ID: 900517754

View in Genome Browser
Species Human (GRCh38)
Location 1:3091163-3091185
Sequence GCTATTGGTCGGTGGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900517754_900517759 18 Left 900517754 1:3091163-3091185 CCAAGGAGCCACCGACCAATAGC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 900517759 1:3091204-3091226 CGCTTCCATCAGACGTGACCTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900517754 Original CRISPR GCTATTGGTCGGTGGCTCCT TGG (reversed) Intronic