ID: 900522325

View in Genome Browser
Species Human (GRCh38)
Location 1:3111635-3111657
Sequence GGTCAGGGGCGCACGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900522315_900522325 20 Left 900522315 1:3111592-3111614 CCGAGCAAGGTTGGGGGAGCCCA 0: 1
1: 0
2: 0
3: 13
4: 174
Right 900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 125
900522320_900522325 0 Left 900522320 1:3111612-3111634 CCAGCGCACGGAAAGGAGGCGCA 0: 1
1: 0
2: 0
3: 0
4: 44
Right 900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 125
900522319_900522325 1 Left 900522319 1:3111611-3111633 CCCAGCGCACGGAAAGGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900522325 Original CRISPR GGTCAGGGGCGCACGCCCCC TGG Intronic
900138433 1:1128675-1128697 GGCCAGGCGCGGACTCCCCCGGG - Intergenic
900353233 1:2247306-2247328 GGTCAGGGGCGCCCTCAGCCTGG + Intronic
900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG + Intronic
901757104 1:11448097-11448119 GGGCTGGGGGCCACGCCCCCTGG + Intergenic
901944535 1:12691078-12691100 GGTCAGGGGCTCACGTCTCCAGG + Intergenic
905178872 1:36154970-36154992 GGTCAGGGGCTCAGGCAACCTGG - Intronic
905933867 1:41808242-41808264 GGTCAGGAGAGCATGCCCTCTGG - Intronic
913971685 1:143421901-143421923 GGTCAGCGGCCCAGGCCCCTTGG + Intergenic
914066062 1:144247514-144247536 GGTCAGCGGCCCAGGCCCCTTGG + Intergenic
914113089 1:144718840-144718862 GGTCAGCGGCCCAGGCCCCTTGG - Intergenic
917028244 1:170664463-170664485 AGTGAGGGGCGCATGCCCACGGG + Intronic
919892142 1:201983109-201983131 AGTCTGGGGCGCACTCACCCCGG - Exonic
920286146 1:204881249-204881271 CTTCAGGGGCACACACCCCCAGG - Intronic
1067455567 10:46417062-46417084 GGTCATGGGCACAGGCCCCCGGG + Intergenic
1067631636 10:47967577-47967599 GGTCATGGGCACAGGCCCCCGGG - Intergenic
1076075901 10:127533659-127533681 GGGAAGGGGCCCCCGCCCCCAGG + Intergenic
1076202443 10:128569277-128569299 CGTCAGGGCCGCCCGCTCCCAGG + Intergenic
1076234860 10:128855856-128855878 GGTCAGAAGCTCACGTCCCCTGG - Intergenic
1076507348 10:130986942-130986964 GGGCAGGGACCCAGGCCCCCAGG - Intergenic
1076646902 10:131960006-131960028 GGTCTGCGGCGCACGTTCCCTGG + Intergenic
1077395050 11:2316519-2316541 GGGGAGGGGCGCCCGCACCCTGG + Intronic
1077459598 11:2702148-2702170 GGTCAGGGGAGCAGGATCCCAGG + Intronic
1078090742 11:8263097-8263119 GCCCGGGGCCGCACGCCCCCCGG - Intronic
1078659719 11:13277464-13277486 GCACAGGAGCGCACGCCCCGAGG - Intronic
1083572076 11:63766246-63766268 GGGCAGGGGGGCACTCCCCCAGG + Exonic
1083779640 11:64911193-64911215 GGTCAGGGTCACACCCCCCAAGG + Exonic
1089396289 11:118138034-118138056 GGTCAGGGTGGAACGCCTCCCGG - Intronic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1097014247 12:55974163-55974185 GGGCAGGGGCGGAAGCGCCCGGG + Intronic
1100260736 12:92929619-92929641 GGTCAGGGAGGGACACCCCCAGG - Intergenic
1105071355 12:133235951-133235973 GCTGAGGGGCGCCGGCCCCCGGG - Exonic
1108541773 13:51452617-51452639 GGGCGGGGGAGCACGGCCCCCGG + Exonic
1111141760 13:84127843-84127865 GGTCAGGGGCCCATGCTCCCAGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1116356647 14:43938770-43938792 GGACAGGAGCCCACGCTCCCCGG + Intergenic
1118930207 14:70234319-70234341 GCTCCGGAGCGGACGCCCCCAGG + Intergenic
1122909790 14:104821872-104821894 GATCAGGGGCCCACACTCCCGGG + Intergenic
1123174332 14:106402102-106402124 GGTGAGGGGCTCACGGCACCTGG + Intergenic
1123182544 14:106483037-106483059 GGTGAGGGGCTCACGGCACCTGG + Intergenic
1202944359 14_KI270726v1_random:13692-13714 GGTGAGGGGCTCACGGCACCTGG - Intergenic
1125746539 15:42000987-42001009 GGCCAGGGGCTCAGGACCCCTGG + Intronic
1129737258 15:77973260-77973282 GGCCAGGGGAGCGGGCCCCCAGG + Intergenic
1129848814 15:78780365-78780387 GGCCAGGGGAGCGGGCCCCCAGG - Intronic
1131097539 15:89665980-89666002 GGTCAGAGGCGCAGGGCCCAGGG - Intronic
1132589817 16:721745-721767 GGGCAGGGGCGCCCGCCAGCAGG - Intronic
1132684984 16:1158506-1158528 CATCAGGGCCGCACGCCCCGTGG + Intronic
1132699712 16:1217117-1217139 GATCAGGGCCACACGCCTCCTGG + Intronic
1133040907 16:3059338-3059360 CTTCAGGGGCGCACGCGCGCTGG + Exonic
1142216370 16:88831922-88831944 AGTGAGGGGCGCACACACCCTGG + Intronic
1142973694 17:3630393-3630415 GGGGAGGGGCGCAGGCCTCCCGG + Intronic
1144734415 17:17546987-17547009 CTTCGGGGGCGCAGGCCCCCTGG - Intronic
1147690605 17:42312530-42312552 GCTCAGGGACGCGCGCTCCCTGG + Intergenic
1148466654 17:47869031-47869053 AGTCAAGGGCTCACGCCCCTGGG - Intergenic
1148674669 17:49438489-49438511 GGGCCAGGGGGCACGCCCCCTGG + Intronic
1151498400 17:74473451-74473473 GGTCAGGGCCGCATGGACCCTGG - Intronic
1151605216 17:75131386-75131408 GGTCAGGGGCACGCGCCCAAAGG + Intronic
1152345531 17:79748469-79748491 GGTCAGGGGTGCCCGCGCCTGGG + Intergenic
1160814465 19:1028744-1028766 GCTCAGGGGCCCAGGTCCCCTGG - Intronic
1161029215 19:2050284-2050306 GGTCAGGTGCACCCACCCCCAGG - Intronic
1161349885 19:3785752-3785774 GGACAGGTGCGCACGTTCCCAGG - Intronic
1161568173 19:5015030-5015052 GGGCAGAGGAGCTCGCCCCCTGG - Intronic
1162101663 19:8342832-8342854 GGGGAGGGACGCACGGCCCCCGG - Intronic
1163087301 19:14991411-14991433 GGTCAGGAGTTCAAGCCCCCTGG + Intronic
1163111055 19:15161167-15161189 GGTCTAGGGCGCCAGCCCCCTGG - Exonic
1163314038 19:16530751-16530773 GGCCCGGGGCCCACGCACCCGGG + Exonic
1163358352 19:16829586-16829608 GGTGAGGGGCGCCCGCCCGCGGG - Intronic
1165170337 19:33887737-33887759 GGCCAGAGGCCCACGCACCCTGG + Intergenic
1165854960 19:38874158-38874180 GGTCATGGGCCCACCCCGCCAGG - Intronic
1166784112 19:45357570-45357592 GGTCGGGGGCCCAGCCCCCCGGG - Intronic
926630033 2:15127848-15127870 GGTCAGGGGCTCAGGTGCCCAGG - Intergenic
927472488 2:23386125-23386147 GGAGAGGGGCGCGCGCCGCCGGG - Intronic
935667450 2:105525179-105525201 GGTCAGGAGCCCATGCTCCCAGG + Intergenic
946431392 2:219628758-219628780 GGTCTGGGGCCCACCTCCCCAGG - Intronic
947593349 2:231396798-231396820 GGACAGGGGCTCAGGCCCCAGGG + Intronic
948944441 2:241212339-241212361 GGACAGGGGCCCATGCCTCCTGG + Intronic
1169088352 20:2840891-2840913 TGACAGGGGCGAACGCCGCCGGG - Intronic
1170026075 20:11891019-11891041 GGGCAGGGGCGCGCGCCCTGCGG + Intronic
1173672639 20:44809494-44809516 GGTCAGGGGCACACACCAGCGGG + Intronic
1174139946 20:48405791-48405813 GGTCAGGGAGGCACTCACCCAGG + Intergenic
1176066400 20:63198793-63198815 GGTCAGGGGCACCTGCCGCCAGG + Intronic
1176082128 20:63278824-63278846 GTTCAGGGCCCCACGCCCTCGGG + Intronic
1176238046 20:64063384-64063406 GGTGAGGGGCGCGGGCCGCCAGG + Exonic
1179919278 21:44498862-44498884 GGTGATGGGCGCAAGGCCCCAGG - Exonic
1180180680 21:46117489-46117511 GGTCAGGCACCCACACCCCCTGG - Intronic
1180232725 21:46437081-46437103 GGTAAGGGGTGAGCGCCCCCAGG + Exonic
1180649872 22:17369296-17369318 GGGGCGGGGCGCGCGCCCCCGGG - Intronic
1181160539 22:20957374-20957396 GGTCCGGGTTGCACGCCCCGCGG - Intergenic
1183831587 22:40420962-40420984 GGACAGGGGGGCACCCCCCATGG - Exonic
1184148926 22:42627483-42627505 GGTCAGGGGCCCAGGCCCAGTGG - Intronic
1185401564 22:50620970-50620992 GTTCACGTGCGCACGTCCCCGGG + Intergenic
949414151 3:3798925-3798947 GGTCTGCGGAGGACGCCCCCGGG + Intronic
950586551 3:13896148-13896170 GGGCAGAGGCGCAGCCCCCCGGG - Intergenic
965558114 3:170038045-170038067 GGGCAGGGGAGCACGGCCCCGGG - Exonic
968047491 3:195632199-195632221 GGTCAGGGGCTCAGGGCGCCGGG - Intergenic
968307121 3:197657725-197657747 GGTCAGGGGCTCAGGGCGCCGGG + Intergenic
968471901 4:786325-786347 GGCAAGGGGCGCGCGCCCCCAGG - Exonic
974009302 4:56592702-56592724 GGTCGGGGGCGGCCGCCGCCTGG + Intronic
976199111 4:82561841-82561863 GGGCCGGGCCGGACGCCCCCTGG + Intronic
978587902 4:110293081-110293103 GGTCAGGGGCCAAGGCCTCCTGG + Intergenic
983296640 4:165874896-165874918 GGTCGGAGGCGCACGTGCCCGGG + Intronic
983940279 4:173529537-173529559 GGCCAGGGGCGCACGGTGCCAGG - Exonic
985655129 5:1127474-1127496 GGGCAGGGCTGCACGCCCTCCGG - Intergenic
985744125 5:1636965-1636987 GGTCAGGGGCTCAGGGCGCCGGG + Intergenic
987040241 5:14055332-14055354 GGGCAGGGGCGCAAGCTCCCTGG + Intergenic
997990656 5:138542612-138542634 GGTAAGGGGCCCGCGCTCCCCGG - Intronic
1001562284 5:172677564-172677586 GGTCAGTGGCGCACAGACCCAGG + Intronic
1006738896 6:36293568-36293590 GGTTAGGGGCGCAGACCCTCAGG - Intronic
1007321925 6:41033913-41033935 GGCCGGGGGCCCACGCCTCCCGG - Exonic
1011398812 6:86937823-86937845 GGTGAGGGGCGCACACCTTCCGG + Exonic
1012916890 6:105180028-105180050 GGGCACGGGCGCGCGCCCCGGGG + Intergenic
1013045191 6:106478624-106478646 GATCAGGGGCCCCCGACCCCTGG + Intergenic
1016340895 6:143060768-143060790 GGGGCGGGGCGCGCGCCCCCGGG - Intronic
1017738237 6:157381985-157382007 GGCTGGGGGCGCACACCCCCAGG - Exonic
1022109730 7:27220810-27220832 GGTTAGGGGCGCAAAGCCCCGGG - Intergenic
1028190509 7:87845274-87845296 GATCAGGGGTCCACGACCCCAGG + Intronic
1029112912 7:98222727-98222749 GGTGAGGTGCACACGCCCACGGG - Intronic
1033406253 7:141073551-141073573 GCTCAGAGGCGCACTCCCCGCGG - Intergenic
1034618105 7:152436107-152436129 CGTGAGGGGCGCCGGCCCCCGGG + Intergenic
1035228031 7:157444286-157444308 GGTGGGGGTCGCACTCCCCCAGG + Intergenic
1037583969 8:20263756-20263778 GGTCAGAGGGGCAGGCCCTCTGG + Intronic
1040907232 8:52481031-52481053 GCTCAGGGTCGCACTACCCCTGG - Intergenic
1045516244 8:102863462-102863484 GGTGGGGGCCGCACGCCGCCAGG + Intronic
1049585500 8:143430788-143430810 CGGGAGGGGCGCGCGCCCCCGGG + Intergenic
1050537780 9:6645433-6645455 GGTCGGGGGCGGCCGCCGCCTGG - Exonic
1054452133 9:65408987-65409009 GGTCAGCGGGGCCCGCCCACCGG + Intergenic
1058467636 9:105244904-105244926 GGTGAGGGGCTCCCGCCTCCCGG + Exonic
1059375367 9:113876563-113876585 GGTCCGGAGAGCACCCCCCCGGG + Intronic
1061559685 9:131394368-131394390 GGGCAGGGCCGCAGGGCCCCCGG - Intronic
1062320199 9:135986918-135986940 GGGCAGGGGCCCAGGCCCCCCGG - Intergenic
1062669070 9:137695679-137695701 TGTGAGGGGCCCACGCCACCCGG - Intronic
1185895362 X:3853735-3853757 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1185900479 X:3892159-3892181 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1185905595 X:3930590-3930612 GGGCAGGGGTGCGCTCCCCCTGG - Intergenic
1186514722 X:10158551-10158573 GGTAAGGGGCGCGCGGCGCCTGG + Exonic
1200256072 X:154584210-154584232 GGTGAGGGCGGCACGGCCCCGGG - Intergenic
1200261697 X:154620193-154620215 GGTGAGGGCGGCACGGCCCCGGG + Intergenic