ID: 900527122

View in Genome Browser
Species Human (GRCh38)
Location 1:3134878-3134900
Sequence CTCGCCGGGCTCTCAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900527122_900527136 3 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527136 1:3134904-3134926 ATCGGGCCGGGTATTAGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
900527122_900527130 -10 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527130 1:3134891-3134913 GCCCGGCGAGGGGATCGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 202
900527122_900527141 29 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527141 1:3134930-3134952 AGACGGCCGAGCTGCTGGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
900527122_900527132 -9 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527132 1:3134892-3134914 CCCGGCGAGGGGATCGGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 187
900527122_900527140 24 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527140 1:3134925-3134947 GGATTAGACGGCCGAGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 52
900527122_900527135 2 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527135 1:3134903-3134925 GATCGGGCCGGGTATTAGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 25
900527122_900527134 1 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527134 1:3134902-3134924 GGATCGGGCCGGGTATTAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
900527122_900527138 12 Left 900527122 1:3134878-3134900 CCACCTCCTGAGAGCCCGGCGAG 0: 1
1: 0
2: 0
3: 16
4: 155
Right 900527138 1:3134913-3134935 GGTATTAGCCGGGGATTAGACGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900527122 Original CRISPR CTCGCCGGGCTCTCAGGAGG TGG (reversed) Intronic
900379410 1:2376436-2376458 TGCCCCGGGCTTTCAGGAGGAGG + Intronic
900527122 1:3134878-3134900 CTCGCCGGGCTCTCAGGAGGTGG - Intronic
900636641 1:3669275-3669297 CTCTACGGCCTCCCAGGAGGCGG + Intronic
902044219 1:13513302-13513324 CTCGCTGCGCTCGCTGGAGGAGG - Exonic
902915878 1:19639016-19639038 CACGCTTGGCTCTCAGGAAGTGG - Intronic
903121774 1:21220845-21220867 CTCCCCGGGATCTCAGGATCAGG - Intronic
904382213 1:30119225-30119247 CATCCTGGGCTCTCAGGAGGAGG + Intergenic
905655216 1:39682448-39682470 CTGGCTGGCCTCCCAGGAGGAGG - Exonic
907213523 1:52843019-52843041 CTCGCCGCGCTCGCCGGAGCTGG - Intronic
916612809 1:166409828-166409850 CTCGCTGGGCTCTGTGGGGGTGG + Intergenic
920498345 1:206470951-206470973 CTGGCCGGAGTCTCAGGAGTAGG + Intronic
921325580 1:213983943-213983965 CTCGCCGGGCTCTGGGCAGCCGG + Intronic
922800440 1:228362465-228362487 CTGGGCGGTCTCTGAGGAGGGGG + Intronic
923475545 1:234327929-234327951 CCCGCAGGGCCCTCAGGAGCTGG - Intergenic
924623201 1:245679982-245680004 CCCGCCTGGCTCTGGGGAGGGGG + Intronic
1065314630 10:24451313-24451335 CTGGCAGAGCTCTCAGGAGGGGG + Intronic
1066074693 10:31861549-31861571 ATTGCCGGGCTCCCAGGAAGTGG + Exonic
1068951559 10:62782521-62782543 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1073446559 10:103584488-103584510 CACGCAGGGCTCTCGGGAGGCGG - Intronic
1074355014 10:112774835-112774857 CTTGACAGGCCCTCAGGAGGGGG - Intronic
1076000553 10:126909326-126909348 CTGGCTGGGCTCTTAGCAGGAGG - Intronic
1076885690 10:133261479-133261501 CGCGCTGGCCTCTGAGGAGGTGG - Intergenic
1077102760 11:829451-829473 CACGGCGGGCTCTCTGGATGAGG + Exonic
1084179121 11:67437788-67437810 CTCCCCAGTCTCTCTGGAGGAGG + Exonic
1085277426 11:75309120-75309142 CTCCCTGTGCTCTCAGAAGGTGG + Intronic
1086950170 11:92883269-92883291 CCCGCCGGGCTGTCAGGATGCGG - Exonic
1089199201 11:116713488-116713510 CTGGCTGGGCTCTTATGAGGAGG - Intergenic
1089580775 11:119480930-119480952 ATGGCCGGGCTCTGAGCAGGGGG - Intergenic
1092204274 12:6606319-6606341 CTCGGCGGGCAGTGAGGAGGAGG - Exonic
1092690893 12:11108882-11108904 CTTGCTGGGCTCCAAGGAGGTGG - Intronic
1104407848 12:128533318-128533340 CTGGCCTGGCCCTCAGGAGGAGG - Intronic
1104961548 12:132490507-132490529 CGCGCCTGGCTCGCAGCAGGCGG - Exonic
1112290818 13:98143104-98143126 CTCGCCGGCCTCAGAGGCGGCGG + Intronic
1118619258 14:67599983-67600005 CTCCCCGCGCTCGAAGGAGGGGG - Intronic
1118749678 14:68796399-68796421 ACTGCAGGGCTCTCAGGAGGGGG - Intergenic
1122694976 14:103548148-103548170 CTGGCCTGGCTGGCAGGAGGAGG - Intergenic
1126592469 15:50354477-50354499 CCCGCCGGGCTCTCCGGAGAGGG - Intronic
1132296031 15:100735142-100735164 CTGGCCGGGCTCTCAGCAAGAGG - Intergenic
1132762922 16:1519713-1519735 CTCTGAGGGCTCCCAGGAGGAGG + Intronic
1134290884 16:12902210-12902232 CTCGCTGGCCTCTCCGGAGGCGG - Exonic
1135992299 16:27225451-27225473 CTGGCAGCCCTCTCAGGAGGGGG - Intronic
1139924397 16:70478256-70478278 GTCCCTGGGCTCACAGGAGGTGG + Exonic
1140474503 16:75232789-75232811 CTCACCGAGCTCTCATGAGGCGG + Intronic
1140904156 16:79396171-79396193 CTCACCTGTGTCTCAGGAGGAGG - Intergenic
1141451324 16:84105446-84105468 CTCTCCGGGCTGTGAAGAGGCGG + Intronic
1142198607 16:88750536-88750558 CTGGCCGGACTCTCAGGATGAGG - Intronic
1142851306 17:2706118-2706140 CCCACCCGGCTCTCAGGAGCGGG + Intronic
1142865808 17:2790856-2790878 CTGGCTGGGCTCAGAGGAGGGGG - Intronic
1143501755 17:7343402-7343424 CTCGCCGGGATTTCTGGCGGGGG + Exonic
1144955846 17:19018393-19018415 CTAGGAGGGCTTTCAGGAGGAGG - Intronic
1146844651 17:36175117-36175139 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1146856957 17:36263052-36263074 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1146863660 17:36325323-36325345 CTCGCCGGGCTCCCAGATGCTGG - Intronic
1146872867 17:36386962-36386984 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1146880225 17:36438048-36438070 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1147066520 17:37925911-37925933 CTCGCCGGGCTCCCAGATGCTGG - Intronic
1147075751 17:37987587-37987609 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1147078052 17:38005472-38005494 CTCGCCGGGCTCCCAGATGCTGG - Intronic
1147087276 17:38067133-38067155 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1147093988 17:38129407-38129429 CTCGCCGGGCTCCCAGATGCTGG - Intergenic
1147103221 17:38191096-38191118 CTCGCCGGGCTCCCAGATGCTGG + Intergenic
1148805209 17:50260501-50260523 CTCGTGGGGCTCTCTGCAGGCGG + Intergenic
1149430724 17:56594122-56594144 CTCCCCCGTCTCTCCGGAGGCGG - Exonic
1149847796 17:60017565-60017587 CTCGCCGGGCTCCCAGATGCTGG + Intergenic
1150086152 17:62274182-62274204 CTCGCCGGGCTCCCAGATGCTGG + Intronic
1150108194 17:62477948-62477970 CTCCCCGGGCACCCAGGGGGAGG - Intronic
1152313887 17:79568665-79568687 CTTCCCAGGCTCTCATGAGGAGG - Intergenic
1153702600 18:7711546-7711568 CTTGCTGGGCTCTGTGGAGGTGG - Intronic
1156851037 18:41726432-41726454 CTTTCCAGGTTCTCAGGAGGAGG - Intergenic
1156979299 18:43265741-43265763 CTTGCTGGGCTCTGAGGGGGTGG + Intergenic
1157513302 18:48294119-48294141 CTCTCCGGGCTCCCAGGGGAAGG - Intronic
1160738176 19:674230-674252 ATCACTGGGGTCTCAGGAGGAGG + Intergenic
1160827848 19:1089044-1089066 CTGGCCGGAGTCTCAGGAGCGGG - Intronic
1161151259 19:2711234-2711256 CTTGCCAGGATCCCAGGAGGCGG - Intergenic
1162775270 19:12975366-12975388 CTCCCCTGGCTGGCAGGAGGTGG - Intergenic
1164575704 19:29404259-29404281 CATGCCGGGCTCTGAGGAGGGGG - Intergenic
1165993578 19:39829783-39829805 CCCGCCCTACTCTCAGGAGGAGG - Intronic
1166336786 19:42112999-42113021 CTGTCCAGGCTTTCAGGAGGAGG - Intronic
1166783464 19:45354136-45354158 ATGGCCGGGCTCTCAGGAGTGGG - Intronic
1166803027 19:45469604-45469626 GTCCCTGGGCTCTCAGGAGAAGG + Intronic
1166930264 19:46297834-46297856 CTCCCCTGTCTCTCAGGATGGGG - Intronic
1167070956 19:47221729-47221751 CTGGCCAGGGTGTCAGGAGGTGG + Exonic
925475214 2:4205955-4205977 CACTCAGGGCTCTCAGGAGAAGG - Intergenic
925889453 2:8421793-8421815 GTCCCCGGGATCACAGGAGGGGG + Intergenic
929257759 2:39830904-39830926 CTTGCTGGGCTCTGTGGAGGGGG + Intergenic
930037826 2:47098834-47098856 CTCTCTGGGCACTCAAGAGGTGG + Intronic
930264742 2:49186412-49186434 CTTGCTGGGCTCTCTGGGGGTGG + Intergenic
934715671 2:96541969-96541991 CTCTCCTGGCTCTGTGGAGGAGG - Intronic
937252516 2:120533737-120533759 CACGCCGGGGGCTCAGGATGGGG - Intergenic
940338533 2:152555048-152555070 CACTCCGTGCACTCAGGAGGGGG - Intronic
941285655 2:163609859-163609881 CTCGCTGTGCTGTCAGGAAGTGG + Exonic
942043982 2:172088380-172088402 CTCGCGGGGCTCCGAGGAGATGG - Exonic
947577098 2:231284478-231284500 CTCACCTGGCTGTCAGCAGGAGG + Intronic
1169223733 20:3842831-3842853 CTCTCAGGGGTCTCAGGAGGAGG - Intergenic
1170596082 20:17806912-17806934 GTGGCCGGGCCCTCAGGACGTGG + Intergenic
1170787674 20:19481733-19481755 CTCCCCGGGCTCTCTGTAGGTGG - Intronic
1171372897 20:24673179-24673201 CTTGCAGGGCTCAGAGGAGGGGG - Intergenic
1172212046 20:33206898-33206920 CTGGCCGGGCTCACTGGTGGTGG - Intergenic
1173523584 20:43716207-43716229 CTCCCCAGACTCTCAGGTGGAGG + Exonic
1175905795 20:62378721-62378743 CTCGTGGGCCTCCCAGGAGGTGG + Intergenic
1176550082 21:8217174-8217196 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1176569009 21:8400209-8400231 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1176576923 21:8444444-8444466 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1177425879 21:20922315-20922337 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1178695987 21:34792938-34792960 GTCTCCGTCCTCTCAGGAGGTGG - Intronic
1179157091 21:38859986-38860008 CAGGGCGGGCTCTCTGGAGGAGG + Intergenic
1179593264 21:42425410-42425432 CTCGCCTTGCCCTCAGGAAGGGG + Intronic
1180606768 22:17064863-17064885 GTCACCAGGCTCTCGGGAGGAGG + Intergenic
1183747576 22:39700413-39700435 CTGGCCTGGCTCTCAGAAGGTGG - Intergenic
1184617114 22:45645754-45645776 CTCCCCGGGCGCCCAGCAGGTGG + Intergenic
1184760632 22:46542151-46542173 GGCGCCGAGCTCCCAGGAGGAGG - Intergenic
1185046918 22:48533160-48533182 GTGGCCGGGGTCTGAGGAGGTGG + Intronic
1203254972 22_KI270733v1_random:133500-133522 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1203263028 22_KI270733v1_random:178579-178601 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
950316197 3:12004225-12004247 CTCTCGGGGCTTGCAGGAGGGGG - Intergenic
955247526 3:57240836-57240858 CTGGCGGGGCTGTTAGGAGGGGG + Intronic
959294564 3:104519627-104519649 ATCTCCTGGCTCTTAGGAGGTGG - Intergenic
960714684 3:120563382-120563404 CTTCCCAAGCTCTCAGGAGGTGG + Intergenic
961349117 3:126287752-126287774 CTCCCAGAGCTCACAGGAGGGGG - Intergenic
961905978 3:130263834-130263856 CACGCCGGGGCCCCAGGAGGTGG + Intergenic
966794120 3:183697931-183697953 CTCGCCGTGCTCTCTCGCGGCGG + Exonic
972755552 4:42042273-42042295 CTTTCTGGGCTCTCTGGAGGTGG - Intronic
981662504 4:147184096-147184118 CTTGCTGGACTCTCAGGGGGTGG - Intergenic
984866919 4:184288857-184288879 CTAGCCTTGCTCTCAGGAGGTGG + Intergenic
991403443 5:66277847-66277869 CTCTCTGGGCTGTCAGGAGCAGG + Intergenic
996770492 5:127080489-127080511 CTTTCCGGGCTCTCACGAGCAGG + Intergenic
999151751 5:149430785-149430807 CTCGGCTGGCTCACAGGATGAGG + Intergenic
999194858 5:149774964-149774986 CTCGCCCGGCTCTCTGGCTGTGG - Intronic
999561789 5:152811334-152811356 CTTGCCAGGCCCTCGGGAGGTGG + Intergenic
1002293068 5:178212758-178212780 CTTCCTGGGCTGTCAGGAGGTGG - Intronic
1003646274 6:7915211-7915233 ATCGCCAGGCACTGAGGAGGTGG - Intronic
1007406985 6:41640826-41640848 CTCCCGGGGCTCTCAGGGGTGGG - Intronic
1009497869 6:64373684-64373706 CTCACCTGGCTATCAGCAGGAGG + Intronic
1011638620 6:89399188-89399210 CTCGCCACCCTCCCAGGAGGAGG - Intronic
1014753687 6:125280452-125280474 CTTGCTGGGCTCTGTGGAGGTGG - Intronic
1016211328 6:141538733-141538755 CTCACCTGGCTATAAGGAGGTGG - Intergenic
1018393083 6:163355618-163355640 CCCGCCAGCCTCTCAGGGGGAGG + Intergenic
1019314816 7:379552-379574 CTCGCGTGGCTCCCAGGAGAGGG + Intergenic
1019914461 7:4123889-4123911 CTCCCAGGGCTCTCAGGATCAGG + Intronic
1020884341 7:13803621-13803643 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic
1023882202 7:44326723-44326745 CTGGGCAGGCTCTGAGGAGGGGG + Intronic
1027025843 7:74851284-74851306 TTCCCCAGGCCCTCAGGAGGAGG + Intronic
1027061918 7:75092835-75092857 TTCCCCAGGCCCTCAGGAGGAGG - Intronic
1032037241 7:128530482-128530504 CTCCCCGGGCACCCAGGGGGAGG - Intergenic
1032966438 7:137103603-137103625 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1037839231 8:22232186-22232208 CTCGCCGGGCTGGTGGGAGGGGG + Exonic
1038467132 8:27774586-27774608 CTCGCCGGGCTCTGAGGCGCAGG + Exonic
1041377366 8:57217485-57217507 CTCCCCGAGATCTCAGGGGGTGG - Intergenic
1041666305 8:60448281-60448303 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049460821 8:142726964-142726986 CTCGCCAGGCTCTGAAGACGCGG - Intergenic
1049471635 8:142777433-142777455 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471654 8:142777485-142777507 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471673 8:142777537-142777559 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1049471692 8:142777589-142777611 CTCGGCGGGTGCCCAGGAGGCGG - Intronic
1058897967 9:109416337-109416359 CTCGCAGGGCTCTCAGGGCTGGG + Intronic
1060838693 9:126777690-126777712 CTCCCCCAGCTCCCAGGAGGGGG - Intergenic
1062109615 9:134774749-134774771 TTCGCCCTGCTCTCAGCAGGAGG + Intronic
1062552836 9:137097962-137097984 CTCCCCGGGCGCTCAGGGGCTGG + Intronic
1062637328 9:137498475-137498497 CTCGCGGGCCTGCCAGGAGGGGG - Intronic
1203471374 Un_GL000220v1:116646-116668 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1203479195 Un_GL000220v1:160618-160640 CCCGCCGGGCTCCCCGGGGGCGG - Intergenic
1185722888 X:2396024-2396046 CTCCGGGGGCTCTCAGGAAGGGG + Intronic
1187839953 X:23476825-23476847 CTTGCTGGGCTCTGTGGAGGTGG + Intergenic
1191255555 X:58278117-58278139 GTGGCCAGGCTTTCAGGAGGAGG - Intergenic
1191256699 X:58282584-58282606 ATGGCCAGGCTTTCAGGAGGAGG - Intergenic
1193079333 X:77390418-77390440 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic
1193284636 X:79697211-79697233 CTTGCTGGGCTCTGTGGAGGGGG + Intergenic
1193774197 X:85622655-85622677 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1193878723 X:86896067-86896089 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1198518980 X:137433591-137433613 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic
1199469831 X:148181968-148181990 CTTGCCGGGCTCTGTGGGGGTGG + Intergenic