ID: 900523378

View in Genome Browser
Species Human (GRCh38)
Location 1:3116792-3116814
Sequence TGGCCCCGCTGGTGACTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900523367_900523378 12 Left 900523367 1:3116757-3116779 CCCTCACCCCAGCAGGCCTAGCT 0: 1
1: 0
2: 2
3: 24
4: 293
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523371_900523378 4 Left 900523371 1:3116765-3116787 CCAGCAGGCCTAGCTGCTCCATG 0: 1
1: 0
2: 2
3: 19
4: 303
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523370_900523378 5 Left 900523370 1:3116764-3116786 CCCAGCAGGCCTAGCTGCTCCAT 0: 1
1: 0
2: 1
3: 12
4: 216
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523368_900523378 11 Left 900523368 1:3116758-3116780 CCTCACCCCAGCAGGCCTAGCTG 0: 1
1: 0
2: 5
3: 38
4: 448
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523364_900523378 20 Left 900523364 1:3116749-3116771 CCCTGAAGCCCTCACCCCAGCAG 0: 1
1: 0
2: 12
3: 96
4: 670
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523369_900523378 6 Left 900523369 1:3116763-3116785 CCCCAGCAGGCCTAGCTGCTCCA 0: 1
1: 0
2: 1
3: 39
4: 292
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523374_900523378 -4 Left 900523374 1:3116773-3116795 CCTAGCTGCTCCATGGCTCTGGC 0: 1
1: 0
2: 2
3: 22
4: 343
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122
900523365_900523378 19 Left 900523365 1:3116750-3116772 CCTGAAGCCCTCACCCCAGCAGG 0: 1
1: 0
2: 4
3: 32
4: 389
Right 900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900523378 Original CRISPR TGGCCCCGCTGGTGACTTGG TGG Intronic