ID: 900517549

View in Genome Browser
Species Human (GRCh38)
Location 1:3090185-3090207
Sequence CCCGAACGCCACCACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900517541_900517549 6 Left 900517541 1:3090156-3090178 CCAGCAAGCTTCTTGATGCCCAG 0: 1
1: 0
2: 1
3: 18
4: 193
Right 900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900517549 Original CRISPR CCCGAACGCCACCACGGGGC TGG Intronic
900439115 1:2644561-2644583 CCCGCAAGCCAGCACAGGGCAGG - Intronic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
900548405 1:3241451-3241473 CCCCACCACCACCCCGGGGCTGG + Intronic
900763028 1:4485706-4485728 CCCTAAGGCCAGCACAGGGCAGG - Intergenic
901332829 1:8423903-8423925 CCCGACCCCCACCCCGAGGCCGG + Intronic
905789662 1:40783527-40783549 CCCGAAGGCCAGCCCGGGGTGGG - Intergenic
910981370 1:92962039-92962061 CCCGACCGCCACCAAGGGCGAGG - Intergenic
1064785346 10:18888379-18888401 CCCGGACCCCTTCACGGGGCTGG - Intergenic
1066065761 10:31759918-31759940 CCCGAGCGCCGCCTCGGGTCCGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1069712293 10:70497397-70497419 CCCAAACGCTACCTCGGGTCAGG - Intronic
1070835034 10:79442718-79442740 CCCCAATGCCACCAAGGGGCTGG - Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1076947953 10:133664851-133664873 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076948943 10:133668161-133668183 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076949927 10:133671460-133671482 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076950911 10:133674759-133674781 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076951901 10:133678069-133678091 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076952890 10:133681379-133681401 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076953874 10:133684678-133684700 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076954858 10:133741030-133741052 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076955847 10:133744340-133744362 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076956837 10:133747650-133747672 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076957824 10:133750959-133750981 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076958809 10:133754258-133754280 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076959798 10:133757568-133757590 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076960782 10:133760867-133760889 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1080406897 11:31987567-31987589 CGCGCCCGCCACCCCGGGGCTGG - Intronic
1082838499 11:57668612-57668634 CCCGGTCCCCACCACGGGACTGG - Intronic
1083572490 11:63768194-63768216 CCCGAGGGGCCCCACGGGGCAGG - Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084219331 11:67667782-67667804 CTCGAATGACCCCACGGGGCTGG + Intronic
1085533778 11:77206320-77206342 CCCCGACTCCACTACGGGGCAGG - Intronic
1086349838 11:85934691-85934713 ACCGAAGGCCGCCACTGGGCGGG + Intergenic
1097194653 12:57236763-57236785 CCCCAACCCCACCCCGGGTCTGG + Intronic
1105250781 13:18697444-18697466 CCCGATGGCCACCAGAGGGCTGG - Intergenic
1122455735 14:101849325-101849347 CCCGAACACCACCCATGGGCGGG - Intronic
1124426942 15:29570616-29570638 CCCGAGCGCCAGCACGATGCGGG + Exonic
1127394701 15:58535220-58535242 CCCCCACCCCACCATGGGGCTGG + Intronic
1128875066 15:71194963-71194985 TCCGAAGCCCAGCACGGGGCTGG + Intronic
1132885757 16:2181291-2181313 CCCGAGGGCCACCACGCGGCAGG - Exonic
1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG + Intergenic
1135571102 16:23549902-23549924 CCCCCAGGTCACCACGGGGCTGG + Intronic
1138514264 16:57527249-57527271 CCAGAAAGCCACCTAGGGGCAGG - Intronic
1142000534 16:87661731-87661753 CCCGCAGGCCGCCACGGGGCGGG + Intronic
1142393338 16:89816576-89816598 CCCGAACTCCGCCTCGGGCCAGG - Exonic
1142470309 17:159713-159735 CCTGAACGGCACCAATGGGCCGG + Intronic
1143166589 17:4900070-4900092 CCCGAAGCCCACCCTGGGGCTGG + Exonic
1143452240 17:7043015-7043037 CCCAACCATCACCACGGGGCGGG + Exonic
1144762860 17:17717230-17717252 CCAGGAAGCCACCAAGGGGCTGG - Intronic
1144872151 17:18378081-18378103 ACCAAATGCCAGCACGGGGCTGG - Intronic
1145260413 17:21351540-21351562 CCAGGATGCCACCATGGGGCGGG - Intergenic
1146725295 17:35151111-35151133 CCCGCGCCCCACCGCGGGGCGGG + Intronic
1146725341 17:35151327-35151349 CCCGCGCCCCACCGCGGGGCGGG + Intronic
1146965738 17:37028301-37028323 CCCGACCACCACCAAGGAGCTGG - Intronic
1147754893 17:42761511-42761533 CCCTGACCCCACCTCGGGGCGGG + Intronic
1151749129 17:76026975-76026997 ACCAAATGCCAGCACGGGGCTGG + Intronic
1154438069 18:14361482-14361504 CCCGATGGCCACCAGGGTGCTGG + Intergenic
1155152898 18:23136235-23136257 CCCCCGCGCCACCCCGGGGCCGG - Exonic
1156461327 18:37322919-37322941 TCCCAAGGCCACCACGTGGCAGG + Intronic
1157544786 18:48539840-48539862 CCCAAACGCCACCCCGAGACGGG - Intronic
1160024072 18:75204635-75204657 CCCCACCGCCACCACGGAGAGGG + Intronic
1160344722 18:78123680-78123702 CCAGATCCCCACCAAGGGGCAGG + Intergenic
1161118729 19:2513351-2513373 CCCGACCCCCTCCACGGGGCTGG - Exonic
1162390821 19:10389051-10389073 GCCGATCACCACCAGGGGGCAGG - Intergenic
1164305792 19:24003266-24003288 CCCGCACCCTACCAAGGGGCAGG + Intergenic
1164546879 19:29173416-29173438 CCCCAACTCCACCCCTGGGCTGG - Intergenic
1164593140 19:29517113-29517135 CTCGAAGGCCAGCACAGGGCTGG - Intergenic
1166763841 19:45240951-45240973 CCCTAACGCCTGCACAGGGCTGG - Intronic
1168116099 19:54222075-54222097 CCCTGAGGCCACCACAGGGCTGG + Exonic
1168119081 19:54241823-54241845 CCCTGAGGCCACCACAGGGCTGG + Exonic
926209157 2:10856204-10856226 CCCCACCTCCACCATGGGGCAGG - Intergenic
929808656 2:45169903-45169925 CGCGACCGCCACCGCGGGGTGGG - Intergenic
948943821 2:241209542-241209564 CCCGAACCCCATCACGGGTGAGG + Exonic
1175243577 20:57567685-57567707 CCCAAAGGCCCCCAAGGGGCGGG - Exonic
1175773756 20:61640448-61640470 CCCGGAAGCCAGCACAGGGCTGG - Intronic
1179457391 21:41508524-41508546 CCCGGAGGCCAAGACGGGGCCGG - Intronic
1179996485 21:44976733-44976755 CCCGATGGCCACCAGGGGGCTGG - Exonic
1181127022 22:20708541-20708563 CCCGGGCGCCACCTGGGGGCAGG + Intronic
1181240356 22:21473844-21473866 CCCGGGCGCCACCTGGGGGCAGG + Intergenic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
956797637 3:72731073-72731095 CCCGAATCCCACCACAGGGGTGG - Intergenic
956798374 3:72736178-72736200 CCCGAATCCCACCACAGGGGTGG - Intergenic
964258731 3:154810210-154810232 CCCGCACGCCACAACAGGCCTGG - Intergenic
979328759 4:119405929-119405951 CCCGAAGGCCTGCACGGGCCCGG - Intergenic
982325626 4:154125957-154125979 CCCCACCGCCACCCCTGGGCTGG - Intergenic
985456347 4:190082128-190082150 CCCGGACGCCTCCGCGCGGCAGG + Exonic
990003599 5:50922074-50922096 CCCACACGCCCCCTCGGGGCTGG - Intergenic
990553754 5:56909788-56909810 CCCAGACGCCACCACGGCGGCGG + Intronic
1000692831 5:164344382-164344404 CCCTAACACCACCACAGAGCTGG + Intergenic
1002512700 5:179733126-179733148 CGCGAACTCCGCCATGGGGCAGG - Exonic
1003092875 6:3118826-3118848 CCCGAACGCGGCCGCGGGTCCGG - Exonic
1022098798 7:27157047-27157069 CCACAAGGCCACCGCGGGGCAGG - Intronic
1025177472 7:56809401-56809423 CCCGAAGGCCTGCACGGGCCCGG - Intergenic
1025694320 7:63766987-63767009 CCCGAAGGCCTGCACGGGCCCGG + Intergenic
1027773964 7:82443146-82443168 CTCGGGCGCCTCCACGGGGCCGG - Intronic
1034921150 7:155083521-155083543 CCCCAAGGCCTCCACAGGGCAGG - Intronic
1036210294 8:6835374-6835396 CCCTAACCCCACCCCGGCGCCGG - Intronic
1051126166 9:13808164-13808186 CCCTACCTCCACCACAGGGCAGG + Intergenic
1057619117 9:96619450-96619472 CCCGAGCGCCCGCGCGGGGCTGG - Exonic
1062041537 9:134406634-134406656 CCCGGAGCCCAGCACGGGGCAGG + Intronic
1062183490 9:135203594-135203616 CCCCAGAGTCACCACGGGGCTGG - Intergenic
1062275762 9:135729871-135729893 GCCCAACCCCACCACTGGGCAGG + Intronic
1186624195 X:11274779-11274801 CCCCAACCCCACCACCGGACAGG + Intronic
1189727096 X:43978132-43978154 CCCTCACTCCACCATGGGGCAGG - Intergenic
1190245742 X:48689000-48689022 CCCGACCCCCACCAGGGGCCAGG - Exonic