ID: 900516919

View in Genome Browser
Species Human (GRCh38)
Location 1:3086537-3086559
Sequence CAAGGCAGCCCGGCGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1716
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 1672}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900516919_900516933 22 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516933 1:3086582-3086604 TGTCTGGAAGCACAAGGGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 309
900516919_900516927 6 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516927 1:3086566-3086588 GGATGCTTCCTGGTCCTGTCTGG 0: 1
1: 0
2: 1
3: 18
4: 183
900516919_900516935 27 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516935 1:3086587-3086609 GGAAGCACAAGGGCTGGGAAGGG 0: 1
1: 1
2: 1
3: 44
4: 556
900516919_900516932 21 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516932 1:3086581-3086603 CTGTCTGGAAGCACAAGGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 238
900516919_900516929 16 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516929 1:3086576-3086598 TGGTCCTGTCTGGAAGCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 228
900516919_900516936 30 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516936 1:3086590-3086612 AGCACAAGGGCTGGGAAGGGAGG 0: 1
1: 2
2: 2
3: 54
4: 780
900516919_900516930 17 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516930 1:3086577-3086599 GGTCCTGTCTGGAAGCACAAGGG 0: 1
1: 0
2: 0
3: 18
4: 159
900516919_900516934 26 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516934 1:3086586-3086608 TGGAAGCACAAGGGCTGGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 401
900516919_900516926 -4 Left 900516919 1:3086537-3086559 CCTCCTCCCGCCGGGCTGCCTTG 0: 1
1: 0
2: 4
3: 39
4: 1672
Right 900516926 1:3086556-3086578 CTTGTCATCTGGATGCTTCCTGG 0: 1
1: 1
2: 1
3: 21
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900516919 Original CRISPR CAAGGCAGCCCGGCGGGAGG AGG (reversed) Intronic
900516919 1:3086537-3086559 CAAGGCAGCCCGGCGGGAGGAGG - Intronic
901030830 1:6305828-6305850 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
901100627 1:6715913-6715935 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
901224067 1:7601580-7601602 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
901270870 1:7952425-7952447 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
901324128 1:8356874-8356896 CAGGGCAGCATGGCTGGAGGTGG - Intronic
901341145 1:8500566-8500588 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
901555498 1:10028698-10028720 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
901800277 1:11704464-11704486 TGAGGCAGCCCAGGGGGAGGAGG - Intronic
901849983 1:12008847-12008869 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
901855698 1:12043030-12043052 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
901869024 1:12126657-12126679 CAAGTCAGCCCAGGGGCAGGAGG + Intronic
902014888 1:13299019-13299041 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
902018548 1:13327991-13328013 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
902027608 1:13395325-13395347 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
902062500 1:13657746-13657768 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
902293437 1:15449964-15449986 TAATGCAGCCCGGATGGAGGCGG + Intergenic
903103301 1:21052937-21052959 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
903426350 1:23257169-23257191 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
903458218 1:23503625-23503647 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
903508052 1:23852832-23852854 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
903519316 1:23935338-23935360 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
903531314 1:24032517-24032539 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
903633815 1:24799001-24799023 CAAGGCAGACGGCTGGGAGGTGG - Intronic
903638088 1:24834463-24834485 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
903748347 1:25603616-25603638 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
903921732 1:26804494-26804516 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
903962000 1:27063766-27063788 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
903993446 1:27289624-27289646 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
904463117 1:30692273-30692295 GAAGGAAGCCCAGAGGGAGGAGG + Intergenic
904696965 1:32336236-32336258 ATAGGCAGCTCGGCGGGCGGCGG - Exonic
904701808 1:32362277-32362299 CAGGGCAACCCGCCGCGAGGCGG + Exonic
904761104 1:32804872-32804894 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
904804701 1:33122657-33122679 CAAGGCAGCCAGGAGGCATGAGG - Intergenic
904930193 1:34081756-34081778 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
905039926 1:34947783-34947805 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
905042106 1:34968248-34968270 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
905315491 1:37080135-37080157 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
905427245 1:37895869-37895891 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
905526967 1:38647165-38647187 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
905599272 1:39235145-39235167 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
905673382 1:39808041-39808063 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
905680761 1:39869459-39869481 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
905686732 1:39913655-39913677 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
905699221 1:39999399-39999421 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
906025355 1:42668920-42668942 GAAAACAGCCCGGCAGGAGGTGG + Intronic
906136770 1:43505540-43505562 GCAGGCAGTCCGGCTGGAGGTGG + Intergenic
906308743 1:44738398-44738420 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
906329860 1:44876137-44876159 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
906353285 1:45081667-45081689 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
906355704 1:45105305-45105327 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
906357112 1:45115892-45115914 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
906370265 1:45247826-45247848 CAAGGCAGTCAGCTGGGAGGTGG - Intronic
906399936 1:45497583-45497605 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
906427089 1:45724335-45724357 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
906762023 1:48383978-48384000 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
906770512 1:48479094-48479116 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
906956723 1:50381369-50381391 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
907009741 1:50952464-50952486 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
907140461 1:52181439-52181461 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
907402344 1:54232937-54232959 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
908370094 1:63472831-63472853 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
908446041 1:64200818-64200840 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
908467751 1:64414605-64414627 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
909641244 1:77870723-77870745 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
910407065 1:86900227-86900249 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
910412812 1:86964277-86964299 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
910777626 1:90892181-90892203 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
910815822 1:91289501-91289523 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
910891765 1:92026525-92026547 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
911325960 1:96470232-96470254 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
911351896 1:96763217-96763239 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
911486799 1:98513251-98513273 CAAGGCAGGCGGTTGGGAGGTGG + Intergenic
911569669 1:99507907-99507929 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
911598482 1:99823311-99823333 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
911602144 1:99857451-99857473 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
912266275 1:108160589-108160611 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
912303044 1:108536457-108536479 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
912316876 1:108675426-108675448 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
912355663 1:109053006-109053028 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
912358319 1:109073721-109073743 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
912371555 1:109177580-109177602 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
912591395 1:110824447-110824469 CAAGGCAGCAAGGCGGGTGGGGG + Intergenic
912669190 1:111608540-111608562 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
912751582 1:112292935-112292957 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
912844137 1:113064016-113064038 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
912966582 1:114242218-114242240 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
913021251 1:114791104-114791126 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
913993651 1:143637429-143637451 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
914230874 1:145764270-145764292 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
914231635 1:145767612-145767634 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
914264656 1:146028043-146028065 CGAGGCAGGCGGCCGGGAGGTGG - Intergenic
914374504 1:147061640-147061662 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
914392077 1:147232855-147232877 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
914468431 1:147950572-147950594 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
914780480 1:150781221-150781243 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
914787847 1:150850638-150850660 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
914887897 1:151599946-151599968 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
914893945 1:151651841-151651863 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
914909078 1:151769714-151769736 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
914954046 1:152145277-152145299 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
914960002 1:152196863-152196885 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
914965916 1:152256788-152256810 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
914987423 1:152472417-152472439 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
915112688 1:153574830-153574852 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
915113774 1:153582668-153582690 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
915208283 1:154287276-154287298 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
915502243 1:156327644-156327666 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
915672851 1:157504744-157504766 CGAGACAGCCAGGCGGGAGAGGG + Intergenic
915861472 1:159449553-159449575 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
915992504 1:160531762-160531784 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
916049951 1:161029321-161029343 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
916223324 1:162465759-162465781 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
916324937 1:163546155-163546177 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
916335529 1:163666796-163666818 CAAGGCAGCCAGGTAGAAGGAGG - Intergenic
916671915 1:167029602-167029624 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
916759918 1:167806645-167806667 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
916864041 1:168837109-168837131 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
917006074 1:170418609-170418631 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
917205849 1:172571415-172571437 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
917304501 1:173612947-173612969 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
917553214 1:176057691-176057713 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
917583251 1:176397242-176397264 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
917724298 1:177814282-177814304 CAGGGCTGCCCAGGGGGAGGAGG + Intergenic
917848541 1:179041295-179041317 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
917859784 1:179135086-179135108 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
917889247 1:179419256-179419278 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
918022830 1:180711253-180711275 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
918221511 1:182440270-182440292 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
918255457 1:182742378-182742400 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
919423792 1:197405432-197405454 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
919486868 1:198157125-198157147 CGGGGCGGCGCGGCGGGAGGTGG + Exonic
919625360 1:199904979-199905001 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
919926003 1:202192125-202192147 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
919959516 1:202452189-202452211 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
919995022 1:202740384-202740406 CAGGGCAGCCGGCCGGGTGGGGG + Intronic
920032179 1:203044118-203044140 CAGGGCAGCCTGGCTGGATGTGG - Intronic
920144007 1:203842238-203842260 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
920152578 1:203920316-203920338 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
920167131 1:204043963-204043985 CATGGCAGGCCGGGGGGTGGGGG - Intergenic
920435406 1:205943740-205943762 CAAGGCGGCCCTGGAGGAGGGGG + Intergenic
920451410 1:206063748-206063770 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
920794834 1:209128834-209128856 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
921043816 1:211460083-211460105 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
921109054 1:212014899-212014921 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
921142792 1:212321827-212321849 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
921197990 1:212778755-212778777 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
921238493 1:213152879-213152901 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
921638538 1:217524500-217524522 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
921813946 1:219545359-219545381 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
921902888 1:220467157-220467179 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
922278416 1:224100573-224100595 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
922306624 1:224350303-224350325 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
922436861 1:225615399-225615421 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
922693295 1:227711491-227711513 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
922993095 1:229932205-229932227 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
923117868 1:230960747-230960769 TGAGGCAGCCAGGCTGGAGGAGG + Intronic
923136993 1:231128256-231128278 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
923174788 1:231453910-231453932 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
923228607 1:231962825-231962847 CCAGGCAGCCAGGTGGGTGGTGG - Intronic
923267835 1:232331425-232331447 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
923468353 1:234268094-234268116 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
923710672 1:236386269-236386291 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
923716463 1:236428775-236428797 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
923793133 1:237128024-237128046 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
923840959 1:237669928-237669950 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
923913858 1:238481462-238481484 TAAGACAGCCAGGTGGGAGGGGG - Intergenic
924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG + Intronic
924634729 1:245775058-245775080 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
924692167 1:246362818-246362840 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
924765878 1:247031921-247031943 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
924788308 1:247220346-247220368 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
924824040 1:247521736-247521758 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
924925544 1:248676658-248676680 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
924943650 1:248830126-248830148 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1063084777 10:2806619-2806641 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1063459683 10:6207077-6207099 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1063744833 10:8868736-8868758 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1063776882 10:9273778-9273800 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1064109201 10:12523384-12523406 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1064367340 10:14719741-14719763 CAAGGCCACCTGGCAGGAGGAGG - Intronic
1065055237 10:21837267-21837289 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1065737956 10:28771524-28771546 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1065756327 10:28934581-28934603 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1065840259 10:29696308-29696330 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1066085214 10:31969437-31969459 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1066140615 10:32500686-32500708 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1066390812 10:34976312-34976334 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1066818803 10:39456336-39456358 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1067086427 10:43242887-43242909 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1067114313 10:43422988-43423010 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1067117541 10:43446833-43446855 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1067280163 10:44865076-44865098 CAGGGCAGCCCTCTGGGAGGCGG - Intergenic
1067325081 10:45259669-45259691 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1067339674 10:45391449-45391471 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1067354362 10:45511764-45511786 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1067391344 10:45866004-45866026 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1067871945 10:49970148-49970170 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1067912000 10:50355629-50355651 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1068667888 10:59696460-59696482 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1068673148 10:59744019-59744041 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1068967658 10:62929160-62929182 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1068969492 10:62947381-62947403 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1069157746 10:65052094-65052116 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1069365544 10:67691248-67691270 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1069645560 10:69993511-69993533 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1069675043 10:70240364-70240386 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1069878673 10:71578512-71578534 CAAGGCAGCTGGGCGGCAAGGGG - Intronic
1069929077 10:71870084-71870106 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1069930155 10:71876335-71876357 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1070319368 10:75343342-75343364 CAAGGCATCACGGCTGGAGGTGG + Intergenic
1070367543 10:75750955-75750977 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1070629768 10:78076306-78076328 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1070650052 10:78228791-78228813 CAACCCAGCCCATCGGGAGGTGG - Intergenic
1070684257 10:78469323-78469345 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1070807618 10:79279603-79279625 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1071289829 10:84180726-84180748 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1071311582 10:84348092-84348114 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1071538217 10:86454589-86454611 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1071616357 10:87080294-87080316 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1072013567 10:91323928-91323950 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1072291610 10:93970396-93970418 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1072602509 10:96942081-96942103 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1072629201 10:97134063-97134085 CAGGGCTGCCCGCTGGGAGGTGG - Intronic
1072684727 10:97529403-97529425 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1072730240 10:97841366-97841388 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1072772292 10:98152309-98152331 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1072980059 10:100092536-100092558 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1072999577 10:100276858-100276880 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1073035243 10:100560299-100560321 GAAGACAGCCTGGCTGGAGGGGG - Intergenic
1073238126 10:102035760-102035782 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1073274956 10:102301904-102301926 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1073450572 10:103606851-103606873 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1073930128 10:108566375-108566397 CATGGCAGCCCCCAGGGAGGCGG - Intergenic
1074048170 10:109858228-109858250 CAAGGCAGACAGGCTGGAGATGG + Intergenic
1074587905 10:114786851-114786873 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1075013697 10:118895287-118895309 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1075051105 10:119182839-119182861 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1075061765 10:119261538-119261560 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1075128702 10:119721703-119721725 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1075129385 10:119725718-119725740 CAAGGCCGCGCGGAGGGAGGCGG + Intergenic
1075137307 10:119795717-119795739 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1075181551 10:120215681-120215703 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1075243294 10:120798298-120798320 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1075407394 10:122203797-122203819 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1075676672 10:124300604-124300626 CACGGCTGCCTGGGGGGAGGGGG - Intergenic
1075842687 10:125518125-125518147 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1075893020 10:125970469-125970491 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1076156254 10:128207785-128207807 CCAGGCAGACCCACGGGAGGGGG - Intergenic
1076221273 10:128734915-128734937 CAGGGCAGCCGGGTGGGTGGGGG + Intergenic
1076362485 10:129899070-129899092 CAAGGCTGCGCGGAGGCAGGAGG - Intronic
1076914439 10:133414805-133414827 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1077058993 11:609593-609615 GGAGGCAGCCCGGCCTGAGGAGG + Exonic
1077079613 11:719398-719420 CACGGCAGCTTGGCTGGAGGAGG + Intronic
1077134972 11:993994-994016 CAAGCCAGCCCGAAGGGCGGGGG - Intronic
1077201362 11:1309200-1309222 GGAGGCAGCCCCGGGGGAGGGGG - Intronic
1077344080 11:2038432-2038454 GAAGGCTGCACGGCAGGAGGTGG + Intergenic
1077407069 11:2387463-2387485 AGATGCAGCCTGGCGGGAGGAGG - Intronic
1077613578 11:3659912-3659934 CAATGCAGCCGTGCGTGAGGCGG + Exonic
1077836973 11:5934362-5934384 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1077839570 11:5960615-5960637 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1078176770 11:8977729-8977751 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1079018231 11:16887750-16887772 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1079020484 11:16906681-16906703 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1079242345 11:18729599-18729621 CAGGGCAGCCCAGCGGGTGGGGG + Intronic
1079372116 11:19860670-19860692 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1079444715 11:20548102-20548124 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
1079450708 11:20597875-20597897 AGCGACAGCCCGGCGGGAGGTGG + Intergenic
1079479377 11:20863747-20863769 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1080405069 11:31971650-31971672 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1080538290 11:33243442-33243464 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1080620779 11:33985910-33985932 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1080647063 11:34195062-34195084 CAAAGATGCCCGGCGGGGGGGGG + Intronic
1080859958 11:36144285-36144307 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1082006172 11:47420346-47420368 CAAGGCGGCCCGAGCGGAGGAGG + Exonic
1082064992 11:47892645-47892667 CAAGGCAGGCGGCTGGGAGGCGG - Intergenic
1082166557 11:48956166-48956188 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1082706116 11:56496909-56496931 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1082871106 11:57944273-57944295 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1083030134 11:59584992-59585014 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1083042176 11:59699403-59699425 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1083079288 11:60073573-60073595 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1083091334 11:60201790-60201812 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1083114877 11:60451041-60451063 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1083118787 11:60491262-60491284 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1083120697 11:60509959-60509981 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1083208370 11:61166894-61166916 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1083865352 11:65450751-65450773 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1083918108 11:65763308-65763330 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1084206668 11:67598492-67598514 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1084338511 11:68476102-68476124 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1084388699 11:68861206-68861228 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1084624560 11:70296321-70296343 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1084787193 11:71449088-71449110 CGAGGCAGCCCTGGAGGAGGGGG + Intronic
1084924921 11:72503180-72503202 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1084989421 11:72909391-72909413 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1085073625 11:73571602-73571624 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1085097704 11:73774777-73774799 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1085112163 11:73897821-73897843 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1085116826 11:73937312-73937334 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1085139800 11:74129714-74129736 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1085292603 11:75410628-75410650 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1085443443 11:76582945-76582967 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1085480768 11:76821166-76821188 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1085492604 11:76934327-76934349 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1085563088 11:77489805-77489827 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1085593903 11:77790876-77790898 GAAAGCAGCCAGGAGGGAGGAGG - Intronic
1085754380 11:79191483-79191505 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1085791221 11:79499611-79499633 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086017106 11:82181559-82181581 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086104357 11:83132985-83133007 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086122718 11:83317436-83317458 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1086430417 11:86731922-86731944 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086434936 11:86771107-86771129 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1086446730 11:86878619-86878641 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1086697149 11:89860376-89860398 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086709010 11:89984111-89984133 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1086792723 11:91063212-91063234 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1086881378 11:92157243-92157265 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1086923828 11:92618191-92618213 CAAGGCAGCAAGGCTGGGGGAGG - Intronic
1087487091 11:98770394-98770416 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1088116387 11:106317905-106317927 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1088257012 11:107912161-107912183 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1088659050 11:112027539-112027561 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1088829589 11:113524014-113524036 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1089139735 11:116275989-116276011 CCAGGGAGCCCCGCGGGACGTGG + Intergenic
1089148352 11:116346759-116346781 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1089421227 11:118332365-118332387 CAAGGCAGACGGCTGGGAGGTGG + Intergenic
1089510260 11:118992157-118992179 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1089520500 11:119059569-119059591 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1090152885 11:124403752-124403774 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1090686579 11:129128939-129128961 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1090762275 11:129848156-129848178 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1090785573 11:130044520-130044542 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1090907003 11:131084784-131084806 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1091309339 11:134561490-134561512 AAACGCAGCCCTGAGGGAGGAGG - Intergenic
1202827066 11_KI270721v1_random:93621-93643 GAAGGCTGCACGGCAGGAGGTGG + Intergenic
1091378462 12:41611-41633 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1091586098 12:1817840-1817862 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1092185601 12:6476056-6476078 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1092296146 12:7200529-7200551 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1092331592 12:7590784-7590806 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1092453435 12:8624715-8624737 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1092827970 12:12415188-12415210 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1092843722 12:12565766-12565788 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1092850103 12:12618670-12618692 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1093038410 12:14354429-14354451 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1093893700 12:24553438-24553460 CAAGGCAGCCCTGCACGATGGGG - Intergenic
1093927736 12:24925946-24925968 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1094103145 12:26784698-26784720 CAAGGCAGGCGGTTGGGAGGTGG - Intronic
1094107922 12:26833173-26833195 CACAGCCGCCCGGCGGGAGCTGG + Exonic
1094169747 12:27479416-27479438 CAAGGCAGCCCTGCTGCTGGAGG + Intronic
1094209307 12:27873688-27873710 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1094239170 12:28201667-28201689 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1094670463 12:32563640-32563662 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1094717060 12:33023268-33023290 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1095114000 12:38330912-38330934 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1095281209 12:40353623-40353645 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1095452937 12:42350604-42350626 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1095646920 12:44558520-44558542 CAGGGCTGGTCGGCGGGAGGGGG + Intronic
1095774784 12:46000015-46000037 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1096044562 12:48551595-48551617 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1096054702 12:48641720-48641742 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1096082292 12:48841817-48841839 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1096093123 12:48916239-48916261 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1096167676 12:49437468-49437490 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1096224862 12:49860585-49860607 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1096441003 12:51644591-51644613 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1096556914 12:52409428-52409450 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1096856774 12:54488882-54488904 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1096968767 12:55648798-55648820 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1097089699 12:56495003-56495025 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1097127221 12:56784316-56784338 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1097128220 12:56790192-56790214 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1097138415 12:56879092-56879114 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1097149002 12:56963203-56963225 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1097228718 12:57495640-57495662 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1097230649 12:57508300-57508322 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1097254691 12:57664827-57664849 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1097779454 12:63686514-63686536 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1098212508 12:68181466-68181488 CAAGGCTGCCAGGTGTGAGGTGG + Intergenic
1098371020 12:69760019-69760041 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1098379642 12:69853986-69854008 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1098412493 12:70201484-70201506 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1098883631 12:75941399-75941421 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1099255644 12:80308606-80308628 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1099672850 12:85717385-85717407 GAAAGCAGCCAGGAGGGAGGCGG - Intergenic
1099971244 12:89503471-89503493 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1100507663 12:95236062-95236084 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1100570866 12:95842018-95842040 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1100577720 12:95908101-95908123 CAAGGCAGGCTGCCGGGAGGTGG + Intronic
1101885081 12:108655736-108655758 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1102186471 12:110951495-110951517 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1102237644 12:111304215-111304237 TGAGGCTGCCCAGCGGGAGGTGG + Exonic
1102294320 12:111724444-111724466 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1102469801 12:113153261-113153283 CCAGGCGGGCCGTCGGGAGGTGG + Exonic
1102656370 12:114485255-114485277 CAAGGCAGGCGGCCGGAAGGTGG + Intergenic
1103045293 12:117730864-117730886 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1103208821 12:119151766-119151788 CAAGACAGGCCTGCTGGAGGAGG - Intronic
1103234613 12:119360775-119360797 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1103414180 12:120732861-120732883 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1103456931 12:121075695-121075717 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1103463678 12:121124848-121124870 GAAGGCAGGCAGGTGGGAGGTGG - Intergenic
1103527189 12:121576872-121576894 CAGGGCAGCCTTGGGGGAGGAGG + Intronic
1103536020 12:121634344-121634366 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1103641591 12:122356994-122357016 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1103720099 12:122969178-122969200 CATGGCAGCCGGGGGGGGGGGGG - Intronic
1103729046 12:123013865-123013887 CAAGGCAGCCCTGCGGGTGGTGG - Exonic
1103872757 12:124102582-124102604 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1104470549 12:129026294-129026316 CAAGGCAGCATGGCTGGGGGAGG + Intergenic
1104712979 12:130997843-130997865 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1104861530 12:131926704-131926726 CAAGGCAGGCGGGTGGGAGGTGG + Intergenic
1104947338 12:132421984-132422006 CAAGGCACCCCCTCAGGAGGCGG + Intergenic
1105692945 13:22859541-22859563 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1105808509 13:23973020-23973042 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1105921881 13:24970827-24970849 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1105980680 13:25513596-25513618 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1106104651 13:26723503-26723525 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1106117764 13:26831712-26831734 CAGGGCAGCCTGCCTGGAGGAGG - Intergenic
1106560319 13:30840245-30840267 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1106746699 13:32716015-32716037 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1106747801 13:32721996-32722018 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1106799433 13:33241896-33241918 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1107042747 13:35966860-35966882 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1107165725 13:37280009-37280031 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1107492998 13:40900105-40900127 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1107562595 13:41571704-41571726 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1107589019 13:41882443-41882465 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1107737818 13:43416850-43416872 CAAGGCAGGCCGCTGGGAGGTGG + Intronic
1108024328 13:46162656-46162678 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1108348046 13:49565371-49565393 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1108370228 13:49761595-49761617 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1108608443 13:52063429-52063451 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1108610410 13:52079656-52079678 CAAGGCAGGCGGGTGGGAGGTGG - Intronic
1108685787 13:52817828-52817850 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1110506627 13:76295045-76295067 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1111230711 13:85341146-85341168 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1111388511 13:87561449-87561471 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1111418469 13:87977180-87977202 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1112050647 13:95641869-95641891 AAAGAGAGCGCGGCGGGAGGCGG + Intronic
1112056282 13:95691694-95691716 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1112070653 13:95846064-95846086 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1112077379 13:95928834-95928856 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1112192423 13:97191181-97191203 TGAGGCAGCCAGGTGGGAGGGGG + Intergenic
1112250512 13:97774824-97774846 CAAGGCAGGCGGTTGGGAGGTGG - Intergenic
1113193887 13:107782409-107782431 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1113329024 13:109311254-109311276 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1113479105 13:110606925-110606947 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1113656025 13:112068175-112068197 CCAGGCGGCGCGGCGGGCGGCGG + Exonic
1113658395 13:112085962-112085984 CAAGGCCACCCAGCAGGAGGTGG - Intergenic
1113735852 13:112678682-112678704 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1114137154 14:19866066-19866088 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1114280404 14:21188576-21188598 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1114336590 14:21697645-21697667 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1114427561 14:22636770-22636792 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1114507790 14:23231999-23232021 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1114578654 14:23736685-23736707 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1114594413 14:23898844-23898866 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1115259564 14:31437813-31437835 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1115324998 14:32128320-32128342 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1115399256 14:32939170-32939192 CTGGGCTGCCCGGCGGGCGGTGG - Intronic
1115494002 14:33984727-33984749 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1115540032 14:34411660-34411682 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1115547350 14:34475817-34475839 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1115622428 14:35153030-35153052 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1115689059 14:35825227-35825249 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1115703855 14:35978275-35978297 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1115761721 14:36582858-36582880 CAAGTCAGCCCAGGAGGAGGAGG - Intergenic
1115847781 14:37556176-37556198 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1115851687 14:37594795-37594817 CAAGGCAGGCAGGCGGGCCGGGG - Intronic
1116192155 14:41675242-41675264 CAAGGCAGGCGGGTGGGAGGTGG + Intronic
1116409016 14:44601133-44601155 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1117010726 14:51467930-51467952 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1117276898 14:54202975-54202997 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1117411821 14:55456911-55456933 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1117596773 14:57333446-57333468 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1117763768 14:59059306-59059328 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1118148490 14:63165193-63165215 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1118184053 14:63522300-63522322 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1118239100 14:64038481-64038503 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1118253376 14:64183555-64183577 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1118341361 14:64896323-64896345 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1118423441 14:65633375-65633397 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1118428729 14:65693146-65693168 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1118517841 14:66546410-66546432 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1118584594 14:67341030-67341052 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1118890249 14:69902974-69902996 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1118906708 14:70028746-70028768 CAAGGCAGGCAGGTGGGAAGCGG - Intronic
1118955495 14:70477322-70477344 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1119051936 14:71377616-71377638 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1119254699 14:73185245-73185267 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1119407484 14:74407628-74407650 GAAGAGGGCCCGGCGGGAGGTGG + Exonic
1119698729 14:76735118-76735140 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1119700202 14:76749984-76750006 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1119722127 14:76898508-76898530 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1119835634 14:77747273-77747295 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1119868626 14:77994165-77994187 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1120086988 14:80286354-80286376 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1120170647 14:81244889-81244911 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1120309978 14:82814927-82814949 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1120505890 14:85353109-85353131 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1120759158 14:88270638-88270660 CAAGGCAGACTGGGGGGAAGAGG + Intronic
1120892770 14:89505631-89505653 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1120906190 14:89623381-89623403 CGAGGCAGTCAGGCAGGAGGAGG + Intergenic
1121181786 14:91934780-91934802 CAAGGCACCGTGGCGGAAGGTGG - Intronic
1121531483 14:94657780-94657802 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
1121917442 14:97848678-97848700 CAGGTCAGCCCGGCCGCAGGAGG + Intergenic
1122101093 14:99410110-99410132 CAGGGCAGCCACGCTGGAGGAGG + Intronic
1122238103 14:100344439-100344461 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1122423219 14:101590330-101590352 CATGGCAGCCAGCCCGGAGGGGG + Intergenic
1122428946 14:101627949-101627971 CAATGGATCCCTGCGGGAGGAGG + Intergenic
1122568651 14:102677840-102677862 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1122717447 14:103704025-103704047 CATGACAGCCCGGGGGGAGACGG + Intronic
1122815423 14:104309789-104309811 CAGGGCAGGCCTGTGGGAGGTGG - Intergenic
1122931105 14:104933435-104933457 CGCGGCAGCCCGGCGCGGGGTGG - Exonic
1124132795 15:27004587-27004609 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1124335185 15:28850280-28850302 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1124426960 15:29570674-29570696 CGGGGCAGCGCGGCGGGACGCGG + Exonic
1124607785 15:31184322-31184344 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1125459773 15:39894870-39894892 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1125566447 15:40682449-40682471 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1125651352 15:41320639-41320661 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1125861449 15:43004735-43004757 CAAGGCAGGCGGCTGGGAGGAGG - Intronic
1125862695 15:43014238-43014260 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1125868382 15:43076336-43076358 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1125884888 15:43221110-43221132 CCTGGCAGCCCTGGGGGAGGGGG + Exonic
1126010181 15:44295161-44295183 CACTTCAGCCCGGCGGGTGGAGG - Intronic
1126113489 15:45188453-45188475 CAAGGTAGCACGGGAGGAGGAGG - Intronic
1126125825 15:45293590-45293612 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1126210809 15:46098442-46098464 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1126295260 15:47132106-47132128 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1126517306 15:49550921-49550943 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1126571524 15:50158111-50158133 CAAGGCAGACGGCTGGGAGGTGG - Intronic
1126573086 15:50172499-50172521 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1126691730 15:51293913-51293935 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1126752022 15:51886306-51886328 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1126799333 15:52285825-52285847 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1126816624 15:52460286-52460308 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1127023919 15:54781736-54781758 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1127088869 15:55447415-55447437 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1127153987 15:56109402-56109424 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1127191981 15:56540532-56540554 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1127584145 15:60366202-60366224 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1127644574 15:60946624-60946646 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1127783075 15:62332930-62332952 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1127874201 15:63098631-63098653 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1128071470 15:64799684-64799706 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1128490358 15:68136241-68136263 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1128500038 15:68221586-68221608 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1128587280 15:68860733-68860755 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1128597581 15:68965153-68965175 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1128843822 15:70872035-70872057 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1129008633 15:72396211-72396233 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1129231846 15:74201416-74201438 CAAGACATCCTGGCAGGAGGTGG + Intronic
1129313669 15:74728628-74728650 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
1129322242 15:74781927-74781949 CAACGCAGCCAGGCGGCAAGTGG + Intergenic
1129438143 15:75558885-75558907 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1130071042 15:80647310-80647332 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1130428477 15:83822834-83822856 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1130522315 15:84672620-84672642 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1130893178 15:88150484-88150506 CAAGGCAGCCCTGGGAGAGTAGG - Intronic
1130942583 15:88523795-88523817 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1131043981 15:89297400-89297422 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1131141104 15:89977807-89977829 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1131382385 15:91974602-91974624 CAGGGCAGGGAGGCGGGAGGTGG + Intronic
1131479484 15:92768959-92768981 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1132300873 15:100774635-100774657 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1132534520 16:471462-471484 GAAGACAGCCCGGAGGCAGGAGG - Intronic
1132758783 16:1498999-1499021 CACCGCAGCCCGGGCGGAGGCGG - Intronic
1132921928 16:2400402-2400424 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1133219841 16:4315452-4315474 CAAGGTGACCCCGCGGGAGGAGG + Exonic
1133300570 16:4779850-4779872 CAAGGCACCCAGGCAGGAGAGGG + Intronic
1133365151 16:5203390-5203412 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1133680310 16:8114770-8114792 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1133752199 16:8733471-8733493 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1133787034 16:8981832-8981854 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1134019086 16:10909016-10909038 CAAGGCAGCCCTGTGGAGGGAGG - Exonic
1134082879 16:11336342-11336364 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1134471925 16:14533045-14533067 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1134750247 16:16619481-16619503 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1134995213 16:18734117-18734139 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1135575526 16:23583173-23583195 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1135639809 16:24109746-24109768 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1135694631 16:24575402-24575424 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1136155079 16:28377085-28377107 CAAGGCAGGCGGTTGGGAGGTGG - Intergenic
1136208012 16:28738177-28738199 CAAGGCAGGCGGTTGGGAGGTGG + Intergenic
1136294828 16:29295566-29295588 CAGGGCAGCCCAGGTGGAGGCGG - Intergenic
1136424305 16:30159049-30159071 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1136572021 16:31103989-31104011 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1136593455 16:31231962-31231984 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1136668455 16:31836117-31836139 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1136919148 16:34246505-34246527 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1137240900 16:46653763-46653785 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1137283756 16:46999814-46999836 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1137303785 16:47180739-47180761 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1137430899 16:48417143-48417165 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1137493378 16:48951452-48951474 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1137523121 16:49210842-49210864 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1138028118 16:53538933-53538955 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1138037654 16:53625120-53625142 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1138043283 16:53697718-53697740 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1138307160 16:55988801-55988823 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1138642693 16:58397446-58397468 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1138699438 16:58846686-58846708 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1139378282 16:66514475-66514497 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1139556224 16:67712640-67712662 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1139623328 16:68164041-68164063 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1139864076 16:70050680-70050702 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1140063193 16:71589195-71589217 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1140993976 16:80242891-80242913 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1141253414 16:82379586-82379608 CCAGGCAGCCGGGAGGGAGAAGG + Intergenic
1141384474 16:83606819-83606841 CAAGGCAGCCGTGAGGGCGGCGG - Intronic
1141571589 16:84937286-84937308 CAAGGGAGGAGGGCGGGAGGAGG - Intergenic
1141682663 16:85553516-85553538 CTAGGCCGCCCGCTGGGAGGGGG + Intergenic
1141719914 16:85750548-85750570 GAAGGCAGCCCGGCGGGGGGCGG - Intronic
1141728837 16:85808614-85808636 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1141961440 16:87411951-87411973 CAATGCAGCCTGGCGGGGGTGGG + Exonic
1142116296 16:88357850-88357872 CAAGGGAGGCCGGAGGGAGCCGG + Intergenic
1142246605 16:88973121-88973143 CAAGGGGGCGCGGTGGGAGGGGG - Intronic
1142332221 16:89462425-89462447 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1142361855 16:89631151-89631173 GAAGGCAGGCCGGGGGGAGTGGG - Intronic
1142477004 17:194489-194511 CAGGGCAGCTGGGTGGGAGGAGG + Intergenic
1142529759 17:571899-571921 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1142533505 17:598317-598339 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1142634360 17:1247534-1247556 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1142657507 17:1403659-1403681 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1142705365 17:1690259-1690281 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1142818453 17:2446937-2446959 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1142825230 17:2506642-2506664 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1142913306 17:3113246-3113268 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1142940001 17:3372463-3372485 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1142949104 17:3464336-3464358 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1142963301 17:3564647-3564669 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1143008726 17:3854006-3854028 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1143115344 17:4578666-4578688 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1143277304 17:5721540-5721562 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1143617782 17:8064088-8064110 CGAGGCAGCGTGGCGGGGGGCGG - Intergenic
1143667604 17:8373530-8373552 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1143689549 17:8550044-8550066 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1143884697 17:10057150-10057172 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1144509918 17:15867141-15867163 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1144536263 17:16094921-16094943 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1144541240 17:16145255-16145277 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1144559896 17:16312560-16312582 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1144866278 17:18337928-18337950 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1145009959 17:19362428-19362450 CAGGGCAGCCCGGGGGGTTGCGG + Intronic
1145013917 17:19384805-19384827 CGTGGCAGCCTGGCGGGATGGGG + Intronic
1145022166 17:19441176-19441198 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1145026982 17:19475715-19475737 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1145174023 17:20684760-20684782 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1145240973 17:21240950-21240972 TAAGGCAGCCCGAGGCGAGGAGG + Exonic
1145418008 17:22740865-22740887 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1145733539 17:27211744-27211766 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1145896031 17:28458539-28458561 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1145920367 17:28604894-28604916 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1145927711 17:28659880-28659902 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1146048978 17:29533480-29533502 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1146187755 17:30736376-30736398 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1146216536 17:30981002-30981024 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1146444616 17:32923463-32923485 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1146731402 17:35195653-35195675 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1147024047 17:37565400-37565422 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1147172504 17:38630587-38630609 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1147277793 17:39333501-39333523 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1147278318 17:39337342-39337364 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1147324555 17:39663989-39664011 CAGGCCAGCCGGGAGGGAGGAGG - Intergenic
1147590527 17:41680281-41680303 CCAGGCAGCCCAGCAGGAAGAGG + Intergenic
1147622235 17:41875798-41875820 CAAGGCAGGCGGCCGGGAGGTGG - Intronic
1147708944 17:42448849-42448871 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1147852083 17:43451528-43451550 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1147974067 17:44237769-44237791 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1148016215 17:44524381-44524403 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1148227193 17:45907167-45907189 CAGGGCAGGCTGGCAGGAGGCGG - Intronic
1148269691 17:46253388-46253410 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1148404157 17:47397368-47397390 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1148406352 17:47420303-47420325 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1148824864 17:50385154-50385176 CAAAGCAGCCAAGCGGGAGCAGG - Exonic
1149625214 17:58074852-58074874 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1149632920 17:58142185-58142207 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1149780757 17:59394728-59394750 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1149793516 17:59499810-59499832 CAAGGCAGGCGGATGGGAGGTGG - Intergenic
1150293939 17:63998160-63998182 CCGAGCAGCGCGGCGGGAGGTGG + Intergenic
1150589363 17:66548739-66548761 CAAGGCAGGGCGGCTGGAGGAGG + Intronic
1150851913 17:68711536-68711558 CAGGGAAGCCAGGTGGGAGGCGG + Intergenic
1150894734 17:69196652-69196674 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1152019998 17:77776020-77776042 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1152129035 17:78465286-78465308 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1152479023 17:80537668-80537690 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1152696329 17:81798503-81798525 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1153221833 18:2868438-2868460 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1153605571 18:6827990-6828012 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1153633956 18:7098205-7098227 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1153646913 18:7203875-7203897 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1153825231 18:8868654-8868676 CAAGACAGCCTGGCCAGAGGAGG + Intergenic
1154089528 18:11344401-11344423 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1154158058 18:11959408-11959430 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1154265049 18:12873644-12873666 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1154278757 18:12981343-12981365 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1154290061 18:13098819-13098841 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1154398443 18:14011490-14011512 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1154440330 18:14383266-14383288 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1154990398 18:21593230-21593252 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1155956349 18:31959886-31959908 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1156066435 18:33148063-33148085 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1156326451 18:36078290-36078312 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1157455797 18:47827836-47827858 CAAGGCAGGCGGCTGGGAGGTGG - Exonic
1157705081 18:49799571-49799593 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1157778641 18:50418074-50418096 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1157857826 18:51117721-51117743 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1158148445 18:54342817-54342839 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1158459448 18:57633511-57633533 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1158646804 18:59255335-59255357 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1159340555 18:67127316-67127338 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1159433402 18:68384623-68384645 CAAAGCAGCTGGGAGGGAGGCGG + Intergenic
1160182114 18:76645287-76645309 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1160228501 18:77029050-77029072 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1160791295 19:924988-925010 CAAGGAAGGCGGTCGGGAGGGGG - Intergenic
1160916690 19:1499888-1499910 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1160947973 19:1652280-1652302 CAGGTGAGCCCGGCGGGGGGCGG - Exonic
1161027093 19:2041782-2041804 CAGGGCAGGCCCGGGGGAGGAGG + Intronic
1161334659 19:3706202-3706224 CGAGGCTGCCCGGCGGGGGCCGG + Intergenic
1161361482 19:3852426-3852448 CAAGGCTGGCCTGCTGGAGGAGG - Intronic
1161659380 19:5536661-5536683 CATGGCAGCCTGGCGGGAGCCGG - Intergenic
1161699012 19:5784938-5784960 CAGGGCAGCCTGCCTGGAGGAGG - Intronic
1161727150 19:5936156-5936178 GAAGGCAGCCTGGCTGGAGCTGG + Intronic
1161790112 19:6355179-6355201 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1162255011 19:9483019-9483041 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1162278865 19:9679697-9679719 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1162602229 19:11677516-11677538 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1162683141 19:12362076-12362098 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1162694969 19:12467497-12467519 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1162799084 19:13101206-13101228 GAAGGCAGCCAGTGGGGAGGAGG + Intronic
1163117994 19:15199972-15199994 CGAGGCCGGCCGGAGGGAGGGGG + Intronic
1163142940 19:15362714-15362736 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1163371947 19:16906022-16906044 CCAGGAAGCCTGGCCGGAGGCGG + Intronic
1163558620 19:18006266-18006288 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1163747609 19:19057547-19057569 CAAGGCCGCCCTGCGGGACCTGG + Exonic
1163865448 19:19769848-19769870 CAAGGCAGGCAGTTGGGAGGTGG - Intergenic
1163896571 19:20064888-20064910 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1163904223 19:20137634-20137656 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1163909526 19:20176464-20176486 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1163913018 19:20214253-20214275 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1163921672 19:20296119-20296141 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1163945612 19:20530867-20530889 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1163986204 19:20953065-20953087 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1164012244 19:21213080-21213102 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1164040300 19:21487377-21487399 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1164047115 19:21551885-21551907 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1164054933 19:21614647-21614669 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164064936 19:21707708-21707730 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164066330 19:21720702-21720724 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164071730 19:21775550-21775572 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164105164 19:22104803-22104825 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164106217 19:22108363-22108385 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1164168642 19:22703494-22703516 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1164186301 19:22872038-22872060 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1164218556 19:23172921-23172943 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164231294 19:23290449-23290471 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1164244577 19:23419011-23419033 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1164256742 19:23533971-23533993 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1164298610 19:23937784-23937806 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1164301048 19:23963760-23963782 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1164512072 19:28905539-28905561 CATGGCAGCCCGGCAGCCGGGGG + Intergenic
1164658637 19:29942692-29942714 AGGGGCAGCCCGGCGGGCGGAGG - Intronic
1164659415 19:29949549-29949571 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1165199270 19:34132224-34132246 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1165482002 19:36069630-36069652 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1165727823 19:38124641-38124663 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1165768404 19:38364561-38364583 CAAGGCAGGCGGCTGGGAGGCGG + Intronic
1165842758 19:38798455-38798477 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1165852280 19:38856322-38856344 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1166047689 19:40238983-40239005 GAAGGCAGCAGGGTGGGAGGTGG + Intronic
1166115158 19:40648808-40648830 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1166163211 19:40967063-40967085 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1166305700 19:41935871-41935893 CCGGGCAGCCCGCCGGGTGGGGG - Intergenic
1166418137 19:42610910-42610932 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1166421582 19:42640201-42640223 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1166640115 19:44488620-44488642 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1166832635 19:45647909-45647931 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1167038695 19:47009475-47009497 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1167135565 19:47613296-47613318 CAAGGCAGCCTGGCGGGTGGGGG - Intronic
1167347360 19:48954971-48954993 GGAGGCAGACGGGCGGGAGGAGG + Intronic
1167548004 19:50140788-50140810 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1167588809 19:50391337-50391359 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1167676169 19:50887553-50887575 CAAGGCAGCCCCCAGGAAGGTGG + Intergenic
1167716056 19:51143481-51143503 CAGGGAAGCCCGGAGGTAGGAGG + Intronic
1167768686 19:51500612-51500634 CAGGGAAGCCCGGAGGTAGGAGG - Intronic
1167890368 19:52535389-52535411 GGAGGGAGCCCTGCGGGAGGGGG + Intronic
1167897612 19:52593957-52593979 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1167898417 19:52600671-52600693 GAAGGGAGCCCTGCGGGAGGGGG + Intronic
1167903471 19:52638949-52638971 GAAGGGAGCCCTGCGGGAGGGGG - Intronic
1167907735 19:52676337-52676359 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1167913364 19:52721320-52721342 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1167924399 19:52811248-52811270 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1167937340 19:52919514-52919536 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1167940658 19:52943195-52943217 GAAGGGAGCGCTGCGGGAGGCGG - Intronic
1167946754 19:52994217-52994239 GAAGGGAGTCCTGCGGGAGGGGG - Intergenic
1167971166 19:53188222-53188244 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1167975406 19:53222626-53222648 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1167980364 19:53270309-53270331 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1167991492 19:53365089-53365111 GAAGGGAGCCCTGCGGGAGGGGG + Intergenic
1167994887 19:53394534-53394556 GAAGGGAGCCCTGCGGGAGGGGG + Intronic
1168003376 19:53467124-53467146 GAAGGAAGCGCTGCGGGAGGGGG + Intergenic
924970853 2:126561-126583 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
925400598 2:3569635-3569657 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
925403738 2:3591885-3591907 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
925407688 2:3616398-3616420 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
926147375 2:10404928-10404950 GAGCACAGCCCGGCGGGAGGTGG - Intronic
926322772 2:11760321-11760343 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
926675163 2:15612646-15612668 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
926683451 2:15680675-15680697 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
927737628 2:25536343-25536365 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
927747124 2:25633520-25633542 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
927747262 2:25634051-25634073 CCCGGCAGCCAGGAGGGAGGTGG + Intronic
927755536 2:25705441-25705463 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
927757957 2:25723802-25723824 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
927777149 2:25911246-25911268 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
927833440 2:26371500-26371522 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928003341 2:27541028-27541050 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928005553 2:27558543-27558565 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928009593 2:27594770-27594792 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928200727 2:29246199-29246221 GAAGGCAGGCAGGCTGGAGGGGG + Intronic
928542305 2:32294706-32294728 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928558224 2:32448293-32448315 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928585626 2:32755222-32755244 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
928596784 2:32868143-32868165 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
928687279 2:33761826-33761848 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
928722268 2:34133562-34133584 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
928888713 2:36179673-36179695 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
929062137 2:37933411-37933433 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
929066210 2:37977960-37977982 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
929110557 2:38403052-38403074 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
929152026 2:38756358-38756380 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
929174046 2:38959641-38959663 CAAGGCAGTCCGTCGAGCGGAGG - Intronic
929238434 2:39628829-39628851 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
929415885 2:41746434-41746456 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
929447998 2:42015246-42015268 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
929518004 2:42622044-42622066 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
929564752 2:42977375-42977397 CAGGGCAGCCCGGCAAGAAGAGG + Intergenic
929577878 2:43063647-43063669 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
929650905 2:43678349-43678371 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
929690415 2:44067973-44067995 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
929739416 2:44587834-44587856 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
930079484 2:47434165-47434187 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
930208935 2:48615112-48615134 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
930363528 2:50411382-50411404 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
930396488 2:50828868-50828890 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
930665685 2:54096472-54096494 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
930703848 2:54485547-54485569 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
930727777 2:54698753-54698775 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
931479833 2:62630052-62630074 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
931576297 2:63722085-63722107 CAAGGCAGGCGGCGGGGAGGTGG - Intronic
931584143 2:63808698-63808720 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
931604852 2:64042101-64042123 CAAGGCAGGCGGCGGGGAGGTGG + Intergenic
931751971 2:65338654-65338676 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
931783827 2:65601481-65601503 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
932253900 2:70267429-70267451 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
932367154 2:71160810-71160832 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
932410377 2:71543500-71543522 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
932718829 2:74123613-74123635 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
932807645 2:74796669-74796691 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
933868584 2:86546002-86546024 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
934128266 2:88920274-88920296 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
934548977 2:95243206-95243228 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
934555246 2:95283576-95283598 GAAGGCAGCCTGGAGGGATGCGG + Intronic
934678254 2:96265340-96265362 CAGGGCTGCCCGGCGGGCGCCGG - Exonic
934998641 2:98989330-98989352 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
935571654 2:104668536-104668558 CAAGGCAGCCCCGATGGAGGAGG - Intergenic
935630933 2:105211554-105211576 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
935636108 2:105251010-105251032 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
936158302 2:110064282-110064304 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
936186360 2:110307044-110307066 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
936282775 2:111157144-111157166 CAAGGCAGCCCTGCAGGTGTAGG - Intronic
936345524 2:111672432-111672454 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
936955002 2:118014203-118014225 CACAGCAGCCCGGGGAGAGGTGG + Intergenic
937279168 2:120705577-120705599 CAAAGCAGCCCTGCAAGAGGTGG - Intergenic
937322100 2:120966991-120967013 CAGGGCAGCCTGCCTGGAGGAGG + Intronic
937734957 2:125277423-125277445 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
937947379 2:127353055-127353077 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
938039396 2:128063320-128063342 CAAGGATGCACTGCGGGAGGTGG - Intergenic
938253335 2:129833376-129833398 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
938533687 2:132220720-132220742 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
938720541 2:134063768-134063790 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
938822060 2:134968989-134969011 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
938829225 2:135034447-135034469 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
938836123 2:135105588-135105610 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
939477181 2:142702274-142702296 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
940299037 2:152160085-152160107 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
940635480 2:156293218-156293240 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
940652518 2:156452193-156452215 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
940817389 2:158311111-158311133 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
941024104 2:160439694-160439716 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
941025005 2:160448650-160448672 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
941603307 2:167564502-167564524 CAAGGCAGGACGCCGGGAGGTGG + Intergenic
941786522 2:169505311-169505333 CAAGGCAGGCAGCTGGGAGGTGG - Exonic
941793438 2:169575769-169575791 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
941822463 2:169856472-169856494 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
941847657 2:170149394-170149416 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
942012099 2:171774426-171774448 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
942021131 2:171867272-171867294 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
942024580 2:171899595-171899617 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
942096061 2:172537528-172537550 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
942355545 2:175107923-175107945 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
942621140 2:177845670-177845692 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
943005674 2:182386201-182386223 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
943323335 2:186472605-186472627 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
943577953 2:189653307-189653329 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
943648431 2:190431344-190431366 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
943773273 2:191741573-191741595 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
943863106 2:192893836-192893858 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
944255222 2:197618442-197618464 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
944263255 2:197697050-197697072 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
944533159 2:200684394-200684416 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
944585222 2:201166606-201166628 CAAGGCAGGCGGCTGGGAGGCGG + Exonic
944598984 2:201284318-201284340 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
944722773 2:202440606-202440628 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
944733171 2:202535724-202535746 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
944751685 2:202715721-202715743 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
944797844 2:203206775-203206797 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
944815688 2:203373102-203373124 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
945088691 2:206159204-206159226 CGAGGCGGCGGGGCGGGAGGCGG + Intronic
945090477 2:206172238-206172260 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
945110758 2:206357398-206357420 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
945232840 2:207610151-207610173 CAAGGCAGGCGGCTGGGAGGTGG - Exonic
945316761 2:208378012-208378034 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
945835927 2:214835996-214836018 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
945864936 2:215163899-215163921 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
945970551 2:216227197-216227219 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
946318029 2:218931155-218931177 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
946363738 2:219235767-219235789 GAAGGCAGCCCGGCGGCAACGGG + Exonic
946447455 2:219751639-219751661 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
946650851 2:221891851-221891873 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
946751579 2:222897564-222897586 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
946766351 2:223044582-223044604 CAAGGCAGCCAGGAGCGGGGTGG - Intergenic
947402238 2:229742535-229742557 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
948000344 2:234562522-234562544 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
948047054 2:234952493-234952515 CAGGGCCGCCCGCCGGGAAGTGG - Intronic
948651759 2:239450017-239450039 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
948793314 2:240390180-240390202 TAAGGCAGCTGGGCCGGAGGGGG + Intergenic
949076500 2:242062149-242062171 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1169085551 20:2823423-2823445 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1169125471 20:3124479-3124501 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1169168262 20:3441818-3441840 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1169214181 20:3784192-3784214 CAAGGCGGCCTGGGGGGTGGGGG + Exonic
1169246780 20:4032203-4032225 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1169420064 20:5452655-5452677 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1169441870 20:5639640-5639662 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1169718175 20:8644151-8644173 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1169992010 20:11513829-11513851 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1170502565 20:16989687-16989709 GGAGGCAGCCAGGCTGGAGGTGG - Intergenic
1170592107 20:17778933-17778955 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1170645607 20:18194262-18194284 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1170664636 20:18375934-18375956 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1170811731 20:19679142-19679164 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1170991254 20:21303549-21303571 CAAGGCTCCCCGGGGGCAGGCGG - Intronic
1171155423 20:22868273-22868295 CAAAGAAGCCAGGTGGGAGGTGG + Intergenic
1171366242 20:24626715-24626737 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1171464726 20:25319524-25319546 CAGGGCAGCCCTGGAGGAGGTGG - Intronic
1171496719 20:25561389-25561411 CAAGGCAGACGGCTGGGAGGTGG - Intronic
1171848590 20:30292291-30292313 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1171899998 20:30847578-30847600 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1172141067 20:32723490-32723512 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1172199510 20:33115319-33115341 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1172209324 20:33185834-33185856 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1172237612 20:33388980-33389002 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1172258221 20:33537127-33537149 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1172279194 20:33698845-33698867 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1172279845 20:33701125-33701147 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1172379354 20:34475294-34475316 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1172717859 20:36977294-36977316 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1172728781 20:37069194-37069216 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1172735718 20:37125576-37125598 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1172910679 20:38407194-38407216 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1173473103 20:43338669-43338691 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1173729543 20:45318734-45318756 GCAGGCAGCCAGGAGGGAGGAGG + Intergenic
1173769699 20:45646417-45646439 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1174020759 20:47526400-47526422 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1174037646 20:47678068-47678090 CAAGTCAGACAGGTGGGAGGTGG - Intronic
1174344753 20:49921806-49921828 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1174835733 20:53854168-53854190 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1175224821 20:57439097-57439119 CAGGGCAGGGGGGCGGGAGGTGG - Intergenic
1175361560 20:58414864-58414886 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1175407766 20:58745822-58745844 CAAGGCAGGCAGGGAGGAGGGGG + Intergenic
1175776024 20:61654064-61654086 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1175783661 20:61698843-61698865 CAAGGCAGCCCGACATCAGGCGG - Intronic
1176348539 21:5771446-5771468 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1176355353 21:5892030-5892052 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1176496288 21:7553009-7553031 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1176542860 21:8169516-8169538 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1176561811 21:8352561-8352583 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1176656790 21:9594166-9594188 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1177788399 21:25696027-25696049 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1178075411 21:29011024-29011046 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1178873219 21:36392851-36392873 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1179195108 21:39156985-39157007 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1179726010 21:43341570-43341592 CTAGGCTGCCCGGGGTGAGGGGG + Intergenic
1179969064 21:44824438-44824460 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1180124986 21:45784817-45784839 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1180739384 22:18042026-18042048 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1180834216 22:18921832-18921854 ACAGGCAGCCAGGCAGGAGGCGG + Intronic
1180842640 22:18966394-18966416 GGAGGCAGCCCTGTGGGAGGAGG + Intergenic
1180861180 22:19084076-19084098 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1181065597 22:20304271-20304293 ACAGGCAGCCAGGCAGGAGGCGG - Intergenic
1181274044 22:21677336-21677358 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1181301639 22:21884420-21884442 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1181373987 22:22441513-22441535 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1181586002 22:23854169-23854191 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1181598786 22:23936797-23936819 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1181617659 22:24065643-24065665 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1181658126 22:24318160-24318182 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1181792421 22:25278264-25278286 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1182082436 22:27538870-27538892 GGAGGCAGCCCGGGGAGAGGGGG - Intergenic
1182085788 22:27560305-27560327 CATCGCAGCCCGCCGGGAGGTGG - Intergenic
1182331028 22:29552141-29552163 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1182343737 22:29644560-29644582 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1182377500 22:29858610-29858632 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1182399725 22:30066454-30066476 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1182468601 22:30533129-30533151 CAGGGCAGCCATGCGGGAGGGGG - Intronic
1182484657 22:30632130-30632152 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1182538777 22:31026635-31026657 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1182564112 22:31184555-31184577 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1182638652 22:31749839-31749861 CAAGGCTGCCCTGTGGGCGGCGG - Intronic
1182976415 22:34626614-34626636 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1182982543 22:34684917-34684939 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1183183534 22:36277991-36278013 CAAGGCACCCTGGAAGGAGGTGG + Intergenic
1183185673 22:36290503-36290525 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1183247309 22:36703587-36703609 CAGGGCCGCCCGCCAGGAGGGGG + Intergenic
1183359850 22:37377763-37377785 CAAGGCAGCCAGGCAGGAAGGGG + Intronic
1183537291 22:38410337-38410359 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1183568051 22:38630795-38630817 CAAGGCATCCCAGGGGGATGTGG + Intronic
1183871834 22:40746037-40746059 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1183940835 22:41294408-41294430 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1183995845 22:41631767-41631789 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1184145393 22:42607464-42607486 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1184169551 22:42750886-42750908 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1184201258 22:42971441-42971463 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1184202510 22:42980840-42980862 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1184258562 22:43301412-43301434 CACAGCAGCCTGGCTGGAGGCGG - Intronic
1185259340 22:49853272-49853294 CAAGCCGGGTCGGCGGGAGGAGG - Intergenic
1185283811 22:49990231-49990253 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1185330219 22:50249058-50249080 CAGGGCAGCCGGGTGGGAGGGGG - Intronic
1203247726 22_KI270733v1_random:85759-85781 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1203284305 22_KI270734v1_random:147131-147153 ACAGGCAGCCAGGCAGGAGGCGG + Intergenic
949330522 3:2916941-2916963 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
949450036 3:4174961-4174983 GAAGGCAGCCGGGCTGGGGGAGG + Intronic
949565736 3:5243119-5243141 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
949570096 3:5284363-5284385 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
949853225 3:8439408-8439430 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
949988654 3:9559753-9559775 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
949989814 3:9569805-9569827 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
950044358 3:9940307-9940329 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
950579345 3:13852415-13852437 CATGGCAGCCTGTTGGGAGGGGG + Intronic
950742290 3:15061572-15061594 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
950949273 3:16980775-16980797 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
951231581 3:20185980-20186002 CCAGGAAGGCCGGGGGGAGGTGG + Intronic
951290589 3:20867431-20867453 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
951550634 3:23872012-23872034 CAAGGCAGGCGGGTGGGAGGTGG + Intronic
952308773 3:32169447-32169469 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
952364603 3:32663831-32663853 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
952892526 3:38053146-38053168 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
952894097 3:38064978-38065000 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
953037686 3:39227414-39227436 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
953084785 3:39655633-39655655 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
953257473 3:41305576-41305598 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
953322391 3:41983685-41983707 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
953425894 3:42797304-42797326 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
953652867 3:44821763-44821785 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
953855001 3:46494270-46494292 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
953922715 3:46963812-46963834 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
953959419 3:47256116-47256138 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
953966293 3:47309639-47309661 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
954060286 3:48061548-48061570 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
954162631 3:48733863-48733885 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
954356375 3:50085487-50085509 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
954399732 3:50312628-50312650 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
954481453 3:50804378-50804400 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
954523222 3:51248549-51248571 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
954567169 3:51608466-51608488 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
954599681 3:51858348-51858370 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
955363212 3:58291018-58291040 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
955395020 3:58550771-58550793 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
955626745 3:60927340-60927362 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
955670166 3:61394026-61394048 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
955674667 3:61435368-61435390 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
955699911 3:61672359-61672381 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
957620027 3:82584224-82584246 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
957789187 3:84918469-84918491 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
958431283 3:94044012-94044034 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
958654623 3:96984761-96984783 CAAGGCAGCAGGGCTGGGGGAGG - Intronic
959415864 3:106075428-106075450 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
959586133 3:108026519-108026541 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
960030218 3:113047182-113047204 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
960344796 3:116518989-116519011 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
960388537 3:117050402-117050424 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
960526809 3:118719026-118719048 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
960577402 3:119242321-119242343 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
960697963 3:120414137-120414159 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
960780741 3:121314236-121314258 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
960817450 3:121688542-121688564 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
960866176 3:122202058-122202080 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
960920887 3:122747009-122747031 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
960924530 3:122781194-122781216 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
961164004 3:124750987-124751009 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
961626125 3:128264910-128264932 CCAGGCAGCCAGAGGGGAGGTGG - Intronic
961704315 3:128772946-128772968 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
961729097 3:128953961-128953983 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
961789227 3:129363978-129364000 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
961831998 3:129627633-129627655 GGAGGCAGCCCTGCGGGAGTCGG + Intergenic
961962305 3:130867646-130867668 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
962572067 3:136723048-136723070 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
962623167 3:137198919-137198941 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
962761720 3:138521164-138521186 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
962787849 3:138784785-138784807 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
963242605 3:143022960-143022982 AAAGGCAGTCCGGATGGAGGTGG - Exonic
963249195 3:143087227-143087249 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
963253370 3:143121138-143121160 CGGGGCGGCCCGGCCGGAGGCGG - Exonic
963498273 3:146096240-146096262 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
963911722 3:150821475-150821497 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
965302244 3:167018460-167018482 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
965534654 3:169812288-169812310 CAAGGCGTCGAGGCGGGAGGGGG - Intronic
965649962 3:170923356-170923378 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
966015636 3:175133361-175133383 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
966206782 3:177413295-177413317 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
966350900 3:179032358-179032380 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
966617307 3:181926309-181926331 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
966783737 3:183607692-183607714 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
966866058 3:184259825-184259847 CAGGGGAGCCGTGCGGGAGGGGG + Exonic
966967027 3:185004119-185004141 CAAGGCAGGCGGCCGGGAGGTGG + Intronic
967127342 3:186435840-186435862 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
967175984 3:186863894-186863916 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
967524163 3:190473058-190473080 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
967578614 3:191125423-191125445 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
967904117 3:194486835-194486857 CAAGGGAGGGCGGCGGGAGGTGG + Intronic
968042523 3:195600104-195600126 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
968072411 3:195793641-195793663 CAAGGAAGACAGGCGGGAGCTGG - Intronic
968139347 3:196243890-196243912 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
968156454 3:196385358-196385380 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
968201938 3:196762336-196762358 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
968226136 3:196973554-196973576 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
968411548 4:395346-395368 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
968429965 4:551051-551073 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
968507050 4:975700-975722 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
968524564 4:1049423-1049445 CCAGGCAGCCTGGGGTGAGGGGG - Intergenic
969384860 4:6837553-6837575 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
969404066 4:6977477-6977499 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
969427455 4:7133707-7133729 GAAGGCAGCCCTGATGGAGGAGG - Intergenic
969508450 4:7602798-7602820 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
970216205 4:13761724-13761746 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
970409132 4:15790532-15790554 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
970472844 4:16393940-16393962 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
970824170 4:20253042-20253064 CAAGGACGCCGAGCGGGAGGCGG + Intergenic
971594949 4:28515415-28515437 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
972288175 4:37668572-37668594 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
972412311 4:38807196-38807218 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
972654036 4:41049019-41049041 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
972700881 4:41492042-41492064 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
972749426 4:41973523-41973545 GAAAGCAGCCAGGAGGGAGGCGG + Intergenic
972938369 4:44167698-44167720 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
972939640 4:44181602-44181624 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
973263267 4:48186213-48186235 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
973274283 4:48292127-48292149 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
973650339 4:52992383-52992405 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
973664020 4:53139225-53139247 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
973675331 4:53256519-53256541 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
973785167 4:54326155-54326177 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
974076497 4:57172894-57172916 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
974597774 4:64037000-64037022 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
974848548 4:67380531-67380553 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
975042356 4:69761715-69761737 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
975633358 4:76423094-76423116 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
975685474 4:76916408-76916430 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
975848269 4:78547695-78547717 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
976149320 4:82077474-82077496 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
976266104 4:83186645-83186667 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
976340974 4:83944301-83944323 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
976607311 4:86995668-86995690 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
976993903 4:91405589-91405611 CAAGGCAGCCCCGAGGCAGGGGG - Intronic
977205014 4:94157630-94157652 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
977542249 4:98330937-98330959 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
978014181 4:103723059-103723081 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
978148734 4:105409327-105409349 GACGGCAGCCTGGTGGGAGGAGG + Intronic
978224811 4:106321102-106321124 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
978409023 4:108409179-108409201 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
978519156 4:109598234-109598256 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
978519703 4:109603451-109603473 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
978527350 4:109679287-109679309 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
978820365 4:112958233-112958255 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
979482785 4:121238336-121238358 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
979622267 4:122811548-122811570 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
979641738 4:123016761-123016783 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
979702424 4:123684673-123684695 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
980883592 4:138739151-138739173 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
980895053 4:138853825-138853847 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
981677368 4:147357632-147357654 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
981993589 4:150953718-150953740 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
981994735 4:150963541-150963563 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
982026269 4:151255666-151255688 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
982040303 4:151390527-151390549 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
982053737 4:151527163-151527185 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
982075205 4:151731471-151731493 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
982192167 4:152867135-152867157 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
982709818 4:158747116-158747138 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
982711102 4:158759542-158759564 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
982723379 4:158881807-158881829 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
982784086 4:159522817-159522839 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
983218251 4:165020587-165020609 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
983604452 4:169569848-169569870 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
983652130 4:170046110-170046132 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
983664555 4:170166726-170166748 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
983906130 4:173184238-173184260 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
984005057 4:174295627-174295649 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
984037779 4:174691748-174691770 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
984728241 4:183041289-183041311 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
984823391 4:183904231-183904253 CCAGGCAGCACAGCAGGAGGTGG - Intronic
984977302 4:185241117-185241139 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
985247323 4:187991585-187991607 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
985613942 5:908163-908185 GAGGGCAGCCCGGCTGTAGGAGG - Intronic
985736331 5:1585766-1585788 CAAGGCAGGCCGCTGGGAGGTGG - Intergenic
987268109 5:16277499-16277521 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
987469190 5:18309340-18309362 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
988532463 5:32039461-32039483 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
988544225 5:32141960-32141982 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
988760786 5:34307349-34307371 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
989021615 5:37013847-37013869 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
989048345 5:37295403-37295425 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
989061697 5:37416150-37416172 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
989068265 5:37484194-37484216 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
989076115 5:37564165-37564187 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
989211665 5:38862803-38862825 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
989252557 5:39333968-39333990 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
989372178 5:40722262-40722284 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
989574937 5:42980189-42980211 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
989588113 5:43088760-43088782 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
989633381 5:43510797-43510819 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
989634751 5:43521857-43521879 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
989640565 5:43578788-43578810 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
989648872 5:43666232-43666254 CAAGGCAGGCGGCTGGGAGGGGG + Intronic
989656033 5:43746729-43746751 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
989663571 5:43825005-43825027 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
989828772 5:45890332-45890354 CAAGGCAGGCGGCTGGGAGGGGG - Intergenic
990252233 5:53927812-53927834 CAAGGCAGCCTGTAGGGAAGTGG + Intronic
990293798 5:54381137-54381159 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
990297854 5:54421003-54421025 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
990427124 5:55697201-55697223 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
990462125 5:56039235-56039257 CAAGGCAGGCGGGTGGGAGGTGG + Intergenic
990485834 5:56258492-56258514 CAAGGCAGTCGGCTGGGAGGTGG + Intergenic
990501195 5:56398295-56398317 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
990617043 5:57518838-57518860 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
990871131 5:60431712-60431734 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991073929 5:62514231-62514253 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991373135 5:65939903-65939925 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
991375190 5:65958259-65958281 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991377149 5:65977796-65977818 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991672703 5:69063335-69063357 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
991723772 5:69516136-69516158 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991907418 5:71526078-71526100 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
991910218 5:71552459-71552481 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
991935435 5:71794906-71794928 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
992289506 5:75269896-75269918 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
992391790 5:76336532-76336554 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
992415915 5:76551494-76551516 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
992463905 5:76985537-76985559 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
992540656 5:77760777-77760799 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
992600283 5:78391646-78391668 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
992662919 5:78979469-78979491 TAAGACAGCCAGGTGGGAGGGGG + Intronic
992690590 5:79236891-79236913 CCCGGCAGCCCGGCGGGCAGGGG + Exonic
992801651 5:80300927-80300949 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
992964309 5:81984066-81984088 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
993657994 5:90596429-90596451 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
993723424 5:91343327-91343349 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
993934587 5:93985779-93985801 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
994907405 5:105859275-105859297 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
995123720 5:108559769-108559791 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
995161957 5:108993178-108993200 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
995236337 5:109833309-109833331 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
995456757 5:112360629-112360651 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
995515863 5:112954566-112954588 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
995895076 5:117002533-117002555 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
995994382 5:118282378-118282400 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
996054020 5:118964796-118964818 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
996057623 5:118998847-118998869 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
996070173 5:119122943-119122965 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
996159795 5:120147778-120147800 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
996386382 5:122913749-122913771 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
996553819 5:124757671-124757693 TGAGGCAGCCAGGTGGGAGGGGG + Intergenic
996661500 5:126009048-126009070 TAAGACAGCCAGGTGGGAGGGGG + Intergenic
997321742 5:132983570-132983592 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
997565405 5:134882482-134882504 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
997875077 5:137538718-137538740 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
998021974 5:138777497-138777519 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
998053529 5:139056027-139056049 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
998059972 5:139112201-139112223 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
998067334 5:139170223-139170245 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
998074351 5:139224233-139224255 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
998239591 5:140428275-140428297 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
999012345 5:148056470-148056492 GAAGGCAGCTGGGAGGGAGGCGG + Intronic
999181235 5:149671035-149671057 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
999455754 5:151714485-151714507 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
999532758 5:152480449-152480471 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
999604286 5:153297421-153297443 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
999978959 5:156940312-156940334 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
999986901 5:157013899-157013921 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1000032839 5:157419305-157419327 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1000103544 5:158037635-158037657 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1000159046 5:158582154-158582176 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1002115649 5:176960987-176961009 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1002118435 5:176983589-176983611 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1002168921 5:177364476-177364498 CCAGGCAGCCCAGCGGAGGGGGG - Intronic
1002501574 5:179650602-179650624 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1002626268 5:180531624-180531646 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1002658343 5:180771448-180771470 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1003067789 6:2918328-2918350 CAAGGAAGCCCAGTGGGAGTGGG + Intergenic
1003319567 6:5038525-5038547 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1003407543 6:5836287-5836309 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1004054225 6:12119123-12119145 CAAGGCAGCCATGCAGGAGATGG + Intronic
1004152381 6:13133651-13133673 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1004415098 6:15416327-15416349 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1004438480 6:15621881-15621903 GAAGGGAGCCCTGTGGGAGGAGG - Intronic
1004664363 6:17736117-17736139 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1005063702 6:21798010-21798032 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1005158641 6:22836090-22836112 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1005240055 6:23814303-23814325 CAGGGCAGTCAGGCAGGAGGAGG - Intergenic
1005341220 6:24845474-24845496 CATGGCAGCACAGAGGGAGGTGG + Intronic
1005414582 6:25586594-25586616 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1005644823 6:27828115-27828137 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1005710778 6:28501911-28501933 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1005837090 6:29718251-29718273 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1005865243 6:29932420-29932442 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1005901755 6:30222342-30222364 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1005933268 6:30499122-30499144 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1006004883 6:30993739-30993761 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1006022054 6:31123094-31123116 CAAGACAGCCAGGCTGGAGGAGG + Intronic
1006136700 6:31900381-31900403 CATGGCTGCCCGGGGGGCGGGGG - Exonic
1006141619 6:31932755-31932777 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1006146775 6:31964068-31964090 CAAGGCAGCGCTGCAGGAAGAGG - Exonic
1006149149 6:31976683-31976705 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1006210022 6:32385732-32385754 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1006225263 6:32531899-32531921 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1006281998 6:33060392-33060414 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1006346415 6:33486202-33486224 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1006403939 6:33833184-33833206 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1006546547 6:34786181-34786203 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1006623446 6:35383386-35383408 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1006932799 6:37697750-37697772 CAAGGCCGCCGGGCGGGGGCGGG - Exonic
1007447981 6:41921574-41921596 CAAGGCGGCCCGTGGGGTGGGGG + Exonic
1007522900 6:42466111-42466133 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1007545086 6:42687124-42687146 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1007651415 6:43425017-43425039 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1008057035 6:46955836-46955858 CAAGGCAGCAGAGGGGGAGGAGG + Intergenic
1008377712 6:50810408-50810430 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1008480589 6:51981674-51981696 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1008553859 6:52656559-52656581 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1008571922 6:52825071-52825093 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1008624859 6:53305843-53305865 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1008841713 6:55910625-55910647 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1008919134 6:56824362-56824384 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1008926727 6:56895659-56895681 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1008965798 6:57311668-57311690 CAAGGCAGGCCGCTGGGAGGTGG + Intergenic
1009041941 6:58190389-58190411 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1009048978 6:58257480-58257502 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1009217794 6:60944656-60944678 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1009622771 6:66097223-66097245 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1009869262 6:69433701-69433723 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1010192157 6:73205999-73206021 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1010246090 6:73661337-73661359 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1010264526 6:73851592-73851614 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1010400707 6:75442393-75442415 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1010513044 6:76744010-76744032 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1011148757 6:84245257-84245279 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1011297134 6:85838305-85838327 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1011426937 6:87239991-87240013 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1011474312 6:87736460-87736482 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1012428589 6:99141733-99141755 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1012479486 6:99650670-99650692 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1012899699 6:104991652-104991674 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1012983804 6:105854536-105854558 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1013190809 6:107803100-107803122 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1013204456 6:107934077-107934099 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1013243795 6:108269571-108269593 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1013410071 6:109876200-109876222 TGAGACAGCCCGGTGGGAGGGGG + Intergenic
1013530892 6:111017852-111017874 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1013681419 6:112528806-112528828 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1013800046 6:113931942-113931964 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1014123327 6:117750745-117750767 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1014137717 6:117907848-117907870 CACGCCAGCCCGGGAGGAGGCGG - Exonic
1014463742 6:121730042-121730064 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1014764351 6:125389769-125389791 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1014800240 6:125770556-125770578 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1015070705 6:129088953-129088975 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1015220740 6:130801997-130802019 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1015643796 6:135364531-135364553 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1017170293 6:151450005-151450027 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1017215291 6:151900034-151900056 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1017493951 6:154967022-154967044 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1017660555 6:156669992-156670014 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1017856071 6:158350366-158350388 CAAGGCAGGCGGCTGGGAGGGGG + Intronic
1018528247 6:164736642-164736664 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1018737282 6:166696784-166696806 CAAGGTGGCCAGGCGGGAAGGGG - Intronic
1019128515 6:169857334-169857356 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1019216176 6:170445225-170445247 CACTGCAGCCCGGCGGTGGGAGG + Intergenic
1019459245 7:1147604-1147626 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1019674328 7:2302458-2302480 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1019981244 7:4623705-4623727 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1020000552 7:4753364-4753386 AAGGGCAGCAAGGCGGGAGGAGG + Intronic
1020157183 7:5736476-5736498 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1020285016 7:6672068-6672090 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1020292089 7:6730003-6730025 CAGGGGAACCGGGCGGGAGGTGG + Intergenic
1020498787 7:8890315-8890337 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1020831606 7:13102310-13102332 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1021120517 7:16790680-16790702 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1021440121 7:20668078-20668100 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1021647276 7:22800603-22800625 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1021735205 7:23636217-23636239 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1021821401 7:24501085-24501107 CACTGCAGCCTGGCAGGAGGTGG + Intergenic
1021991769 7:26147852-26147874 CAAGGCAGACGGCTGGGAGGTGG - Intergenic
1021995785 7:26177238-26177260 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1022005289 7:26261621-26261643 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1022083174 7:27044437-27044459 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1022089461 7:27098053-27098075 CAAGGCAGTCCTCCTGGAGGCGG + Intergenic
1022187768 7:27987011-27987033 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1022274000 7:28838548-28838570 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1022317982 7:29263384-29263406 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1022542700 7:31153410-31153432 CAAGGCAGGCGGCTGGGAGGCGG - Intergenic
1022700223 7:32753528-32753550 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1022756987 7:33303863-33303885 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1023044080 7:36196768-36196790 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1023954345 7:44872242-44872264 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1024309737 7:47959178-47959200 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1024538589 7:50459313-50459335 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1024625713 7:51207786-51207808 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1024910613 7:54443839-54443861 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1024931391 7:54668376-54668398 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1024989315 7:55220829-55220851 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1024991142 7:55235337-55235359 TAAGGCAGCCCGGCTGCAGAGGG + Intronic
1025000476 7:55311572-55311594 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1025011736 7:55403078-55403100 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1025102767 7:56150115-56150137 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1025573105 7:62600288-62600310 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1025775060 7:64553941-64553963 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1025796122 7:64739205-64739227 CAAGGCAGGCGGCCGGGAGATGG + Intergenic
1025800726 7:64784467-64784489 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1025803776 7:64810097-64810119 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1025821747 7:64968709-64968731 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1025828880 7:65033317-65033339 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1025852726 7:65257749-65257771 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1025979630 7:66394714-66394736 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1026007928 7:66614425-66614447 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1026360556 7:69598445-69598467 CGAGGCAGGCGGGCGGGCGGAGG + Intergenic
1026862190 7:73797721-73797743 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1026868104 7:73835569-73835591 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1027183055 7:75952961-75952983 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1027826711 7:83125110-83125132 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1028227563 7:88267033-88267055 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1028535535 7:91887240-91887262 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1028548054 7:92026688-92026710 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1028595774 7:92545451-92545473 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1028685728 7:93586725-93586747 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1029117250 7:98243653-98243675 GATGGCAGGCGGGCGGGAGGTGG - Intronic
1029279342 7:99426546-99426568 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1029334694 7:99888849-99888871 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1029430239 7:100524209-100524231 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1029469079 7:100742506-100742528 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1029963197 7:104709962-104709984 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1030036426 7:105411384-105411406 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1030288202 7:107847909-107847931 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1030329268 7:108255522-108255544 CAAGGCAGGCTGCTGGGAGGTGG - Intronic
1030602643 7:111609666-111609688 CAAGGCAGGCGGCCGGGAGATGG - Intergenic
1030692594 7:112551372-112551394 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1030725599 7:112922312-112922334 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1032043010 7:128577331-128577353 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1032129375 7:129216087-129216109 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1032157017 7:129476814-129476836 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1032179618 7:129663766-129663788 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1032194464 7:129781122-129781144 CAAAGCAGCAGGGAGGGAGGGGG - Intergenic
1032290983 7:130590612-130590634 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1032569440 7:132984419-132984441 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1032589288 7:133177333-133177355 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1033173082 7:139101199-139101221 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1033185593 7:139225221-139225243 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1033219850 7:139520687-139520709 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1033293961 7:140114524-140114546 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1033323654 7:140361906-140361928 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1033333014 7:140431335-140431357 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1034034244 7:147802415-147802437 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1034233872 7:149553900-149553922 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1034723654 7:153315801-153315823 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1034922720 7:155097036-155097058 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1035103952 7:156426298-156426320 CAAGGCAGCCCACCAGGAGATGG + Intergenic
1035404301 7:158587932-158587954 GAAGGGAGCCGGGCGGGCGGGGG - Intergenic
1035612120 8:973600-973622 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1035704381 8:1664072-1664094 AAAGGCAGCCCTGGTGGAGGAGG - Intronic
1036095889 8:5725075-5725097 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1036483079 8:9154526-9154548 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1036737100 8:11329670-11329692 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1037756373 8:21712646-21712668 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1038167860 8:25102789-25102811 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1038595003 8:28880612-28880634 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1038744986 8:30247522-30247544 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1039072377 8:33658862-33658884 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1039153500 8:34529835-34529857 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1039201114 8:35094714-35094736 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1039488099 8:37927477-37927499 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1039651044 8:39339771-39339793 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1039753261 8:40496866-40496888 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1039826647 8:41180111-41180133 TAAGTCAGCCTGGAGGGAGGTGG - Intergenic
1039881298 8:41626905-41626927 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1040041440 8:42919582-42919604 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1040043617 8:42940122-42940144 CAAGGCAGGCCGCCGGGAGGTGG + Intronic
1040052959 8:43033614-43033636 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1040070121 8:43180735-43180757 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1040093476 8:43420131-43420153 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1040121438 8:43688279-43688301 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1040409228 8:47137853-47137875 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1040600472 8:48878830-48878852 CCAGGCAGCCCTGCTGGAGGTGG - Intergenic
1040616357 8:49041931-49041953 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1040785390 8:51158807-51158829 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1040818540 8:51533841-51533863 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1040917142 8:52574191-52574213 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1041066165 8:54085342-54085364 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1041270592 8:56105250-56105272 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1041287100 8:56272622-56272644 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1041357943 8:57021590-57021612 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1041363032 8:57071920-57071942 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1041677392 8:60549279-60549301 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1041920958 8:63180613-63180635 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1042133911 8:65616489-65616511 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1042139229 8:65662454-65662476 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1042195961 8:66232019-66232041 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1042290844 8:67167936-67167958 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1042475575 8:69245373-69245395 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1043958647 8:86390334-86390356 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1043961708 8:86424444-86424466 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1044423702 8:92027412-92027434 CAAGGCAGCCCAAAGGGATGGGG + Intronic
1044597305 8:93971052-93971074 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1044932705 8:97265432-97265454 CAAAGCAGCCCAGCAGGTGGAGG - Intergenic
1044969337 8:97604710-97604732 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1045022008 8:98052157-98052179 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1045120557 8:99029416-99029438 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1045195552 8:99926976-99926998 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1045298799 8:100893158-100893180 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1046636162 8:116678349-116678371 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1046703495 8:117426522-117426544 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1046735975 8:117777461-117777483 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1046770362 8:118111680-118111702 CGCGGCGGCCCGGCTGGAGGCGG + Exonic
1046867296 8:119164975-119164997 CAAGGCAGCGAGGCTGGGGGAGG - Intergenic
1047266482 8:123314405-123314427 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1047388702 8:124432470-124432492 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1048009231 8:130443216-130443238 CGAGGCCGCCCGGTGGGGGGGGG - Intronic
1048368272 8:133757259-133757281 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1048576003 8:135690537-135690559 CACGGGAGCCCGCCGCGAGGGGG + Intergenic
1049177522 8:141202789-141202811 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1049976103 9:862141-862163 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1050417508 9:5432852-5432874 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1050534816 9:6622598-6622620 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1050557171 9:6799204-6799226 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1050571971 9:6949480-6949502 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1050862239 9:10449395-10449417 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1051257953 9:15233712-15233734 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1051276757 9:15406182-15406204 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1051281153 9:15442810-15442832 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1051430743 9:16977970-16977992 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1051661994 9:19434412-19434434 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1052236307 9:26215537-26215559 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1052274723 9:26664011-26664033 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1052338536 9:27342822-27342844 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1052492948 9:29189654-29189676 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1052880942 9:33600644-33600666 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1052928582 9:34038639-34038661 CAAGGCAGGCGGGTGGGAGGTGG - Intronic
1052941804 9:34137195-34137217 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1053131614 9:35618679-35618701 CAAGGCAGCCAGGAGGAGGGTGG - Intronic
1055134045 9:72806903-72806925 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1055241983 9:74197201-74197223 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1055506570 9:76955220-76955242 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1055518988 9:77061242-77061264 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1055585941 9:77760563-77760585 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1056097715 9:83272462-83272484 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1056166698 9:83947869-83947891 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1056229481 9:84527866-84527888 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1056336336 9:85573460-85573482 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1056409489 9:86311976-86311998 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1056564518 9:87759539-87759561 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1056737094 9:89219327-89219349 CAAGGCAGCAGGGAAGGAGGTGG - Intergenic
1057155213 9:92832098-92832120 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1057212356 9:93207032-93207054 CAAGGAAGCCTGGCAGGAGTGGG - Intronic
1057619028 9:96619134-96619156 CCGGGCAGCCCGGTGGGAGGTGG + Intronic
1057630596 9:96716156-96716178 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1057716285 9:97498532-97498554 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1057751384 9:97796201-97796223 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1058018742 9:100067547-100067569 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1058049523 9:100392554-100392576 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1058193765 9:101950304-101950326 CAAGGTAGCCAGGAGGGAAGAGG + Intergenic
1058244295 9:102603910-102603932 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1058368397 9:104235697-104235719 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1058390513 9:104490219-104490241 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1058661244 9:107271327-107271349 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1058722405 9:107775712-107775734 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1058972734 9:110097800-110097822 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1059118217 9:111617861-111617883 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1059392209 9:114006347-114006369 CAAGGCTGCCCGGTGTGGGGAGG - Intronic
1059707893 9:116841017-116841039 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1059880046 9:118678687-118678709 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1060334703 9:122711145-122711167 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
1060349984 9:122851853-122851875 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1060625461 9:125108188-125108210 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1060669893 9:125459454-125459476 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1060682230 9:125576875-125576897 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1060725760 9:126004904-126004926 CAAGACAGCCTGGCAGCAGGGGG - Intergenic
1061142982 9:128779874-128779896 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1061147355 9:128807872-128807894 CAAAGTAGCCCGGCGGCAAGAGG + Exonic
1061427249 9:130506995-130507017 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1061534343 9:131238488-131238510 AACGGCAGCCCGGCGGGGGCTGG + Intergenic
1061619006 9:131798790-131798812 CAAGTCAGCCCAGAGGGATGAGG - Intergenic
1061635719 9:131907574-131907596 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1061808665 9:133149857-133149879 CAAGGGAGCCTGGGGGAAGGAGG + Intergenic
1061828305 9:133275213-133275235 CAGGGCCGCCGGGCGGAAGGCGG - Exonic
1061939550 9:133876660-133876682 GAAGGCAGGACCGCGGGAGGGGG + Intronic
1062496185 9:136832940-136832962 CAGGGCAGCCCAGGGCGAGGAGG - Intronic
1062496200 9:136832984-136833006 CAGGGCAGCCCAGGGCGAGGAGG - Intronic
1062582414 9:137234420-137234442 CGAGCCAGCCCAGCGGGAAGGGG - Exonic
1062609580 9:137368034-137368056 CCAGGCAGCACGGCGGGTGAGGG + Intronic
1203464129 Un_GL000220v1:68994-69016 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1203634503 Un_KI270750v1:97650-97672 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1185584520 X:1235121-1235143 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1186786784 X:12962998-12963020 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1186923060 X:14303099-14303121 CAAGGCAGGCTGCTGGGAGGTGG + Intergenic
1187183809 X:16965749-16965771 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1187184426 X:16969365-16969387 CAAGGCAGGCTGCTGGGAGGTGG + Intronic
1187212643 X:17245443-17245465 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1188086316 X:25905612-25905634 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1188492801 X:30754409-30754431 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1189042125 X:37553758-37553780 TAAGACAGCCAGGTGGGAGGAGG - Intronic
1189056966 X:37707845-37707867 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1189210097 X:39277245-39277267 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1189342018 X:40211411-40211433 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1189407158 X:40735514-40735536 TGAGGCGGCCCGGCGGTAGGCGG - Exonic
1189505760 X:41612055-41612077 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1189570137 X:42286257-42286279 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1189587372 X:42474623-42474645 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1189825385 X:44911666-44911688 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1189838178 X:45041891-45041913 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1189882237 X:45504520-45504542 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1189968713 X:46396638-46396660 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1190158946 X:48016660-48016682 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1190171402 X:48114998-48115020 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1190174642 X:48138925-48138947 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1190184431 X:48222145-48222167 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1190241495 X:48660207-48660229 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1190505375 X:51120133-51120155 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1190769507 X:53503764-53503786 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1190778856 X:53577878-53577900 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1190793523 X:53721494-53721516 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1190820198 X:53966588-53966610 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1190839273 X:54129659-54129681 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1190848442 X:54215545-54215567 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1190891623 X:54573185-54573207 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1191637256 X:63392791-63392813 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1191828598 X:65392121-65392143 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1191835256 X:65456798-65456820 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1191894291 X:65975684-65975706 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1192025653 X:67448650-67448672 CAAGGCAGTCAGGCAGGAGAAGG - Intergenic
1192106884 X:68326219-68326241 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1192324731 X:70122799-70122821 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1192353004 X:70372282-70372304 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1192477114 X:71452700-71452722 CAAGGCAGGCAGCTGGGAGGTGG + Intronic
1192500247 X:71645508-71645530 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1192504827 X:71675541-71675563 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1192530343 X:71877384-71877406 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1192567592 X:72178300-72178322 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1192610146 X:72559426-72559448 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1192663540 X:73067687-73067709 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1192681024 X:73254270-73254292 TAAGACAGCCAGGTGGGAGGGGG - Intergenic
1192739815 X:73882042-73882064 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1192761202 X:74098126-74098148 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1192794263 X:74412992-74413014 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1192886019 X:75335947-75335969 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1192892554 X:75407039-75407061 CAAGGCAGGCAGCTGGGAGGTGG - Intronic
1193067962 X:77279057-77279079 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1193132524 X:77932544-77932566 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1193164732 X:78266079-78266101 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1193328889 X:80214856-80214878 CAAGGCAGGCAGCTGGGAGGTGG - Intergenic
1193362090 X:80590745-80590767 CAAGGCAGGCGGGTGGGAGGTGG - Intergenic
1193362386 X:80591634-80591656 CAAGGCAGCTGGCCGGGTGGGGG - Intergenic
1193372245 X:80712505-80712527 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1193608175 X:83594058-83594080 GCTGGCAGACCGGCGGGAGGAGG + Intergenic
1193890088 X:87033604-87033626 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1194181103 X:90713465-90713487 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1194714790 X:97275917-97275939 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1195257641 X:103104919-103104941 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1195888862 X:109670981-109671003 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1196778439 X:119361752-119361774 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1197199201 X:123733883-123733905 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1197452836 X:126641110-126641132 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1197455559 X:126673575-126673597 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1197735814 X:129850138-129850160 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1198108742 X:133484291-133484313 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1198189225 X:134286350-134286372 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1198246752 X:134839050-134839072 CAAGGCAGGCGGCTGGGAGGTGG - Intronic
1198260329 X:134960092-134960114 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1198476676 X:137001307-137001329 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1198600925 X:138283261-138283283 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1199230866 X:145435983-145436005 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1199586330 X:149420484-149420506 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1199836863 X:151599904-151599926 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1199984692 X:152941999-152942021 CAGGGCTGCCCAGGGGGAGGGGG + Intronic
1200324682 X:155224241-155224263 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1200387520 X:155908198-155908220 CAAGGCAGGCGGCTGGGAGGTGG + Intronic
1200527722 Y:4295354-4295376 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1200953009 Y:8918536-8918558 CAAGGCAGGCAGCTGGGAGGTGG + Intergenic
1201017959 Y:9624336-9624358 GGAGGCAACCCTGCGGGAGGAGG + Intergenic
1201294880 Y:12454100-12454122 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1201335698 Y:12878489-12878511 CAAGGCAGGCTGCTGGGAGGTGG - Intergenic
1201440332 Y:14001202-14001224 CAAGGCAGGCGGCTGGGAGGTGG + Intergenic
1201444239 Y:14041506-14041528 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic
1201948225 Y:19535555-19535577 CAAGGCAGGCGGCTGGGAGGTGG - Intergenic