ID: 900522575

View in Genome Browser
Species Human (GRCh38)
Location 1:3112846-3112868
Sequence TGATGGGGCTGGAGCCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 570}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900522575_900522592 19 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522592 1:3112888-3112910 CCCGGGCCATCCTTCTTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 50
900522575_900522586 1 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522586 1:3112870-3112892 CCTCCTGTGGAACGGGGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 132
900522575_900522590 18 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522590 1:3112887-3112909 TCCCGGGCCATCCTTCTTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 115
900522575_900522583 -6 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522583 1:3112863-3112885 CCATCATCCTCCTGTGGAACGGG 0: 1
1: 0
2: 0
3: 17
4: 508
900522575_900522587 2 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522587 1:3112871-3112893 CTCCTGTGGAACGGGGTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 123
900522575_900522596 30 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522596 1:3112899-3112921 CTTCTTGCGGGGAGAGCCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 157
900522575_900522581 -7 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522581 1:3112862-3112884 CCCATCATCCTCCTGTGGAACGG 0: 1
1: 0
2: 0
3: 22
4: 250
900522575_900522584 -5 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522584 1:3112864-3112886 CATCATCCTCCTGTGGAACGGGG 0: 1
1: 0
2: 1
3: 13
4: 374
900522575_900522589 17 Left 900522575 1:3112846-3112868 CCGCCTGGGCTCCAGCCCCATCA 0: 1
1: 1
2: 3
3: 52
4: 570
Right 900522589 1:3112886-3112908 GTCCCGGGCCATCCTTCTTGCGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900522575 Original CRISPR TGATGGGGCTGGAGCCCAGG CGG (reversed) Intronic
900121863 1:1051678-1051700 GGATGGGCCCGGAGCCCACGAGG + Intronic
900322497 1:2092142-2092164 GGACGGGGCCGGAGCCAAGGGGG - Intronic
900417927 1:2543552-2543574 TGATGGGGCTGGAGCCCAGTGGG - Intergenic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
900822266 1:4898814-4898836 AGCTGGTCCTGGAGCCCAGGTGG + Intergenic
901173179 1:7279112-7279134 TGAGGGGGCTGGTGAGCAGGTGG + Intronic
901740990 1:11341789-11341811 TGGTTGGATTGGAGCCCAGGTGG + Intergenic
901759822 1:11463446-11463468 GGAGGGTGCTGGAGCCCATGAGG + Intergenic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902098482 1:13965964-13965986 TATTGGAGATGGAGCCCAGGAGG + Intergenic
902245666 1:15118842-15118864 TCATGGGGCAGGAACCCAGCTGG + Intergenic
902377156 1:16035225-16035247 TGGAGGGGAGGGAGCCCAGGGGG + Intergenic
902389700 1:16095946-16095968 AGATGGGGCTGGAAGCCTGGAGG - Intergenic
903954896 1:27018572-27018594 TGATGGGGCTGGAGATGATGGGG + Intergenic
904202064 1:28826424-28826446 TGAGATGGGTGGAGCCCAGGAGG + Intronic
904567455 1:31436086-31436108 TGCTGGGGCAGGGGCCGAGGAGG + Intergenic
904832917 1:33316744-33316766 GAAGGGGGCTGGAGCCCAGAAGG + Intronic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905510716 1:38517576-38517598 TGAGGACGCTGGAGCCTAGGTGG + Intergenic
905695505 1:39970565-39970587 TGGTGGGGCTGGAGGCCTGTGGG + Intergenic
905863216 1:41363627-41363649 TGGTGGGGGTTGAGCCCAAGGGG - Intronic
905942503 1:41875164-41875186 GGATGGTGCTGGAGCCCTGAAGG - Intronic
906182696 1:43835553-43835575 AGAGGGAGCTGGAGCCCAGCAGG - Intronic
906242815 1:44252361-44252383 TAATGGGGCAGCAGCCAAGGCGG - Intronic
906265382 1:44424869-44424891 TAAGCGGGCTGGAGCCCAAGGGG - Intronic
906636295 1:47412680-47412702 TCATGGGCCTGGATTCCAGGCGG - Intergenic
906724791 1:48036290-48036312 TGATGTGGCTTGAGCCAAGCAGG - Intergenic
907108937 1:51909002-51909024 GGCTGGGGCTGGGGCCCAGGAGG - Exonic
907267406 1:53271368-53271390 TGAAGGTCCAGGAGCCCAGGAGG + Intronic
908192305 1:61715770-61715792 TTTAGGGGCTTGAGCCCAGGAGG + Intronic
908616186 1:65925514-65925536 TGATGGGGCAGGGGCTCGGGGGG - Intronic
908740131 1:67318771-67318793 GGATGAGACTGGAGCTCAGGGGG + Intronic
909943223 1:81634622-81634644 GGCTGGGACTGGAACCCAGGAGG - Intronic
910805105 1:91181933-91181955 TCATGGCTCTGGAGGCCAGGAGG + Intergenic
912382803 1:109256389-109256411 TGATGAGGCTGGAGGGTAGGTGG + Intronic
912516609 1:110220334-110220356 GGATGTGGCTGGTGCCCACGGGG + Intronic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
913442168 1:118909505-118909527 GGATGGGGCTGGAAGCCAGGAGG + Intronic
913472882 1:119207448-119207470 AGCTGGAGCTGGAGTCCAGGAGG - Intergenic
913999727 1:143683222-143683244 TGAAAGGACTGGTGCCCAGGGGG + Intergenic
914194913 1:145442154-145442176 TGAGAGGACTGGTGCCCAGGGGG + Intergenic
914476187 1:148024721-148024743 TGAGAGGACTGGTGCCCAGGGGG + Intergenic
914753920 1:150552652-150552674 AGATGGGGTGGGAGCCTAGGGGG - Intronic
915244461 1:154546561-154546583 TGGTGGGGCTTGTGCCCAGTGGG + Intronic
915358878 1:155273535-155273557 TCCTGGGGGCGGAGCCCAGGGGG - Intronic
915433505 1:155885686-155885708 TGAGGTCGCTGGAACCCAGGAGG - Intergenic
915625828 1:157113527-157113549 TGATGGGCCTGGAGGTCAAGAGG + Intergenic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
917426356 1:174918685-174918707 TGAGGTTGCTTGAGCCCAGGAGG + Intronic
919863278 1:201757887-201757909 TGATGCAGCTGGTTCCCAGGTGG + Intronic
920091016 1:203453300-203453322 TCCTGGGGCTGGTGGCCAGGAGG - Intergenic
920417770 1:205810294-205810316 TGATGGGGCTGGGGTAGAGGTGG - Exonic
920876474 1:209840923-209840945 TGATGGTCCTCAAGCCCAGGGGG - Exonic
921214377 1:212924696-212924718 TGAACGGGCTAGAGGCCAGGTGG - Intergenic
921828418 1:219700157-219700179 TGATGGGGATGGAGCACAATGGG - Intronic
922802957 1:228372386-228372408 TGCTGGGGCAGGGGCCCATGTGG + Exonic
923168029 1:231385938-231385960 GGCTGAGGCAGGAGCCCAGGAGG - Intronic
924451923 1:244186556-244186578 TGAGTGGGGTGGAGGCCAGGAGG - Intergenic
924948130 1:248859306-248859328 GGCTGGGGTTGGAGCACAGGAGG - Intergenic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064387406 10:14909019-14909041 TGATGGGGATGTACCCCAGTGGG - Exonic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1065145454 10:22763641-22763663 TGATGAGGATGGAGCCCAGAGGG + Intergenic
1065145591 10:22764553-22764575 TGGTGTGGATGGAGCCCAGAGGG + Intergenic
1065150538 10:22818069-22818091 GACTGAGGCTGGAGCCCAGGAGG - Intergenic
1065230761 10:23595916-23595938 TGATAGGGGTGGAGCCAAGACGG - Intergenic
1065488209 10:26255045-26255067 GTATGGGCCTGGAGCTCAGGAGG + Intronic
1065767065 10:29040072-29040094 TGGTGGAGATGGAGCCCAGCTGG - Intergenic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1065935183 10:30514973-30514995 TGTTTGGTCTGGAGGCCAGGAGG - Intergenic
1066125614 10:32338846-32338868 GGAGGAGCCTGGAGCCCAGGAGG + Intronic
1066461537 10:35616644-35616666 TGATGGGACTCGGGCTCAGGAGG - Intergenic
1067048012 10:42996745-42996767 GGGTGGGGCTGGAGCCCGGCTGG + Intergenic
1068984815 10:63097796-63097818 AGATGGGACTTGAGCCCAGGAGG - Intergenic
1069473128 10:68710741-68710763 TGACATGGCTTGAGCCCAGGAGG - Intergenic
1070757850 10:79004718-79004740 AGATGGGAATTGAGCCCAGGAGG + Intergenic
1070788957 10:79178484-79178506 AGTTGGAGCTGGAGCCCAGCTGG + Intronic
1070923110 10:80201441-80201463 TGGTGGGTCTGGGGCTCAGGAGG - Intronic
1072741289 10:97911542-97911564 TGCTGGGGCTGGCACCCAGGAGG - Intronic
1073004271 10:100310242-100310264 GGAGGGTGCTTGAGCCCAGGAGG + Intronic
1073096590 10:100983843-100983865 TGAGGGGGCTGGGGGCCTGGAGG + Exonic
1073104533 10:101024678-101024700 GGCTGAGGCAGGAGCCCAGGAGG + Intronic
1073105892 10:101031936-101031958 TACTGGGGTAGGAGCCCAGGGGG + Intronic
1075201506 10:120408534-120408556 GGCTGGGGCTGGTGCCCATGGGG - Intergenic
1075354694 10:121760938-121760960 TGTTGGAGGTGGAGCCCAGTGGG + Intronic
1075488520 10:122847195-122847217 TGACTGTGCTGCAGCCCAGGAGG + Intronic
1075673620 10:124281184-124281206 TGCTGGGTCTGCATCCCAGGAGG - Intergenic
1076344955 10:129773596-129773618 TGATGTGGGAGGCGCCCAGGAGG + Intergenic
1076502417 10:130947801-130947823 TTATGGGGTGAGAGCCCAGGAGG + Intergenic
1076647417 10:131962759-131962781 GGTTGGGGGTGGAGCCCAGCAGG - Intergenic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077102477 11:828325-828347 TCAGGAGGCTGGAACCCAGGAGG - Intronic
1077181286 11:1218358-1218380 GGCTGGGGCTGGGGCACAGGGGG - Intergenic
1077413200 11:2413036-2413058 TGGTGAGGCTGGCGCCCAGCCGG + Intronic
1077465722 11:2732867-2732889 AGATGGGGCTGGGGCCCATGGGG - Intronic
1077504518 11:2923925-2923947 TGCTGGGCCCTGAGCCCAGGTGG + Intronic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1077617950 11:3692220-3692242 TCAGGAGGCTGGGGCCCAGGAGG + Intronic
1078099608 11:8322144-8322166 TGACGGAGGTGGAGCTCAGGTGG - Intergenic
1078897083 11:15606241-15606263 TTATGAGGATGGAGCCCTGGGGG - Intergenic
1078930153 11:15906329-15906351 TGATGGTGCTCTAACCCAGGGGG - Intergenic
1079135662 11:17774868-17774890 GGATGAGGCTGGAGCCTCGGGGG - Intronic
1079233644 11:18671405-18671427 TGTGGGGGTTGGAGGCCAGGTGG + Intergenic
1079344214 11:19637789-19637811 TGTTGGGGGTGGGGCCCAGTGGG - Intronic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080416360 11:32073150-32073172 AGGTGGGGGTGGAGCCGAGGCGG - Intronic
1080579570 11:33631298-33631320 TGTTCAGGCTGGAGCCAAGGGGG - Intronic
1081071070 11:38608843-38608865 TGATGGAGGTGGAGCCTAGTGGG - Intergenic
1081468996 11:43352100-43352122 TGATGGGGGAGGAGCCAAGATGG - Intergenic
1081586326 11:44386523-44386545 GGATGGAGATGGAGCCCAGAGGG - Intergenic
1081597248 11:44467634-44467656 CCATGGGGCAGGAGCCCTGGTGG - Intergenic
1081709941 11:45210066-45210088 GGAGGGGGCTGGAGACGAGGCGG + Intronic
1081778229 11:45691685-45691707 GGATGGGGCTGGGTCACAGGTGG - Intergenic
1081882121 11:46462574-46462596 TGATGGGTCTGGAGAGCAGTGGG - Intronic
1081976888 11:47241092-47241114 AGATGGGGCAGGAGACCAGATGG + Intronic
1082884237 11:58066784-58066806 TGATGGGGTGTGGGCCCAGGAGG - Intronic
1082906051 11:58309743-58309765 TGATGGGAGTGGAGCCAAGATGG - Intergenic
1083640652 11:64143519-64143541 TGAGGGAGCTGGAGCCCACCAGG + Intronic
1083864053 11:65444143-65444165 TGATGGGGCTTGAGCAAAGTGGG + Intergenic
1084086970 11:66859262-66859284 TGAGGGGGCTGGAGCTCAAGGGG + Intronic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084214479 11:67639982-67640004 TGGAGGGGCTGGGGCCCCGGGGG + Intergenic
1084500854 11:69534330-69534352 TGATGGGGCCGGGGCCAGGGCGG - Intergenic
1084561476 11:69907913-69907935 TGCTGGGGCTGCAACCCAGAGGG + Intergenic
1084579732 11:70015702-70015724 TGATGAGCCAGGAGCCGAGGAGG - Intergenic
1084666549 11:70579506-70579528 GGATGAGGCTGGGCCCCAGGTGG + Intronic
1084666567 11:70579575-70579597 GGATGGAGCTGGGCCCCAGGTGG + Intronic
1085324441 11:75595734-75595756 TGATAGGGCTGCTGCCAAGGTGG - Intronic
1088627545 11:111741304-111741326 TGAGGATGCAGGAGCCCAGGTGG + Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089225309 11:116915180-116915202 TGATGGGGCGGGGGGGCAGGCGG + Intronic
1090160100 11:124483585-124483607 TGATGGAGGTGGAGCCTAAGAGG + Intergenic
1091042618 11:132296201-132296223 TTATGGGCCTGGAGCTCAGCAGG + Intronic
1091409393 12:229145-229167 TGGAGGGGCTGGAGCCAGGGAGG + Intronic
1091498415 12:991598-991620 GGATCGGGCGGGAGCCGAGGCGG + Intronic
1091644354 12:2262625-2262647 TGGTGGTGCAGGAGGCCAGGAGG + Intronic
1091936720 12:4440751-4440773 AGATGGGGCTGGAGAGCAGCGGG - Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092286836 12:7133488-7133510 AGGTGGAGCTGGACCCCAGGTGG + Intronic
1092706425 12:11290227-11290249 TGGTGAGGCTGGAGCCAAGACGG + Intergenic
1093935186 12:24993291-24993313 GGATCGGGCTTGAACCCAGGAGG + Intergenic
1093980810 12:25473256-25473278 GGGAGGGGCTTGAGCCCAGGAGG - Intronic
1095718912 12:45378763-45378785 TTATGGGGGTGGAGATCAGGAGG + Intronic
1096490216 12:52008936-52008958 TCATGGATCTGGAACCCAGGAGG + Intronic
1096650121 12:53058464-53058486 GCCTGGGGCTGGAGTCCAGGTGG + Intronic
1096725014 12:53554496-53554518 TGAGGTGGGGGGAGCCCAGGAGG + Intronic
1097192027 12:57224037-57224059 AGTTGGGGCTGAGGCCCAGGTGG + Intronic
1097344678 12:58477542-58477564 AGATGAGGCTGGAGCCAAGATGG - Intergenic
1099087237 12:78260651-78260673 TGGTGGATCTGGAGCACAGGTGG - Intergenic
1101277152 12:103215432-103215454 TGATGGGGTAAGAGGCCAGGAGG - Intergenic
1101762388 12:107669539-107669561 TCAGGAGGCTTGAGCCCAGGAGG + Intergenic
1101884518 12:108650271-108650293 GGATTTGGCTTGAGCCCAGGAGG - Intronic
1102152105 12:110695884-110695906 AGAAGGGGCTGGAGTCCATGTGG + Intronic
1103323009 12:120102582-120102604 TCCTGGGGCTGGAGCCAAGGCGG - Intronic
1103529692 12:121592347-121592369 TCATCGTTCTGGAGCCCAGGAGG - Intergenic
1104476906 12:129078258-129078280 TTAAGGGGCAGGAGCCCTGGAGG - Intronic
1104506069 12:129333753-129333775 TGATGGGGTGGGAGCAGAGGTGG + Intronic
1104862070 12:131929135-131929157 TGATGGGGGCGGAGACTAGGGGG - Intergenic
1104923303 12:132302614-132302636 TGATGGGGCATGAGCTCTGGGGG - Intronic
1104965447 12:132506995-132507017 TCATGGGGCGGGCGCCCAGCCGG + Intronic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105523473 13:21152712-21152734 TGGTGTGGCTGGAGCACAAGGGG + Intergenic
1106182046 13:27377937-27377959 GGCTGAGGCTGGAGCCCAGGAGG + Intergenic
1106195442 13:27490398-27490420 TTCTGGATCTGGAGCCCAGGAGG - Intergenic
1106699002 13:32208959-32208981 TGCTGGGGCTCGACCCCGGGAGG - Exonic
1106891339 13:34249081-34249103 TGATGGGTCTGGGGCCCTAGAGG + Intergenic
1108195750 13:47993140-47993162 AGAAGTGGCTTGAGCCCAGGAGG + Intronic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1108588593 13:51892635-51892657 TGATGGAGCTGGGTCCAAGGAGG - Intergenic
1109476596 13:62887181-62887203 TGATGGGGGTGGAGTGCTGGTGG + Intergenic
1110568197 13:76977337-76977359 TGGTGGGGCTGGAGGCATGGAGG - Intergenic
1110908677 13:80926102-80926124 GGCTGGGGCTTGAACCCAGGAGG + Intergenic
1111092802 13:83469310-83469332 TGATGTGGCTGAAGCACAGAAGG - Intergenic
1113046165 13:106157706-106157728 TGATGGGGCTTGGCCTCAGGGGG - Intergenic
1113349867 13:109518722-109518744 TGGTGAGGCTGGAGACAAGGGGG + Intergenic
1113908526 13:113831221-113831243 CCATGGGGCTGGGGTCCAGGTGG + Intronic
1114422915 14:22599412-22599434 TGATGGGGGTGAAGCACAAGGGG - Intronic
1115767140 14:36634685-36634707 AGATGGGGGTGGACCTCAGGAGG - Intergenic
1116811540 14:49544527-49544549 TGATGGGGGTGAAGTCCAGCAGG + Intergenic
1117644870 14:57841233-57841255 TGATGGGGGAAGAGCCCAGAGGG + Intronic
1117807824 14:59513177-59513199 TGAGGGGGGTGGAGCCAAGATGG + Intronic
1119169134 14:72519609-72519631 TGATGGAGCTCGTGACCAGGGGG - Intronic
1119329434 14:73783230-73783252 TGATGTTGCTGGAGTCCCGGGGG + Intronic
1120764750 14:88318484-88318506 TGATGGTGCTGGGGAACAGGAGG + Intronic
1121007922 14:90502093-90502115 TGAAGGTGCTGGAGCTCAGAGGG - Intergenic
1121452307 14:94016763-94016785 TCATGGTGCTGGAGAGCAGGTGG - Intergenic
1121638538 14:95470076-95470098 GGATGTGGCAGGGGCCCAGGGGG + Intronic
1121828465 14:97029610-97029632 TGATAGGGCAGAAGCTCAGGGGG + Intergenic
1122386635 14:101352814-101352836 GGATGGCTCTGGAGCACAGGTGG - Intergenic
1122544552 14:102514963-102514985 TGATGGGGCTGCAGACGCGGTGG - Intergenic
1122925663 14:104898306-104898328 TGAAGGGGCTGGGTCCCCGGCGG + Intergenic
1123110533 14:105864979-105865001 TGACGGGGCTGAAGCCCAGCGGG + Intergenic
1123581953 15:21723373-21723395 TGATGGGACTGGAGTACAGAAGG + Intergenic
1123618602 15:22165973-22165995 TGATGGGACTGGAGTACAGAAGG + Intergenic
1124186408 15:27533406-27533428 TGATGGTGCTGGAGCCAGAGAGG - Exonic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1124572951 15:30882928-30882950 TGATGAGACTGATGCCCAGGAGG - Intergenic
1125782847 15:42285947-42285969 TCCTGAGGCTGCAGCCCAGGGGG - Intronic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1128062554 15:64744016-64744038 GGATCGTGCTTGAGCCCAGGAGG + Intronic
1128230171 15:66029246-66029268 TGATGGGGGTTGAGCCAGGGAGG + Intronic
1128618800 15:69131634-69131656 TGATGGAGCAGGAGCCCAGCAGG + Intergenic
1128756926 15:70189564-70189586 GGGTGGGGCAGGAGCCAAGGTGG + Intergenic
1129108296 15:73323405-73323427 TGATGGTGTGGGAGCCGAGGGGG + Exonic
1129275723 15:74443997-74444019 AGCTGAGGCAGGAGCCCAGGAGG + Intergenic
1129710705 15:77819144-77819166 TGATTGGGCGGGAGCCTCGGGGG - Intronic
1129783051 15:78287296-78287318 TGAGGGTGCTGTAGCCCAGAGGG - Intronic
1129904836 15:79179192-79179214 AGATGGTGCTGGGGCCCAGCTGG + Intergenic
1130149463 15:81300096-81300118 TGATTGGGCTGCCGCCCTGGGGG - Exonic
1130162046 15:81411352-81411374 TGCTGGGGCCAGAGCACAGGGGG + Intergenic
1130273480 15:82464468-82464490 TGTTGAGGTTGGTGCCCAGGTGG - Intergenic
1130465831 15:84191839-84191861 TGTTGAGGTTGGTGCCCAGGTGG - Intergenic
1130498434 15:84481697-84481719 TGTTGAGGTTGGTGCCCAGGTGG + Intergenic
1130588120 15:85196435-85196457 TGTTGAGGTTGGTGCCCAGGTGG - Intergenic
1132142761 15:99408680-99408702 TGAAGGGCCTGGAGCCTGGGTGG - Intergenic
1132496013 16:263841-263863 AGACGGGGCTGCGGCCCAGGAGG + Intronic
1132665303 16:1078753-1078775 AGGCGGGGCTGGGGCCCAGGAGG + Intergenic
1132834542 16:1946222-1946244 AGATGCGGTTTGAGCCCAGGTGG + Intronic
1132854228 16:2037708-2037730 TGCTGGGGCTGGGGCTCACGAGG - Intronic
1132858246 16:2057128-2057150 AGATGGCGCTGTGGCCCAGGTGG - Exonic
1133038878 16:3049480-3049502 TACTGGGGATGGAGCCCAGCTGG + Intronic
1133170916 16:3982093-3982115 TGATGGGGCATGAGCCCACAGGG + Intronic
1133454607 16:5931177-5931199 TGATGTGGTTGGAGCTCAAGGGG - Intergenic
1133519669 16:6544842-6544864 TGATGGGGCTTGATCCAAGTTGG + Intronic
1134005828 16:10818447-10818469 TGCTGGGGCTGGAGGCGGGGCGG - Intronic
1134225368 16:12385887-12385909 TGGTGAGGCCTGAGCCCAGGAGG - Intronic
1136137769 16:28267804-28267826 AGCTGGGGCTGAACCCCAGGAGG + Intergenic
1136234273 16:28904645-28904667 GGGGAGGGCTGGAGCCCAGGAGG + Exonic
1136364714 16:29804705-29804727 GGAAGAGGCTGGAGCGCAGGAGG + Intronic
1136411992 16:30083003-30083025 TGATGGGGGTTGAGGCCAGCGGG + Intronic
1137724914 16:50650626-50650648 TGATGGGGCAGGAGGACAAGAGG + Intergenic
1138270940 16:55695416-55695438 TCAGTGGGCTGGGGCCCAGGTGG - Intronic
1138417580 16:56880045-56880067 AGCCGGGGCTGGAGCTCAGGTGG + Intronic
1138520200 16:57566653-57566675 TGGGGGGGCTGGAGCCCTGAGGG + Exonic
1138590321 16:57996072-57996094 TGGTGGGGCTGGGGCCCCAGAGG - Exonic
1139254202 16:65525385-65525407 TGCTAGGGCTGGAGCCCAAAAGG + Intergenic
1139504802 16:67393489-67393511 GGGTGGGACTGCAGCCCAGGCGG + Intronic
1139961590 16:70721204-70721226 TGGTGGGGCTGGGGCCTAGAAGG + Intronic
1140778821 16:78275356-78275378 TGATGGGGCTTGTGCCCACCGGG + Intronic
1140861527 16:79022690-79022712 GTAAGGGGCTGGAGCCCAAGAGG + Intronic
1141117513 16:81323050-81323072 TGATGGAGCTGGAGGCCAGCAGG + Intronic
1141133058 16:81447878-81447900 TGATGGGACGAGAGCCCTGGTGG - Intronic
1141429178 16:83962140-83962162 TGATGGGGCAGGAAGCCAGATGG - Intronic
1141662394 16:85448527-85448549 AGATGAGGCGGGACCCCAGGGGG + Intergenic
1142128351 16:88421159-88421181 CGTGGGGGCAGGAGCCCAGGTGG + Intergenic
1142178700 16:88656818-88656840 GGAAGGCGCAGGAGCCCAGGTGG + Intronic
1142599744 17:1047847-1047869 CAATGGGGCTGAAGTCCAGGTGG + Intronic
1142812796 17:2403171-2403193 TGATGAAGCTGGAGCAAAGGCGG + Intergenic
1143496340 17:7314963-7314985 TGATGGAGCGGGAGCGCAAGCGG - Exonic
1143701190 17:8661433-8661455 TGATGTGACTGGAGCAAAGGAGG - Intergenic
1145837231 17:27963727-27963749 AGATGGGCCTGAAGCTCAGGCGG - Intergenic
1145976354 17:28986385-28986407 TGGTGGGGCTGGGGCGCAGGTGG - Intronic
1146892158 17:36513253-36513275 TGCTGAGTCTGGAGACCAGGTGG - Intronic
1147692189 17:42323136-42323158 TGATGTACCTGGAGCCAAGGAGG + Exonic
1148256335 17:46135764-46135786 GGCTGAGGCTTGAGCCCAGGAGG - Intronic
1148460958 17:47838755-47838777 GGAGGGGGCTGGGGGCCAGGAGG - Intronic
1148990874 17:51666258-51666280 GGAAGAGGCTGGAGCCCAGAAGG + Intronic
1151195589 17:72429336-72429358 TGGGGGTGCTGGAGCCCAAGGGG - Intergenic
1151468580 17:74303528-74303550 GGCTGAGGCTTGAGCCCAGGAGG - Intronic
1151627090 17:75283673-75283695 TGACCCGGCTGGGGCCCAGGTGG + Intronic
1151953329 17:77367360-77367382 TGATGGGGCATGAGCCCAAAGGG - Intronic
1151998882 17:77632204-77632226 TGATGTGGATTGAGTCCAGGTGG + Intergenic
1152020737 17:77779074-77779096 GGATGGCGCTGGACCCCAAGAGG + Intergenic
1152516696 17:80829301-80829323 AGACGGGGCTGGTGTCCAGGAGG + Intronic
1152594583 17:81232140-81232162 TGCTGAAGCTGGAGCCAAGGTGG - Intronic
1152650622 17:81490881-81490903 AGAGGGGGCTGGGGGCCAGGTGG + Intergenic
1152651622 17:81496757-81496779 TGGGGAGGCTTGAGCCCAGGAGG + Intergenic
1153642618 18:7169734-7169756 TGCTGGGGCTGCAGGCCACGTGG + Intergenic
1153776959 18:8462879-8462901 TGAGGGAGCCGGAGGCCAGGCGG + Intergenic
1157476934 18:48029526-48029548 TGGCGGGGCTGGGGCCCGGGAGG + Exonic
1157818519 18:50748715-50748737 TGTTGGGGCTGGAGAACAGCTGG - Intergenic
1159061287 18:63517491-63517513 AGATGGGGCTGGAGTGCAGTGGG + Intergenic
1159804165 18:72935595-72935617 GGGTCGAGCTGGAGCCCAGGAGG - Intergenic
1160255787 18:77247624-77247646 TGTTGGAGGTGGAGCCCAGTGGG - Intergenic
1160963437 19:1734946-1734968 GGATGGGGCAGGGGCCCAGGAGG + Intergenic
1161314856 19:3613031-3613053 GGGCGGGGCTGGAGGCCAGGGGG - Intronic
1161482132 19:4516569-4516591 TGATGTGGCAGGAGCCCTGGGGG - Intronic
1162548695 19:11346376-11346398 GGAGGGGGCGGGATCCCAGGGGG - Intronic
1162727653 19:12699815-12699837 TGGAGGGTCTGGCGCCCAGGAGG + Exonic
1163045512 19:14638631-14638653 TGAAGGGATTGGTGCCCAGGTGG - Intronic
1163163479 19:15479656-15479678 AGAGGGGCCTGGAGACCAGGTGG + Exonic
1163861378 19:19744684-19744706 ATGTGGGGCCGGAGCCCAGGTGG + Intergenic
1163871993 19:19829957-19829979 TGATGGGGATGGGGCCAAGATGG + Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1165022507 19:32936004-32936026 TGGTGGGGCAGGAGCTCATGGGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165867863 19:38949943-38949965 TGACGGGGGCGGGGCCCAGGAGG - Intronic
1167160009 19:47761168-47761190 GGCTGAGGCTGGAGCCCAGGAGG + Intergenic
1167369354 19:49071659-49071681 TGAGGGTGCTGGAGCCCGAGGGG - Intronic
1167606751 19:50485383-50485405 TCCTGGGGAAGGAGCCCAGGAGG - Exonic
1167696035 19:51016041-51016063 GGATGGGGCCTGAGCCCTGGTGG + Exonic
1167724566 19:51201397-51201419 AGATGGGGTGGGAGCCCAGCAGG - Intergenic
1167758191 19:51426458-51426480 AGATGGGGTGGGAGCCCAGCAGG + Intergenic
1168269576 19:55242171-55242193 TGACCCTGCTGGAGCCCAGGAGG - Exonic
925066230 2:930739-930761 CGATGTGGCTGGAGCTGAGGTGG - Intergenic
925558013 2:5153471-5153493 TGACGTGGCTGGAGCACAGTCGG - Intergenic
926311435 2:11678691-11678713 TTCTGGGGCTGGTGTCCAGGCGG + Intronic
926622612 2:15060566-15060588 TGTTGGGGGTGGGTCCCAGGAGG + Intergenic
926705663 2:15835722-15835744 TGAAGGGGCTGGATGCCACGTGG + Intergenic
926846511 2:17147075-17147097 TGCTGAGGCTTGAACCCAGGAGG - Intergenic
927142632 2:20140469-20140491 GGAGGGGGCCGGAGTCCAGGGGG - Intergenic
927148818 2:20184192-20184214 TGCTGGGGCGGGACCACAGGTGG + Intergenic
927879562 2:26681111-26681133 TGATGGGCTGGGACCCCAGGAGG - Intergenic
928125811 2:28615009-28615031 TGATGGGGCTGGGGCAAGGGAGG + Intronic
928381579 2:30822771-30822793 TGATGGGGACAGACCCCAGGTGG - Intergenic
928722144 2:34133116-34133138 TGATGGGGCGGCTGGCCAGGCGG + Intergenic
929592829 2:43158182-43158204 TACTGGGGCTGGGGGCCAGGAGG - Intergenic
929684971 2:44025778-44025800 GGAGGAGGCTTGAGCCCAGGAGG - Intergenic
929903699 2:46027848-46027870 AGATGGGGCTCAAGACCAGGGGG + Intronic
930213190 2:48664959-48664981 TGCTCGGGCTGGAGTTCAGGTGG + Intronic
930980738 2:57523548-57523570 AGCTGAGGCTGGAGCCCACGTGG - Intergenic
931193113 2:60024579-60024601 TGATGGGGGTGGAGGTGAGGAGG + Intergenic
931244375 2:60480153-60480175 TGGAGGAGCTGGAGGCCAGGGGG + Intronic
931818720 2:65930325-65930347 TCCTGGGGCTGGAGCCAAGATGG - Intergenic
931949399 2:67345563-67345585 TGGTGGGGGTGGGGACCAGGAGG - Intergenic
932593729 2:73081579-73081601 GGGAGGGGCCGGAGCCCAGGGGG + Intronic
932748938 2:74358590-74358612 TGCTGGGTCTGGAGCTCAGCAGG - Intronic
933721155 2:85398566-85398588 AGGTGGGGCTGGAACCGAGGTGG - Intronic
933804516 2:85988501-85988523 TGGTCTGGCTGGAGCACAGGTGG - Intergenic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
937325954 2:120989670-120989692 TGATGGTGCTGGGGCTCAGCTGG - Exonic
938227287 2:129626921-129626943 TGATGTGCTTGGAGCCCAGCAGG + Intergenic
938388384 2:130883872-130883894 TGAGGAGGCTGAAGCTCAGGAGG - Intronic
938545234 2:132322800-132322822 GGCTGAGGCTTGAGCCCAGGAGG + Intergenic
940586895 2:155663694-155663716 TAATGGGGCTGAAGCCCGGGAGG - Intergenic
942234757 2:173893191-173893213 GGATGTGGCTTGAGCCCAGAAGG - Intergenic
942564067 2:177249127-177249149 TGAGGATCCTGGAGCCCAGGAGG + Intronic
943342062 2:186693866-186693888 TGCTGGGGCTGCAGCCCGGGTGG - Intergenic
943436168 2:187867952-187867974 TCATGGAGCTGGAGACCAAGGGG - Intergenic
944366668 2:198928962-198928984 TGAAGAGGCTGGAGCCCATGAGG - Intergenic
944807990 2:203301344-203301366 TGAGATCGCTGGAGCCCAGGAGG - Intronic
947590688 2:231383397-231383419 TGCAGGGGCTGTAGGCCAGGGGG - Intergenic
948362283 2:237431022-237431044 GGGAGGAGCTGGAGCCCAGGAGG + Intergenic
948499465 2:238381326-238381348 AGATGGGGCTGGATTCGAGGAGG + Intronic
948811087 2:240478798-240478820 TGTCGGGGCTGGAGCCAAGCAGG - Intergenic
948910991 2:241002558-241002580 GAATGGGGCTGGAGTCGAGGAGG + Intronic
1169751277 20:8997261-8997283 TGTTGGAGGTGGAGCCCAGTGGG + Intergenic
1170696660 20:18665216-18665238 AGTTGGGGCTGGGGGCCAGGGGG + Intronic
1170851038 20:20004797-20004819 GGATTGTGCTTGAGCCCAGGAGG - Intergenic
1170953248 20:20955669-20955691 TGGCGGGGCTGGATCCCTGGAGG + Intergenic
1171188530 20:23141494-23141516 TGATGGCACTGATGCCCAGGAGG - Intergenic
1171874088 20:30555572-30555594 GGCTGAGGCTTGAGCCCAGGAGG + Intergenic
1172012077 20:31851412-31851434 TGATGGAGCTGGACCCGATGGGG + Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1172867743 20:38112922-38112944 AGATGGGGATGGCACCCAGGAGG - Intronic
1173877455 20:46383271-46383293 TGTCTGGTCTGGAGCCCAGGAGG - Intronic
1174232292 20:49055627-49055649 GGTTGGGGCTTGAGCCCTGGAGG + Intronic
1174364252 20:50046942-50046964 TGATGGGCCATGAGCCCTGGGGG - Intergenic
1174483804 20:50849005-50849027 AAATGGGGCTGGAGCCCTGCGGG + Intronic
1174514098 20:51078038-51078060 TGCAGGGGCTGGAGCCCAATGGG - Intergenic
1174783737 20:53413249-53413271 TGAGGGGGAAGGAGGCCAGGTGG + Intronic
1175300243 20:57937887-57937909 TGGTGGGGCTGGAGCACGGGAGG + Intergenic
1175300258 20:57937937-57937959 TTGTGGGGCTGGACCACAGGAGG + Intergenic
1175574266 20:60048953-60048975 TCATGGGCCAGCAGCCCAGGTGG + Intergenic
1175737355 20:61396480-61396502 TGAGGGGGCAGCACCCCAGGTGG - Intronic
1175829491 20:61954348-61954370 GCCTGGAGCTGGAGCCCAGGAGG + Intronic
1175877804 20:62238665-62238687 GGCTGGGGCTGGAGCCGGGGCGG + Intronic
1175960919 20:62636009-62636031 AGATGGGGCTGGACCTGAGGAGG + Intergenic
1175966845 20:62664206-62664228 GCATGGGCCTGGAGCCCTGGGGG - Intronic
1179057067 21:37946095-37946117 TGTTGGAGGTGGAGCCCAGTGGG + Intergenic
1179474199 21:41632944-41632966 AGCTGGGCCTGGTGCCCAGGTGG - Intergenic
1179885302 21:44311724-44311746 TGCTGAGGCTTGAGCCCTGGAGG + Intronic
1179988375 21:44933117-44933139 GGGCGGGGCAGGAGCCCAGGTGG + Intronic
1180998063 22:19975315-19975337 TGAGGGGGCTGGGAGCCAGGCGG - Intronic
1181495660 22:23286159-23286181 TGATGGGGCCCAGGCCCAGGTGG + Intronic
1182380964 22:29887279-29887301 TGAGGGAACTGGAGCTCAGGGGG - Intronic
1183708867 22:39491020-39491042 TGATGCGGCTGGGGCCGAGAGGG - Exonic
1183731147 22:39619262-39619284 GGATGGTGCTGGAGGCCAGCTGG - Intronic
1183806216 22:40213417-40213439 TGAAGGGGCTGGAGAACAAGTGG + Intronic
1183998804 22:41656788-41656810 TGCTGGGGCTGGGGCCCCGTAGG - Intronic
1184057100 22:42059984-42060006 TGATGGGCATGGAGCTCAGGAGG + Exonic
1184258916 22:43303337-43303359 GGATGGGGCAGGAGGCCAAGCGG - Intronic
1184308812 22:43628017-43628039 AGATGGGCCTGCACCCCAGGAGG - Intronic
1184372419 22:44090844-44090866 TGATAGCCCTGGAGCACAGGGGG - Intronic
1184860912 22:47172941-47172963 TGATGGTGCTGGTGCCCGGAGGG + Intronic
1185286599 22:50003018-50003040 TGGTGGGGGTGGATCCCAAGTGG + Intronic
949788953 3:7771940-7771962 TGGTTGGGCTGGAGAGCAGGGGG - Intergenic
949876241 3:8627883-8627905 TGAAGGGGCTAAGGCCCAGGGGG - Intronic
949947574 3:9202624-9202646 AGATGGGGCAGGAATCCAGGAGG - Intronic
950254351 3:11492472-11492494 TGGAGGGGCTGGAGCCAAGATGG - Intronic
950835377 3:15914277-15914299 TGTTGGGGCAGGGGCCCAGTGGG - Intergenic
950906586 3:16544531-16544553 TGATGGGGCTAGGGCAGAGGAGG - Intergenic
951306869 3:21074535-21074557 TGTTGGAAATGGAGCCCAGGGGG - Intergenic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
951987601 3:28638289-28638311 TGAAGGGGCTGGAAAGCAGGGGG + Intergenic
952346039 3:32486752-32486774 TGTTGGGGGTGGAGCCTAGCTGG + Intronic
952827130 3:37533350-37533372 TGATGTTGATGGAGCCCGGGAGG - Exonic
953032744 3:39188821-39188843 GGGAGGGGCGGGAGCCCAGGCGG + Exonic
953061832 3:39434224-39434246 GGGTGTGGCAGGAGCCCAGGTGG + Intergenic
953241269 3:41151430-41151452 TGATGGGGCTGGAGGTGAAGAGG + Intergenic
953361593 3:42301872-42301894 TGATGGGAGTGGAACCCAGATGG + Intergenic
953547205 3:43872377-43872399 AGAGGGGGCAGCAGCCCAGGTGG - Intergenic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
954907293 3:54073636-54073658 TGATGAGGATGGATGCCAGGGGG - Intergenic
955065082 3:55526933-55526955 TGATGGGTCTGCAGGCCAGCAGG + Intronic
955216644 3:56989689-56989711 TGCTGGGGCTGGAATCCACGAGG - Intronic
955377611 3:58411202-58411224 TGATTAGGCTGCAGCCCAGAGGG + Intronic
955450259 3:59058546-59058568 GGATGGAACTGGAACCCAGGAGG + Intergenic
955816803 3:62852409-62852431 TGATGGGGGAGGAGCCAAGATGG - Intronic
956941223 3:74163095-74163117 TCAGGGGGGTGGAGCCAAGGTGG - Intergenic
958045329 3:88277945-88277967 TGATAGGCCTTGTGCCCAGGAGG + Intergenic
958513039 3:95073557-95073579 GGAGGAGGCTTGAGCCCAGGAGG + Intergenic
959042404 3:101437617-101437639 TGGGAGGGCTTGAGCCCAGGAGG + Intronic
961061240 3:123831080-123831102 TGTTGGGGATGGAACACAGGTGG - Intronic
961144847 3:124585015-124585037 GGATGGGGCTGGGGATCAGGAGG + Intronic
961484254 3:127206504-127206526 TGCTGGGGTTGAAGCCCAGCTGG + Intergenic
961503990 3:127358119-127358141 GGAGGGGGCTGGTGCCCAGGTGG - Intergenic
961662554 3:128477379-128477401 TGTAGGGGGTGGAGGCCAGGGGG + Intergenic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
962746186 3:138398836-138398858 TGATGGGGTGGGACCACAGGTGG + Intronic
962908120 3:139823702-139823724 GGATGCAGCTAGAGCCCAGGAGG + Intergenic
964182502 3:153905392-153905414 TCATTGGCCTGGAGACCAGGAGG - Intergenic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
965803534 3:172518356-172518378 TGATGGGGCTTGAGGTCAGCAGG + Intronic
966081294 3:176004989-176005011 TGAAGGGCATGGAGTCCAGGTGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967134698 3:186503559-186503581 TCCTGGGGCTGCAGCCCAGCAGG + Intergenic
967997322 3:195176638-195176660 TGATGAGGCTGGAGAGCTGGAGG + Intronic
968464414 4:743272-743294 TGGTGGGGCGGGTGCCCGGGGGG + Intronic
968465773 4:749905-749927 GGCTTGGGCAGGAGCCCAGGAGG - Intronic
968481512 4:835082-835104 TGTGGCTGCTGGAGCCCAGGGGG - Intergenic
968658435 4:1788539-1788561 GGCTGGGGCAGGAGCCCAGGGGG + Intergenic
968831180 4:2933702-2933724 TGATGGGCCTGGGGGGCAGGGGG + Intronic
968959408 4:3735320-3735342 GGATGGGCCTGGAGCTCTGGAGG + Intergenic
969261839 4:6038612-6038634 TGATGGGCCTGGATCCCAGCAGG - Intronic
969302768 4:6307068-6307090 TGATGGGGCTGGTGTCCTTGGGG - Intergenic
969317689 4:6391759-6391781 GGGTGGGGCTGGAGGCCTGGAGG + Intronic
969518001 4:7659312-7659334 TGTTGGGCCTGGCTCCCAGGAGG - Intronic
969525041 4:7700047-7700069 GGCTGGGGCGGGAGCCCTGGGGG - Intronic
969612573 4:8235574-8235596 TGATGTGGGTGGGCCCCAGGGGG + Intronic
970654831 4:18219455-18219477 TGTTGGGGGTGGGGGCCAGGGGG - Intergenic
971310973 4:25525512-25525534 TGTTTGGGCTGGAGCTGAGGAGG - Intergenic
971899506 4:32640848-32640870 AGGTGGGGCTTGAGCCCAGGAGG - Intergenic
973277183 4:48322436-48322458 TGTTGGAGGTGGAGCCCGGGGGG + Intergenic
974027300 4:56744898-56744920 TGATGGGACAGGAGGCCAGATGG + Intergenic
975133444 4:70850909-70850931 TGATGGAGGTGGAGCTTAGGCGG - Intergenic
975165584 4:71174917-71174939 TGATTTGAATGGAGCCCAGGTGG + Intergenic
975184406 4:71384550-71384572 GGAGGGGGCTTGAACCCAGGAGG + Intronic
976277461 4:83291792-83291814 TGAGGTGGGTTGAGCCCAGGAGG + Intergenic
976816015 4:89148946-89148968 TAATGGGGCTGGATCACATGAGG - Intergenic
977290393 4:95159536-95159558 TGATGGGGCGGGGGCGGAGGTGG + Intergenic
978361088 4:107931723-107931745 TGCTGCGGCTGGACCCCAGCGGG + Exonic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
979289935 4:118968294-118968316 TGATTTGCCTGGAGCCCATGAGG - Intronic
981052787 4:140327562-140327584 GGCTGGGGCTTGATCCCAGGAGG + Intronic
981423242 4:144575365-144575387 AAGTGAGGCTGGAGCCCAGGAGG + Intergenic
982941840 4:161569085-161569107 TAAGGAGGCTTGAGCCCAGGAGG - Intronic
984883319 4:184429170-184429192 TCCTGGGGCTGGGGACCAGGGGG + Intronic
984910339 4:184668468-184668490 AGATGAGGCTGGAGCACAGCGGG - Intronic
984945994 4:184969210-184969232 TGAAGGGCCTTGAACCCAGGAGG - Intergenic
985371001 4:189284982-189285004 TGGTCAGGCTGGAGCCCTGGCGG - Intergenic
985570060 5:639940-639962 TTATGGGGCTGGGGTCCAGGTGG - Intronic
986739532 5:10694018-10694040 TCCTGGGGGTGGAGCCCGGGAGG + Intronic
988451950 5:31352325-31352347 AGATGGGGCTGGAATCCAGCAGG - Intergenic
988529310 5:32013788-32013810 TGATGGGGGTGGAGCAGAAGGGG - Intronic
989171104 5:38470717-38470739 TGATGGTGTGGGTGCCCAGGGGG + Intergenic
990583352 5:57185892-57185914 TGCAGAGGCTTGAGCCCAGGAGG + Intronic
992152084 5:73914813-73914835 GGAGGTGGATGGAGCCCAGGAGG - Intronic
993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG + Intergenic
993135359 5:83954339-83954361 TGTTGGAGCTGTAGCCTAGGGGG + Intronic
995637125 5:114206320-114206342 AGATGGGGCTGGAGATTAGGAGG - Intergenic
996072618 5:119150699-119150721 GGATGATGCTTGAGCCCAGGAGG + Intronic
997137111 5:131338085-131338107 TGAAGGGGGTGGAGCCAAGATGG - Intronic
997467716 5:134099381-134099403 AGAGGAGGCTGGAGCCCATGGGG + Intergenic
997630923 5:135368511-135368533 TGATCTGGCTGGAGGCCAGAAGG + Intronic
998205760 5:140155820-140155842 ACATGGGGTTGGAGCACAGGGGG - Intergenic
998636260 5:143958268-143958290 TGATGGGGTTGGAGAGAAGGGGG + Intergenic
999033424 5:148319972-148319994 TGTGGGGGCTGGAGCCAAGATGG + Intergenic
999255580 5:150208404-150208426 TGCTGCGGCTGGAGCAGAGGGGG + Intronic
1000120205 5:158189908-158189930 TGATCTCACTGGAGCCCAGGAGG + Intergenic
1000373853 5:160561257-160561279 AGATGAGGCTGGAGGGCAGGTGG - Intergenic
1000493520 5:161947154-161947176 TGTTGGAGGTGGAGCCCAGTGGG - Intergenic
1000545737 5:162599310-162599332 GGATGTGGCTTGAGCCCAGGAGG - Intergenic
1000979147 5:167798250-167798272 TGATGGGGCAGGGGAGCAGGAGG - Intronic
1001236915 5:170037827-170037849 TTATGAGGCTGGAGCCCTTGAGG + Intronic
1001313996 5:170629939-170629961 TGATGGGGCTGGGGCTGAGGCGG + Intronic
1001602681 5:172939351-172939373 TGATGGGCCTTGAGCTGAGGAGG + Intronic
1001938908 5:175727288-175727310 TGTATGGGATGGAGCCCAGGTGG + Intergenic
1002139732 5:177131945-177131967 TGGTGGGGATCAAGCCCAGGGGG + Intergenic
1002360867 5:178669759-178669781 TGTTGGGGCTGCAGCCCGTGGGG + Intergenic
1004478412 6:15996127-15996149 TCATGGGCCTGGAGACCAGAAGG + Intergenic
1004659176 6:17694689-17694711 GGATGGGGCTGGGGCCACGGTGG + Intronic
1005504399 6:26457493-26457515 GGTTGGGCCTGGAGCGCAGGAGG - Intergenic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006449021 6:34095332-34095354 GGGTGGGGCTGGAGCTGAGGAGG - Intronic
1006463509 6:34177488-34177510 AGAGGGAGCTGGACCCCAGGTGG - Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1006898719 6:37486566-37486588 TGGTGGGGCTGCAGGGCAGGGGG - Intronic
1007076969 6:39074293-39074315 GGATGTGCCTGGAGCCCAGCTGG + Intronic
1007177097 6:39904383-39904405 AGAAGGGGCTGGTGCCCAGTCGG + Exonic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007573102 6:42907451-42907473 TGAAGGGCCTGGGGCCCAAGAGG - Intergenic
1007652135 6:43429520-43429542 AGAGGTTGCTGGAGCCCAGGAGG - Intronic
1007746839 6:44048218-44048240 TCCTGGGGCAGGAACCCAGGGGG + Intergenic
1010266619 6:73875031-73875053 TGTTGGAGCTGCAGCCCAGTGGG - Intergenic
1010272050 6:73925941-73925963 TGATGGGGCGGCTGGCCAGGCGG + Intergenic
1011734578 6:90297582-90297604 AGCTGGGGCTGAAGCCCGGGAGG - Intergenic
1012425386 6:99108506-99108528 TGACGGGGGTGGAGCTCAGGCGG + Intergenic
1012450695 6:99349959-99349981 GGGAGGGGCTGGAGCGCAGGCGG - Intronic
1013709450 6:112880068-112880090 TGATGGGGCTGGAGCTCCCTGGG - Intergenic
1016261399 6:142174615-142174637 TGAGGGGGCGGGAGCAGAGGTGG + Intronic
1016900001 6:149091986-149092008 TGGTGGGGCAGAAGCCCATGTGG - Intergenic
1017478572 6:154825564-154825586 TCAGGAGGCTTGAGCCCAGGAGG + Intronic
1017766660 6:157612433-157612455 CCTCGGGGCTGGAGCCCAGGTGG - Intronic
1018185443 6:161262344-161262366 TGATGGAGCTGCAGCCATGGTGG + Intronic
1018501779 6:164419093-164419115 TGATGATGCTAGAGCCCACGGGG + Intergenic
1018573466 6:165234041-165234063 TCATGGGGCTGTGGCCCAGTGGG + Intergenic
1018845499 6:167552498-167552520 TGCTGGTGCTGGAGCCCGTGTGG + Intergenic
1018848317 6:167570558-167570580 TGGTGGGGCTGAAGCCGGGGAGG - Intergenic
1018867831 6:167759403-167759425 GGACGGAGCTGGAGCCCAGATGG + Intergenic
1018915783 6:168131576-168131598 TGATGGGCCCGGAGCACAGGTGG - Intergenic
1020319510 7:6929560-6929582 TTGGGGGGGTGGAGCCCAGGTGG + Intergenic
1020538901 7:9436389-9436411 TCATGGGGGTGGAGCCAAGATGG + Intergenic
1021209754 7:17834043-17834065 TGATGGGGATGGAGGTAAGGTGG - Exonic
1022688362 7:32618664-32618686 AGATGGGGGTGGTGCCGAGGTGG - Intergenic
1023039123 7:36156713-36156735 TGATGTTGCTGGTCCCCAGGGGG - Intronic
1023350238 7:39313211-39313233 TGATGGGTCTGGGGATCAGGAGG - Intronic
1023390844 7:39710246-39710268 TGATGGGGCTGGGGACAGGGTGG + Intergenic
1023837085 7:44074515-44074537 TGGTGGTGCTGGAGCCCTGGGGG + Exonic
1023897203 7:44443821-44443843 AGATGGGGCTTGAGCTGAGGTGG - Intronic
1023915506 7:44585678-44585700 GGAAATGGCTGGAGCCCAGGAGG + Intergenic
1024063413 7:45715172-45715194 TGATGGGGACGGGGTCCAGGAGG + Exonic
1025026981 7:55524745-55524767 TGATGGGAATGGAGACCAGGAGG + Intronic
1025209490 7:57012778-57012800 AGATGAGGCTCGAGGCCAGGAGG + Intergenic
1025247679 7:57329256-57329278 TGATGGGACTTGAGACCAGCTGG - Intergenic
1025662457 7:63564072-63564094 AGATGAGGCTCGAGGCCAGGAGG - Intergenic
1026078026 7:67191204-67191226 TGTTGGGGGTGGAGCCCAGTGGG - Intronic
1026509495 7:71016391-71016413 TGATGAGGCTGGCGGCCAGGTGG - Intergenic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026698852 7:72621089-72621111 TGTTGGGGGTGGAGCCCAATGGG + Intronic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1027704492 7:81511230-81511252 TGTTGGGGGAGGAACCCAGGGGG + Intergenic
1029105799 7:98174632-98174654 TCATGGAGCTGGAGACCTGGAGG + Intronic
1029384620 7:100235213-100235235 TGAGGGGGCTGCAGGGCAGGTGG - Intronic
1029478830 7:100801043-100801065 TCTTGGGGCTGGACCTCAGGGGG + Intergenic
1029837926 7:103332717-103332739 AGATAGTGCTTGAGCCCAGGAGG - Intronic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1030063376 7:105640623-105640645 GGTTGAGGCTTGAGCCCAGGAGG - Intronic
1030449776 7:109693255-109693277 TGAGGGGGGTGGAGCCAAGATGG - Intergenic
1030735023 7:113037774-113037796 TTAGGGGAATGGAGCCCAGGAGG + Intergenic
1032252875 7:130272877-130272899 TGCAGGGGCTGCAGCCCAGCCGG - Intronic
1032674146 7:134113051-134113073 TTATTGGGCAGGAGCCCAGCAGG + Intergenic
1033226802 7:139569043-139569065 AGATGTGGCCGGAGCCCAGTGGG + Exonic
1033332189 7:140426084-140426106 GAACGGGGCTGGAGTCCAGGGGG - Exonic
1034446396 7:151116179-151116201 TGAAGGGAAGGGAGCCCAGGAGG + Intronic
1034550677 7:151818707-151818729 GGCTGGGCCTTGAGCCCAGGGGG - Intronic
1034553111 7:151833603-151833625 TGCTGGGGCTGGGGACCAGATGG - Intronic
1034717463 7:153256729-153256751 TGGTGGGGCTGCAGCCCTGAAGG + Intergenic
1034963309 7:155375401-155375423 TGATGTGGCGGGAGGCCTGGTGG - Intergenic
1036033249 8:4994126-4994148 GGGTGGGGCGGGGGCCCAGGAGG + Intronic
1036498885 8:9295440-9295462 TGCAGCTGCTGGAGCCCAGGAGG + Intergenic
1037411378 8:18601924-18601946 TGAAGGGGCTGGAAACCAGCTGG - Intronic
1037765182 8:21768414-21768436 TGATGAGGCGGGGGCACAGGGGG - Intronic
1037806831 8:22062651-22062673 TGATGGGGGTGCTGGCCAGGTGG - Intronic
1038381977 8:27104567-27104589 TGATTGGGATGGTTCCCAGGGGG + Intergenic
1038447049 8:27611545-27611567 TGGTGGGGGTGGAGTGCAGGGGG - Intronic
1038491843 8:27977173-27977195 TCATGGGGGTGGAGCCCACGTGG - Intronic
1038648293 8:29379619-29379641 AGATGGGCCTTGGGCCCAGGAGG - Intergenic
1039822777 8:41148311-41148333 TAATGTGACTGGAGCTCAGGGGG - Intergenic
1040452439 8:47561665-47561687 AGATGGGGGAGGATCCCAGGAGG - Intronic
1041102571 8:54411401-54411423 TGATGGGGATGTAGACCAGCAGG - Intergenic
1041519579 8:58740565-58740587 TTATGAGGCTGGAGCCAGGGAGG + Intergenic
1042086262 8:65112532-65112554 TGATGGAGCTCCAGCCCAGAAGG - Intergenic
1044265227 8:90174085-90174107 TTGGGAGGCTGGAGCCCAGGAGG + Intergenic
1045494940 8:102700261-102700283 TGATGTGGTTGGAAACCAGGTGG + Intergenic
1047254922 8:123207479-123207501 TGGTGGGGCTGGAACCGGGGCGG - Exonic
1047536668 8:125726439-125726461 TGGTGTGGCTGGAACCCTGGAGG + Intergenic
1047762387 8:127963748-127963770 TGATCTAGCTGGGGCCCAGGTGG + Intergenic
1049167193 8:141133711-141133733 TGGTGGGGCTGGGGCCCGAGGGG + Intronic
1049224252 8:141442026-141442048 TGCTTGGGCAGGAGACCAGGGGG + Intergenic
1049421954 8:142520971-142520993 TGGTGAGGATGGACCCCAGGAGG + Intronic
1049422061 8:142521394-142521416 GGATGGGGCTGGAGACCACAGGG - Intronic
1050113729 9:2242097-2242119 TGTTGGGCCTGGAACCCCGGCGG - Intergenic
1050168493 9:2791335-2791357 TGCTCTGGCTGGAGACCAGGTGG + Intronic
1050271087 9:3945955-3945977 TGGCTGGCCTGGAGCCCAGGTGG - Intronic
1051082162 9:13306669-13306691 GGATGGGGGTGGAGCCAAGATGG - Intergenic
1051184262 9:14442124-14442146 GGCTGGGACTGGAGCCTAGGAGG + Intergenic
1053009995 9:34627725-34627747 TCGTGGGGATGGAGTCCAGGGGG + Exonic
1053228727 9:36386567-36386589 TGATGGGAATGCAGCCCAGCAGG - Intronic
1053619155 9:39798578-39798600 GGGTGGGGCTGAAGCCTAGGGGG - Intergenic
1054265002 9:62908851-62908873 GGGTGGGGCTGAAGCCTAGGGGG + Intergenic
1056801555 9:89695549-89695571 TGAAGGGGCTGAAGCCCACCCGG + Intergenic
1056925564 9:90831244-90831266 TGAGGGGGCTGGAGGGGAGGAGG + Intronic
1057007018 9:91569231-91569253 TCAAGGGCATGGAGCCCAGGGGG - Intronic
1057310657 9:93940966-93940988 TGATGGGGCTGGATCAGATGTGG - Intergenic
1058457737 9:105153529-105153551 TAATAGGGCTGGACCCCAGAAGG - Intergenic
1059733216 9:117076754-117076776 TGATGGGGCTGGACCACATGAGG - Intronic
1060249397 9:121972854-121972876 TATTTGGGCTTGAGCCCAGGTGG + Intronic
1060267588 9:122121392-122121414 TGCTGCTGCTGGAGCCCAAGGGG - Intergenic
1060389521 9:123267340-123267362 TGATGGGGATGGAGAGCAGGAGG - Intronic
1060529276 9:124338994-124339016 GGATGGGGCTGGAGAGCTGGGGG - Intronic
1060954250 9:127626911-127626933 TCAGGGGGCTTGAGCCCAGAAGG - Intronic
1061220426 9:129247343-129247365 TGAGGAAGATGGAGCCCAGGTGG - Intergenic
1061243040 9:129385309-129385331 TTCGGGGGCTGGTGCCCAGGAGG - Intergenic
1061407053 9:130398299-130398321 TGATGGGAGTGGAGGCCTGGAGG + Intronic
1061752827 9:132792635-132792657 TGTTGGGATTGTAGCCCAGGCGG + Exonic
1062385696 9:136310685-136310707 TGCAGGGGCTGGGGCCCAGAGGG - Intergenic
1062465452 9:136678848-136678870 TGAGGTGGGAGGAGCCCAGGAGG - Intronic
1062667509 9:137683530-137683552 TACTTGGGCTTGAGCCCAGGAGG - Intronic
1185522861 X:754788-754810 GGCTGAGGCAGGAGCCCAGGGGG - Intergenic
1186129862 X:6454849-6454871 TGAGGCAGCTTGAGCCCAGGAGG + Intergenic
1187602248 X:20845440-20845462 GGATGGGGGTGGAGCCAAGATGG + Intergenic
1189733914 X:44049748-44049770 TGATGGGACTGGATCCCTGAAGG + Intergenic
1190174799 X:48139419-48139441 TGATGGGGCTGCTGGCCGGGCGG - Intergenic
1190358278 X:49626187-49626209 TGAGGGGGGTGGAGCCAAGATGG - Intergenic
1190883943 X:54514104-54514126 TGTTGTGGCTGGGACCCAGGGGG + Intergenic
1191048322 X:56162899-56162921 TCGTGGGGGTGGAGCCAAGGTGG - Intergenic
1192015670 X:67327119-67327141 TGACGTGGCTGGAGCCAAGATGG - Intergenic
1192150427 X:68708915-68708937 ACCTGGGGCTGAAGCCCAGGTGG - Intronic
1193279003 X:79625817-79625839 TGTTGTGGGAGGAGCCCAGGGGG - Intergenic
1193324011 X:80157441-80157463 TTATAGGGCTGGAGCCAAGATGG - Intergenic
1195034735 X:100961996-100962018 GGTTGGGGCTGGAGTCCAGTGGG + Intergenic
1195667043 X:107440986-107441008 TGGTGGGGCTGGAGCCTAAGGGG + Intergenic
1196403062 X:115335887-115335909 GGCTGAGGCTTGAGCCCAGGAGG - Intergenic
1197370079 X:125614951-125614973 TGATGGGGGAGGAGCCAAGGTGG - Intergenic
1198172078 X:134117176-134117198 TGCTGGAGGTGGAGCCCAGATGG + Intergenic
1199421683 X:147651212-147651234 TCATGGGGCTGGATCCCTCGTGG + Intergenic
1200071226 X:153530463-153530485 GGAGGTGGCAGGAGCCCAGGAGG - Intronic
1200114259 X:153763266-153763288 TCAGGTGGCTGGAGCCCTGGGGG - Intergenic
1200273674 X:154712000-154712022 TAATGGGGCTGGATCCTTGGTGG - Intronic
1200988055 Y:9324968-9324990 TGATGGAGCTGCAGGCCAGCCGG - Intergenic
1201291225 Y:12421708-12421730 AGCTGGGGCTGGACACCAGGAGG - Intergenic
1201545676 Y:15159036-15159058 TGTGGGGGCTGGAGCCAAGATGG - Intergenic
1201867014 Y:18666932-18666954 CGATGGGACTGGAGCCTGGGAGG - Intergenic