ID: 900522791

View in Genome Browser
Species Human (GRCh38)
Location 1:3113707-3113729
Sequence ACCAAACACATCCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 274}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900522789_900522791 -9 Left 900522789 1:3113693-3113715 CCTCAGAGCTGACCACCAAACAC 0: 1
1: 0
2: 0
3: 22
4: 223
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522778_900522791 19 Left 900522778 1:3113665-3113687 CCCCACCCACCAGACCAGGGTGG 0: 1
1: 0
2: 0
3: 26
4: 299
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522787_900522791 -7 Left 900522787 1:3113691-3113713 CCCCTCAGAGCTGACCACCAAAC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522785_900522791 5 Left 900522785 1:3113679-3113701 CCAGGGTGGCTCCCCCTCAGAGC 0: 1
1: 0
2: 0
3: 16
4: 202
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522773_900522791 25 Left 900522773 1:3113659-3113681 CCCGGCCCCCACCCACCAGACCA 0: 1
1: 0
2: 9
3: 90
4: 896
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522781_900522791 17 Left 900522781 1:3113667-3113689 CCACCCACCAGACCAGGGTGGCT 0: 1
1: 0
2: 3
3: 15
4: 291
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522786_900522791 -6 Left 900522786 1:3113690-3113712 CCCCCTCAGAGCTGACCACCAAA 0: 1
1: 0
2: 0
3: 15
4: 188
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522780_900522791 18 Left 900522780 1:3113666-3113688 CCCACCCACCAGACCAGGGTGGC 0: 1
1: 0
2: 7
3: 13
4: 201
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522784_900522791 10 Left 900522784 1:3113674-3113696 CCAGACCAGGGTGGCTCCCCCTC 0: 1
1: 0
2: 0
3: 7
4: 192
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522777_900522791 20 Left 900522777 1:3113664-3113686 CCCCCACCCACCAGACCAGGGTG 0: 1
1: 1
2: 1
3: 34
4: 380
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522782_900522791 14 Left 900522782 1:3113670-3113692 CCCACCAGACCAGGGTGGCTCCC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522774_900522791 24 Left 900522774 1:3113660-3113682 CCGGCCCCCACCCACCAGACCAG 0: 1
1: 0
2: 5
3: 95
4: 851
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522788_900522791 -8 Left 900522788 1:3113692-3113714 CCCTCAGAGCTGACCACCAAACA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274
900522783_900522791 13 Left 900522783 1:3113671-3113693 CCACCAGACCAGGGTGGCTCCCC 0: 1
1: 0
2: 0
3: 22
4: 278
Right 900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG 0: 1
1: 0
2: 2
3: 33
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900522791 Original CRISPR ACCAAACACATCCCCAGACA TGG Intronic
900341047 1:2189465-2189487 ACCAGACACAGCCCCAGGCGGGG - Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900526282 1:3130372-3130394 ACCAAACACAACACCAGCCCTGG + Intronic
904695807 1:32330642-32330664 ACCTAACCGATCCCCAGATAGGG - Exonic
904744758 1:32703598-32703620 GTCAAAGACCTCCCCAGACAGGG - Intergenic
905263934 1:36738393-36738415 ACCATGCACATCCCCAGAGCTGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906299951 1:44674486-44674508 ACCACACACCTCCCCCAACACGG + Exonic
907629148 1:56062450-56062472 ACAAATCACATAGCCAGACAGGG + Intergenic
907751276 1:57265603-57265625 AACAAAGACATTCCCAGGCAAGG + Intronic
908292194 1:62679126-62679148 ACCATACACATATCAAGACAAGG + Intronic
909161519 1:72157116-72157138 AACAAAAACATAGCCAGACAAGG - Intronic
910895933 1:92069341-92069363 ACCATTCCCATACCCAGACAGGG + Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
912369138 1:109159585-109159607 ACCAAACACAGACTCACACAGGG - Intronic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913045957 1:115073608-115073630 AGCAAAACCATCCCCAGTCAGGG - Intronic
915331608 1:155116320-155116342 GCCCAACACCTCCCCAGACATGG + Intergenic
915650717 1:157308416-157308438 TCCAAACACATGTCCAGAAAGGG + Intergenic
918138990 1:181704227-181704249 AGCAAACACAGCCCCAGAGAAGG - Intronic
920090542 1:203449908-203449930 ACCAAACTTAGCCCCAGAGAGGG - Intergenic
924945873 1:248846708-248846730 TCCTAATGCATCCCCAGACAAGG + Intronic
1064482421 10:15752847-15752869 ACAACACACATACCCAGCCAAGG - Intergenic
1065521668 10:26579686-26579708 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1065522263 10:26584404-26584426 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065527836 10:26640709-26640731 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065528530 10:26646152-26646174 ACCAAAGTCAGCCCCAGTCAGGG + Intergenic
1065528742 10:26647962-26647984 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065558482 10:26939585-26939607 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065558708 10:26941415-26941437 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065559063 10:26944232-26944254 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065559349 10:26946438-26946460 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1066648963 10:37637842-37637864 ACCTAGCACATCCCCAGGCATGG + Intergenic
1067269242 10:44775249-44775271 ACCAAGCTCATCCACAGAAAGGG + Intergenic
1067291174 10:44942537-44942559 AACAAATACATGGCCAGACACGG - Intergenic
1076601509 10:131659716-131659738 ACCAGAAACAGCCCCAGAAAAGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081645158 11:44785216-44785238 ACCAACCAGATCCAGAGACATGG + Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083678774 11:64341913-64341935 CCCAACCACAACACCAGACATGG - Intronic
1084737896 11:71117678-71117700 AGCAAACACATCCACATACTGGG + Intronic
1088147387 11:106698272-106698294 AAAAAAAAAATCCCCAGACATGG - Intronic
1088426774 11:109713460-109713482 GACAAATTCATCCCCAGACATGG + Intergenic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089433062 11:118437895-118437917 AACAAACACCTCCCCTCACAGGG - Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091695282 12:2624119-2624141 ACAAAACAAACCCCCAAACAAGG - Intronic
1092406062 12:8222842-8222864 ATCAACCACATCCAAAGACAAGG + Intronic
1093006403 12:14056233-14056255 ACCAAAAACATTCCAAGAAAGGG + Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093588621 12:20872517-20872539 ACCAAGCACAATCCCAGCCATGG - Intronic
1095096115 12:38150193-38150215 CCCAATCTAATCCCCAGACAAGG - Intergenic
1101446211 12:104738495-104738517 ACTAAACACACACCCAGGCAAGG + Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102334122 12:112062902-112062924 ACAAAACACATAGCCAGGCATGG + Intronic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1104322183 12:127762093-127762115 ACCAAACACTTCCCAAACCAGGG + Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105070977 12:133234511-133234533 ACCTCACACATCCCGAGAGAGGG + Exonic
1107368236 13:39709930-39709952 ACCAAACAAATCCACATACATGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1113019744 13:105871552-105871574 ACCAAACACTTCCCCATAGTGGG + Intergenic
1113392044 13:109907329-109907351 CCCACACACCTCCCCAGACAAGG - Intergenic
1113933074 13:113978694-113978716 ACCAAGGACATCCTCAGACTGGG + Exonic
1114403998 14:22436929-22436951 ACCGAACTCATCCACTGACAAGG - Intergenic
1116612406 14:47092781-47092803 ACTAAACAGAGCCCAAGACATGG - Intronic
1119117651 14:72041282-72041304 ACAAGACACATCTCCAGAGAAGG - Intronic
1119258509 14:73221020-73221042 ACCAAAGACAGCCCCAAACCAGG - Exonic
1120387290 14:83862647-83862669 TCCCATCTCATCCCCAGACATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1125161857 15:36653483-36653505 ACAAAACAAAACCCCAGACATGG - Intronic
1125345334 15:38713472-38713494 ACCAAGCATAGCCACAGACAAGG - Intergenic
1126378671 15:48023133-48023155 ACCAAAATAATCCTCAGACATGG + Intergenic
1127810657 15:62562374-62562396 CCCAAACACATCCCCAGTGAAGG - Intronic
1128328807 15:66742460-66742482 ACCAGACACACCCTCAGCCAGGG - Intronic
1130536608 15:84790033-84790055 AGCAAACATACCCACAGACAAGG - Intronic
1130573324 15:85068503-85068525 AGCTAAAACATCCCCAGAGAAGG - Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1131558480 15:93419390-93419412 ACCAAACACATGCCCAGTTTTGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132674495 16:1116134-1116156 CCCAAACACACCCCCACACGGGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133494262 16:6301597-6301619 CCCACACACCTCCTCAGACACGG - Intronic
1134855987 16:17519582-17519604 CTCAAATAAATCCCCAGACATGG + Intergenic
1135306509 16:21371749-21371771 ACAAAACAAAACCCCAAACAAGG + Intergenic
1136514469 16:30759605-30759627 ACTTTACCCATCCCCAGACAAGG - Exonic
1137539300 16:49351142-49351164 CACACACACATCCCCAGCCAAGG + Intergenic
1138277995 16:55750201-55750223 ACCAGACAATTCCCCAGCCATGG - Intergenic
1138283989 16:55794047-55794069 ACCAGACAATTCCCCAGCCATGG - Intergenic
1138285013 16:55802940-55802962 ACCAGACAATTCCCCAGCCATGG + Exonic
1139463552 16:67141801-67141823 ACCACACAGAGCCCCAAACAGGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142245040 16:88966484-88966506 ACCAAACCCATGTCCAGACGAGG + Intronic
1143954852 17:10660206-10660228 ACCAAACACAGCACGAGGCATGG - Intergenic
1146989189 17:37252070-37252092 ACCACACACAACCCCCAACATGG + Exonic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147184144 17:38704812-38704834 TCCAAAAAGACCCCCAGACACGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1151155289 17:72120111-72120133 AGCAAACTCTCCCCCAGACAGGG + Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156973308 18:43184488-43184510 TCCACACACATGCCTAGACATGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1160436942 18:78858995-78859017 CCCAAACTCATCCCCCGACCAGG - Intergenic
1160437630 18:78863455-78863477 ATCAAACCCCTCCCCAGAGAGGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161732251 19:5968446-5968468 GCCAACCACTTCCCCAAACACGG - Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1162674662 19:12290003-12290025 AACAAACACAACCTCAGACATGG + Intronic
1162805902 19:13137952-13137974 AACCAACACATCCCCACACATGG + Intronic
1162874398 19:13610108-13610130 AACAAACACATTTCCAGCCAGGG + Intronic
1163416774 19:17191577-17191599 GGCAAACACATGCCCAGAGATGG - Intronic
1163694516 19:18757198-18757220 ACCAGACAGAACCCCAGCCATGG - Intronic
1163860111 19:19738307-19738329 ACCACACCCATCCCCTGACCAGG - Intergenic
1164772205 19:30818188-30818210 ACCCAACAAATCACCAGGCATGG + Intergenic
1165441068 19:35828111-35828133 ACAAAATACATCCCCAGTTAGGG - Intronic
1166302218 19:41917805-41917827 ACCATGCACAGCCCCAGCCATGG + Intronic
1166720059 19:44991444-44991466 GACAGACCCATCCCCAGACAGGG + Intronic
1167169525 19:47821917-47821939 AGGAAACACATCCCCTCACATGG - Exonic
1167872470 19:52383474-52383496 AAAAAACACATCCCCAGAAAAGG - Intronic
1167876212 19:52414750-52414772 AAGAAACACATCCCCAGAAAAGG - Intronic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
925308366 2:2865573-2865595 ACCCCACACCACCCCAGACAGGG - Intergenic
925308401 2:2865671-2865693 ACCCCACACCGCCCCAGACAGGG - Intergenic
925308421 2:2865722-2865744 ACCCCACACCACCCCAGACAGGG - Intergenic
925308477 2:2865876-2865898 ACCCCACACCACCCCAGACAGGG - Intergenic
925308528 2:2866008-2866030 ACCCCACACCACCCCAGACAGGG - Intergenic
925308574 2:2866139-2866161 ACCCCACACCGCCCCAGACAGGG - Intergenic
925742093 2:7014957-7014979 ACCAAATAGATCACTAGACAAGG - Intronic
926115176 2:10208748-10208770 ACCCAACTCATCTCCAGCCATGG + Intronic
926847848 2:17161668-17161690 AACAAACACATTCCCTGACCTGG + Intergenic
928010529 2:27603331-27603353 ACGAAATACATCCCCACGCAGGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930947484 2:57092695-57092717 ACTCAGCACATTCCCAGACATGG - Intergenic
931567739 2:63632834-63632856 TCCATACATATCCCCAGACTTGG - Intronic
931578632 2:63748600-63748622 ACCAAAAACATACCCAGCAATGG - Intronic
931784662 2:65608338-65608360 ACAAAACACATCCCCCTCCAGGG + Intergenic
934912182 2:98269266-98269288 AGAAGACACATCCCCAGAAAAGG - Intronic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937605070 2:123790259-123790281 AGCTAACACATCCCCAGAAAAGG + Intergenic
938204264 2:129403875-129403897 CCTAACCACTTCCCCAGACAAGG - Intergenic
940558053 2:155257196-155257218 ACCACACTCAGCCCCAGCCAAGG + Intergenic
943986704 2:194631034-194631056 ACCACACACATCCAAAGACCAGG - Intergenic
945034104 2:205689330-205689352 ACCAAACACATTTACAGACAAGG - Intronic
945426730 2:209714351-209714373 ATCAATCAGATCCACAGACATGG - Intronic
947933793 2:233985856-233985878 ACTGAACACATACCCAAACATGG - Exonic
947948658 2:234128694-234128716 ACCAGACTCTTCCCCAGTCAAGG - Intergenic
948553327 2:238790732-238790754 GCCAAACACATCTACAGACATGG + Intergenic
1168796266 20:611864-611886 CCCACACACAGCCCCAGACCAGG + Intergenic
1169777181 20:9268322-9268344 ACCAAACACAGCAGAAGACATGG - Intronic
1171790046 20:29514898-29514920 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1172692506 20:36799797-36799819 ATCAAACCAAGCCCCAGACAGGG + Intronic
1173425287 20:42937394-42937416 AGTAAACAGATTCCCAGACATGG - Intronic
1175225656 20:57442425-57442447 ACCACAGACATCCCCAGGCCGGG - Intergenic
1175725096 20:61312714-61312736 ACCACTCACATCCTCGGACATGG - Intronic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1176372293 21:6069289-6069311 ACCAAACTCATTCCCAGCCTAGG - Intergenic
1178791636 21:35705522-35705544 ACCAACCACATCCCATAACAGGG - Intronic
1179751225 21:43469250-43469272 ACCAAACTCATTCCCAGCCTAGG + Intergenic
1180917215 22:19497571-19497593 ATCACACACATACCCAGAAAGGG - Intronic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184238512 22:43199485-43199507 GGCCAAAACATCCCCAGACAAGG - Exonic
1184500908 22:44871122-44871144 ACCAAACACATCCAGGCACAAGG + Intergenic
953670476 3:44958108-44958130 ACCAAACACACCAGCAGGCAGGG - Intronic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
958566022 3:95811247-95811269 ACCACACACATACACACACACGG + Intergenic
958966868 3:100568765-100568787 ACCAATCACATTCCCAAAAATGG - Intronic
959874348 3:111364177-111364199 ACCAAATACATCACCAGTGATGG - Intronic
962573163 3:136731792-136731814 AGCAAACACATGCCCACACCTGG + Intronic
963843157 3:150128686-150128708 ACCAATCACATCCCAATACAGGG + Intergenic
963861180 3:150312190-150312212 ACCAAACAGAAACCCAGAAATGG + Intergenic
965000001 3:162941150-162941172 ACCAAACACAGTCCCAGTGATGG + Intergenic
966238311 3:177727300-177727322 AGCAAACATATCCTCAGAAAGGG - Intergenic
966287496 3:178314917-178314939 AGCAGACACTTACCCAGACAGGG - Intergenic
966826212 3:183967146-183967168 AACAAGCACATCTCCAGGCAGGG - Intronic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967896073 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG + Exonic
968211367 3:196851477-196851499 ACCACACCCAGCCCTAGACAGGG + Intergenic
968699845 4:2049735-2049757 CCAAAACACATCCCCAGCCTTGG + Intergenic
968883329 4:3312937-3312959 ACCAAGCACACCCCCATACTCGG - Intronic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969090926 4:4693542-4693564 TCCAAACAGATCCTGAGACAAGG + Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
969885654 4:10213094-10213116 AACAAAGCCATCCCCAGAGAAGG + Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
975679134 4:76858330-76858352 AACAAACAGACCCCCAGTCATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977819880 4:101458897-101458919 ACCCAACTCATCACCAGACAAGG + Intronic
978988955 4:115053748-115053770 ACCACATACATCCCAAGTCATGG - Intronic
981193912 4:141896088-141896110 ACCAACCACCTCCCCATACTGGG - Intergenic
981678804 4:147370510-147370532 TCCACACACAGCCCCTGACATGG + Intergenic
983131999 4:164031954-164031976 ACCAAAAACAACCCAAGACCAGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
985843360 5:2326201-2326223 CCCAAACACAGTCCCAGACATGG + Intergenic
985952544 5:3234672-3234694 ACAAAACACACATCCAGACATGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988384187 5:30539861-30539883 ACCCAAAACATTCCCAGCCATGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
990314899 5:54574739-54574761 CCTACACACATCCCCAAACATGG - Intergenic
992838909 5:80668190-80668212 CCCATACAAATCCCCAGACTCGG - Intronic
992995906 5:82332577-82332599 AGCAAACTCATCACCAGACAGGG + Intronic
993001508 5:82385852-82385874 ATCAAAGACATCCACAGGCAGGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001896516 5:175386847-175386869 ACCACACACAACTCCAAACAGGG + Intergenic
1002177385 5:177408993-177409015 ACCATACACATCCCCACCCAAGG + Intronic
1002325829 5:178405000-178405022 ACCAATGACATCCCCATACCAGG + Intronic
1003978139 6:11363659-11363681 ACCAACAACATCCCCAGTTACGG + Intronic
1004930069 6:20454381-20454403 ACCAAACCCATCCGCCCACAAGG - Intronic
1006714411 6:36106289-36106311 ATCAGACACATCCCGAGAAACGG + Intronic
1007515494 6:42407340-42407362 GACAAACACAGCCCCAAACAGGG - Intronic
1008385666 6:50887089-50887111 ACCACACACAGCCTCAGAAAGGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1011282258 6:85688870-85688892 ACCAAAAGAATACCCAGACATGG - Intergenic
1011411563 6:87071703-87071725 TCAAAAAACATCCCAAGACAGGG - Intergenic
1012556681 6:100521930-100521952 ACCAAAGCCATCCCCAGTCTGGG - Intronic
1012958383 6:105595256-105595278 ACCACACACATCACCACCCAAGG - Intergenic
1013569694 6:111409549-111409571 ACCATACAAATCCCCTGAAAGGG + Intronic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1016674088 6:146743382-146743404 ACCAAACCCATCCCAACCCAAGG - Intronic
1017300116 6:152847135-152847157 CCCAAACACAGACCCAGACCAGG + Intergenic
1020791609 7:12634682-12634704 ACAAAACAAAGCCCCAAACATGG - Intronic
1022088010 7:27087857-27087879 ACCCAACACTTCCTCAGAGAAGG - Intergenic
1022697573 7:32724785-32724807 ACCAAACAATTACCAAGACAGGG + Intergenic
1023320515 7:38992252-38992274 AAAAAACAAATTCCCAGACAAGG - Intronic
1023698313 7:42869921-42869943 ACCAAGCACCTCCCCAGAACAGG - Intergenic
1023748990 7:43351704-43351726 ACCAAGCACATGCAAAGACAAGG - Intronic
1023802678 7:43848582-43848604 ACCAATCACATCTCCAGCCTGGG + Intergenic
1026382971 7:69817749-69817771 ACCACCCACATCCCCGGGCAGGG - Intronic
1027719488 7:81721753-81721775 ATCAAACACATCACCAGTGATGG - Intronic
1027769633 7:82390614-82390636 ACCATACACATCCACAGTAATGG - Intronic
1027769726 7:82391839-82391861 ACCATACACATCCACAGTAATGG - Intronic
1028242067 7:88433712-88433734 CCCAAATACATCCCCAGTGAGGG - Intergenic
1030378277 7:108779866-108779888 ACCAAACCCCTCCCCAGCCAGGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031998892 7:128251903-128251925 ACCAACCACATTACCAGACGGGG - Intronic
1032688720 7:134261025-134261047 ACCAAACAAATGCCCAGTCCAGG - Intronic
1032886076 7:136139950-136139972 ACCTAACAAATTCCAAGACAGGG - Intergenic
1036006687 8:4672899-4672921 AACAAACACATTCACAAACATGG + Intronic
1036263681 8:7258872-7258894 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036264982 8:7266494-7266516 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036266283 8:7274116-7274138 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036267584 8:7281738-7281760 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036268887 8:7289360-7289382 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036270185 8:7296982-7297004 ATCAAACACATCCAAAGACAAGG - Intergenic
1036297703 8:7550072-7550094 ATCAAACATATCCAAAGACAAGG + Intergenic
1036299007 8:7557720-7557742 ATCAAACATATCCAAAGACAAGG + Intergenic
1036300312 8:7565370-7565392 ATCAAACATATCCAAAGACAAGG + Intergenic
1036301618 8:7573015-7573037 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036302916 8:7580664-7580686 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036315722 8:7717411-7717433 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036317031 8:7725059-7725081 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036318338 8:7732707-7732729 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036319647 8:7740354-7740376 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036320954 8:7748002-7748024 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036322264 8:7755650-7755672 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036323573 8:7763298-7763320 ATCAAGCACATCCAAAGACAAGG - Intergenic
1036324869 8:7770946-7770968 ATCAAACATATCCAAAGACAAGG - Intergenic
1036351167 8:8013362-8013384 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036352473 8:8021008-8021030 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036353766 8:8028656-8028678 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036475427 8:9088865-9088887 GCCAAACACATTCCCTGACCAGG + Intronic
1036846446 8:12173781-12173803 ATCAAGCACATCCAAAGACAAGG + Intergenic
1036867809 8:12416100-12416122 ATCAAGCACATCCAAAGACAAGG + Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1039020828 8:33204353-33204375 ACCAAACACATCACAAAATATGG + Intergenic
1040819707 8:51542237-51542259 ACAGAACACAACCTCAGACAAGG + Intronic
1042593999 8:70425814-70425836 ACCAAAGGCATCACCAGGCATGG - Intergenic
1042925745 8:73966761-73966783 ACCACACATAGCCCAAGACATGG + Intronic
1046535868 8:115509402-115509424 ACCAAACCCTTCCCCACACTTGG - Intronic
1048561901 8:135548186-135548208 ACCAAGCACTTCTCTAGACATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050336502 9:4594883-4594905 ACTAAACAAAATCCCAGACAAGG + Intronic
1055179283 9:73363453-73363475 CCCCACCACATCCACAGACAGGG - Intergenic
1056938508 9:90936282-90936304 ACCAAAGGCATCCTCAGCCAAGG - Intergenic
1057795133 9:98150408-98150430 ACCAAACCCATTCCCACTCAGGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062080638 9:134621594-134621616 TACAAAAGCATCCCCAGACATGG - Intergenic
1062372136 9:136245474-136245496 ACCTCGCACATCCCCAGCCAGGG + Exonic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186593192 X:10953045-10953067 TCCATACACATCCCCAGGAAGGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1192614738 X:72608050-72608072 ACCAAACACATGCCCAGCCGTGG - Intronic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1194468417 X:94260843-94260865 ACCAAACACAAACCCAGAAGGGG + Intergenic
1194534374 X:95087113-95087135 AGCAAACACATCCCTCCACATGG + Intergenic
1194915577 X:99703839-99703861 AACAAACACATACCCTGTCAAGG + Intergenic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199448550 X:147954359-147954381 ACCAAACCCAACTCCAGCCAGGG - Intergenic
1201941095 Y:19460933-19460955 ACCATCCACATCCCCAGATCTGG - Intergenic