Intergenic
1019337903 7:493969-493991 GCGCTGAGCAGGGTGGGCGGCGG - Intergenic
1019421840 7:954354-954376 GCGCGGGGCCGGGTGGGTCCGGG - Intronic
1020130165 7:5555206-5555228 CCGAGGGGCGGGGTGGGGGCCGG - Intronic
1021998561 7:26202367-26202389 CCGCGCTCCCGGGTGGGGGCGGG + Intronic
1022410495 7:30135524-30135546 CCGGGGAGCCGGGTCGGGGCGGG + Intronic
1022578015 7:31517622-31517644 GCGCGGTTCCGGGTGGGCGTGGG - Intronic
1027361663 7:77416176-77416198 CTGCGGAGAGGGGTGGGGGCGGG - Intronic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1029207760 7:98879276-98879298 CCGCGGAGCCTGGGGGGCCCTGG - Intronic
1029708275 7:102286701-102286723 CCGCGGAGCCCGAGCGGCGCCGG - Intronic
1031846038 7:126806817-126806839 GCGCGGTTCCGGGTAGGCGCGGG - Intronic
1033253112 7:139777557-139777579 CCGCGGAGGGCGGCGGGCGCGGG + Intronic
1034244760 7:149635932-149635954 CCGGGGACCGGGGTGGGCGGGGG - Intergenic
1034446108 7:151115086-151115108 CGGCTGCGCCGGGTCGGCGCGGG - Intronic
1034470461 7:151251898-151251920 CCGGGGAGCTGGGGGGGCTCGGG + Intronic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1035751631 8:2001148-2001170 CTGCGGAACCGGGGGCGCGCGGG + Exonic
1036381169 8:8237414-8237436 CCGGTGAGCAGGGTGGGCTCGGG + Intergenic
1036848396 8:12185214-12185236 CCGGTGAGCAGGGTGGGCTCGGG - Intronic
1036869756 8:12427495-12427517 CCGGTGAGCAGGGTGGGCTCGGG - Intronic
1037829537 8:22179512-22179534 CCACGGAGCAGGGTGGCTGCTGG + Intronic
1040495168 8:47959962-47959984 CCGCGGTGCTGGGTGGGTACCGG - Exonic
1041145861 8:54875270-54875292 TGGCGGTTCCGGGTGGGCGCGGG + Intergenic
1041753570 8:61288292-61288314 CCGCGGAGGCGGCGGGGAGCGGG - Intronic
1042246410 8:66712822-66712844 CCGCGGGGCCAGGTAGGTGCGGG + Intronic
1043472732 8:80578446-80578468 ACGGGGAGCCGGGTAGGAGCGGG - Intergenic
1044250678 8:90001441-90001463 CGGCGCAGGCGGTTGGGCGCAGG - Exonic
1044692654 8:94895396-94895418 CCGTGGAGCGCGGTGGACGCGGG - Intronic
1045510106 8:102806994-102807016 CCACGGAGACGGCTGGGCGGGGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049423405 8:142526674-142526696 CCCCGGGGCTGGGTGGGCTCTGG - Intronic
1049442196 8:142614612-142614634 CCCGGGAGCCGAGTGGGCGCAGG - Intergenic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049625398 8:143617536-143617558 CCGCGGAGCCAGGTGGGGGGCGG + Exonic
1049680567 8:143916149-143916171 ATGCAGAGCGGGGTGGGCGCAGG + Exonic
1049792356 8:144477950-144477972 CCGCGGTGCCCCGTGGGAGCCGG - Intronic
1052997784 9:34560164-34560186 CTGAGGGGCCGGGTGGGCGGAGG + Intronic
1053072900 9:35111516-35111538 GCGCGGAGCCGGGGCGGCCCCGG - Exonic
1055321743 9:75088809-75088831 GCTCGGGGCCGGGTGCGCGCCGG - Intronic
1056560631 9:87726377-87726399 CCTCCGAGCCGGGTGGACACAGG + Exonic
1057294619 9:93827872-93827894 CCGGGGGGCGGGCTGGGCGCCGG + Intergenic
1057300744 9:93880232-93880254 CCGTGGAGCAGGGTGGGGGGGGG - Intergenic
1057547265 9:96027625-96027647 CCGGGGGGACGGGTGGGCGCTGG - Intergenic
1057684772 9:97222058-97222080 AGGAGGAGCCGGGTGGGGGCAGG - Intergenic
1058537573 9:105977906-105977928 CCGAGGAGCAGGGTGGGGGCCGG + Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060106768 9:120877400-120877422 CTGCGGAGCCCGGCGGCCGCGGG - Intronic
1061275872 9:129569159-129569181 CCCCGGCTCCGGGTGGGCGCGGG + Intergenic
1061587706 9:131579345-131579367 CAGCGGGGCCGGGCGGGAGCTGG - Exonic
1062426620 9:136508998-136509020 CCGTGAAGCCGGGTGGACACAGG + Exonic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1203471380 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203479201 Un_GL000220v1:160624-160646 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1185736596 X:2500765-2500787 CCGGGGACCCGGGTGGGCGCGGG - Intronic
1185749657 X:2600684-2600706 CCTCGGAGCCGGCTGGGGGAAGG - Intergenic
1186486052 X:9935220-9935242 CCCGGGAGCCGGGGGGGCGGGGG + Intronic
1190745896 X:53321448-53321470 CGGGCGAGCCGGGTGGGGGCAGG - Intergenic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic