ID: 900527871

View in Genome Browser
Species Human (GRCh38)
Location 1:3137960-3137982
Sequence TGGCTGGAGGGTCCGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900527866_900527871 -5 Left 900527866 1:3137942-3137964 CCAGTAGCTCTTGGACTGTGGCT 0: 1
1: 0
2: 0
3: 19
4: 162
Right 900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 125
900527860_900527871 30 Left 900527860 1:3137907-3137929 CCATTTGTGCTAAATGTCCCACG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 125
900527863_900527871 12 Left 900527863 1:3137925-3137947 CCACGATGCATTTGAGGCCAGTA 0: 1
1: 0
2: 2
3: 5
4: 83
Right 900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 125
900527862_900527871 13 Left 900527862 1:3137924-3137946 CCCACGATGCATTTGAGGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900527871 Original CRISPR TGGCTGGAGGGTCCGTCCCT GGG Intronic
900403341 1:2481847-2481869 TGGCTGCAGGCTCCTTCTCTCGG - Intronic
900460877 1:2801662-2801684 TGGCTGGAGGGCCCAGGCCTGGG + Intronic
900472787 1:2863012-2863034 GAGCTGGGGGGTCTGTCCCTGGG + Intergenic
900505524 1:3028329-3028351 GGGCTGGGGGCTCCTTCCCTGGG - Intergenic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
900739511 1:4322200-4322222 TGGGTGGGGGGTCCTTCCATGGG - Intergenic
901416551 1:9120520-9120542 TGCCTGGAGGTTTCTTCCCTGGG + Intronic
902748170 1:18487338-18487360 TGGCTGGAGGGGCCATCCAGGGG + Intergenic
905356147 1:37386290-37386312 TGACTGGCGGGTCTTTCCCTTGG - Intergenic
905641944 1:39596112-39596134 TGGCTCCAGTGTCCCTCCCTGGG + Intergenic
907341458 1:53738830-53738852 TGGGTGGCGTGTCCGTCCCCGGG - Intergenic
908908898 1:69049286-69049308 TGGCAGAAGTGTCTGTCCCTGGG + Intergenic
916890075 1:169106012-169106034 TGGCTGGGGGATCCGCACCTGGG - Intronic
918958314 1:191238531-191238553 TGGCTGGATGGTCAGTGACTTGG + Intergenic
920200796 1:204258636-204258658 GGGCTGCAGGCTCCTTCCCTGGG - Intronic
922672413 1:227520864-227520886 AGGCTGGAGGGGCCTGCCCTCGG - Intergenic
1062857860 10:788332-788354 TGGCTGGAGGGTCAGCACCCAGG + Intergenic
1062903937 10:1166949-1166971 TGGCTGGAGGGCCAGTCCCAGGG - Intergenic
1065317043 10:24473420-24473442 AGGCTGGAGATTCTGTCCCTGGG - Exonic
1066553024 10:36580522-36580544 TGGCTGGAGGGTGCCACCCAGGG + Intergenic
1076421057 10:130331831-130331853 AGGCTGGAGGGCTGGTCCCTAGG + Intergenic
1077286296 11:1767497-1767519 TGCCTGGTGGGTCAGTCCCTCGG - Intergenic
1077415668 11:2423197-2423219 TGGCTGGAGAGAAGGTCCCTGGG - Intergenic
1078355356 11:10628361-10628383 TGGCTGGAGGGTGTGACTCTGGG + Intronic
1080076681 11:28158090-28158112 TGGCTGGATGGTCCGGGACTTGG + Intronic
1082026128 11:47573599-47573621 TGGTGGGAGGGTCCATCCCACGG - Exonic
1083282935 11:61638557-61638579 TGGCTGGAGGGTCTCTCCTAAGG - Intergenic
1085389444 11:76175095-76175117 AGGCTTGAGGGTCCTTCCCTGGG - Intergenic
1085834528 11:79938277-79938299 TGGCTGGAGGGTGCTTCTTTGGG - Intergenic
1089517645 11:119043953-119043975 AGGCTGGAGGGTGGGTCCCTTGG - Intergenic
1091779123 12:3202767-3202789 TGGCTGGAGGGCCCAACCCATGG - Intronic
1094812207 12:34149551-34149573 AGGCTGGAGGGGCCTTCCCTAGG + Intergenic
1099366011 12:81765959-81765981 TGGCTGGATGGTCAGTGACTTGG + Intergenic
1100939721 12:99712850-99712872 TGGCTGGAGGGTCCATCCTCTGG + Intronic
1101814708 12:108136948-108136970 TGGCTGGAGGGTCCCCTGCTAGG + Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1105202936 13:18194867-18194889 GGGCTGGAGGGACAGTCCCGAGG - Intergenic
1105438281 13:20395589-20395611 TGGTTGGAGAGTCTGACCCTCGG - Intergenic
1111057721 13:82972450-82972472 TGGCTGGATGGTCAGGGCCTTGG - Intergenic
1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG + Intronic
1113579817 13:111420974-111420996 TGGCTGGTGGCTCCCTCCCCTGG + Intergenic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1117596194 14:57329310-57329332 TGGCTGGATGGTCAGACACTTGG - Intergenic
1121512729 14:94524294-94524316 TGGCTGGAGTGTGAGTCCCCTGG + Intergenic
1121686641 14:95840314-95840336 TGGCTGGAGGGTCTCTCACACGG + Intergenic
1125520690 15:40346362-40346384 GGGCTGGAGGGACCAGCCCTAGG + Intergenic
1126949775 15:53868410-53868432 TCACTGGAGGATCTGTCCCTGGG + Intergenic
1130149413 15:81299902-81299924 GGGCTGGAGGCTCAGTCTCTGGG - Exonic
1132514362 16:359402-359424 TGCCTGGAGGGTCCGGCCGCAGG + Intergenic
1135173710 16:20209636-20209658 TGGCAGGAGGGGCTGTCCTTTGG - Intergenic
1135403791 16:22184040-22184062 TGGCTGCAGGGTCTGCCCCCTGG + Intronic
1136886147 16:33931473-33931495 TGGGTGGTGGGACCCTCCCTGGG - Intergenic
1137531474 16:49281404-49281426 TGGCTGGCGGGCCCGGCCCGCGG - Exonic
1139481687 16:67234223-67234245 TGGCTGCAGGGGCTGTCTCTGGG + Exonic
1141482864 16:84318450-84318472 TGGCTGAAGGGCCCGTGCATGGG - Intronic
1142349918 16:89575279-89575301 GGGCTGGAAGGACCGTCCCGGGG - Intergenic
1203086292 16_KI270728v1_random:1186334-1186356 TGGGTGGTGGGACCCTCCCTGGG + Intergenic
1147143908 17:38474486-38474508 TGGGTGGTGGGACCCTCCCTGGG + Intronic
1151478431 17:74356356-74356378 TGGCTTGTGGGACCCTCCCTGGG + Intergenic
1151975270 17:77480741-77480763 TGGCGGGAGGGGCCCTGCCTGGG + Intronic
1154506248 18:15043459-15043481 TGGCTGGATGGTCAGGCACTTGG + Intergenic
1157532295 18:48431070-48431092 TGGCTGGAGGCTTACTCCCTCGG + Intergenic
1157763151 18:50279958-50279980 TGGCTGGACTGCCCGGCCCTGGG - Exonic
1158073081 18:53496212-53496234 TGGCTGGCGGGTGCCTCTCTGGG + Intronic
1160701154 19:508004-508026 GGGCTGGAGGGTCCGGGCTTCGG + Intronic
1162391891 19:10394976-10394998 TGGCTGGAGGCCCCCTCCCCAGG - Intronic
1163222923 19:15934762-15934784 GGGCTGGAGGGTCCTGGCCTGGG - Exonic
1165874846 19:38998992-38999014 TGGCTGGAAGGGCCCACCCTGGG - Intronic
1167715101 19:51137994-51138016 GTCCTGGAGGGTCAGTCCCTGGG + Intergenic
1168340324 19:55619321-55619343 TGGCTGGAGGTTGGGTTCCTGGG + Intergenic
925636978 2:5950001-5950023 TGAGGGGAGGGTCCGTGCCTTGG - Intergenic
926751082 2:16199026-16199048 TGGCTGGTGGGTCGGGCCTTTGG + Intergenic
928177997 2:29047929-29047951 GGGGTGGAGGGTGCGTGCCTGGG + Intronic
929929310 2:46239698-46239720 TGGTTGGATGGTCCGGGCCTGGG + Intergenic
932321968 2:70829023-70829045 AGGCTGGAGGGGCCGTCACGTGG - Intergenic
933966408 2:87432993-87433015 TGGCTGGAGGGGCTGGCCATAGG - Intergenic
936327387 2:111517492-111517514 TGGCTGGAGGGGCTGGCCATAGG + Intergenic
936499364 2:113053735-113053757 TGGCTGGAGGGTTCGGCTCAGGG + Intergenic
937884028 2:126888033-126888055 TGGATGGAGGGTCAGGCCCTGGG - Intergenic
938259614 2:129885901-129885923 GCGCTGGAGGGTCTGTGCCTAGG - Intergenic
947248794 2:228078903-228078925 TGCCTGGAGGCTCCGTTCGTGGG - Intronic
947941717 2:234062258-234062280 TGGCTGGAAGGTCAGTTCCTGGG - Intronic
1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG + Intergenic
1174287377 20:49482838-49482860 TGGAGGGAGGGGCCGCCCCTCGG + Intergenic
1175860591 20:62148190-62148212 TGGCTGCGGGGTCCCTCCCCGGG - Intronic
1175901457 20:62361462-62361484 TGGCTGGAGGGCCGGCCCCAAGG - Intronic
1175936124 20:62514877-62514899 TGGCTGGAGGTCCCTTCCCTGGG + Intergenic
1176715023 21:10343138-10343160 GGGCTGGAGGGACAGTCCCGAGG + Intergenic
1176791607 21:13325564-13325586 TGGCTGGATGGTCAGGCACTTGG - Intergenic
1177990173 21:28027752-28027774 TGGCTGGATGGTCAGGCACTTGG + Intergenic
1178830588 21:36053304-36053326 TGGCTGGTGGGGCAGTCCCATGG - Intronic
1180144180 21:45910198-45910220 TGGGTGGGGGGTCCGTATCTGGG - Intronic
1180603327 22:17036800-17036822 GGGCTGGAGGGACAGTCCCGAGG - Intergenic
1181082626 22:20424928-20424950 TGGCTGGAGGCTCCCTCCCTTGG - Exonic
1182975303 22:34618498-34618520 TGGCTGGAGTGTTGGTTCCTGGG + Intergenic
1184111515 22:42398254-42398276 TGGCTGCTGGCTCGGTCCCTGGG - Intronic
1184807765 22:46806798-46806820 TGGCTGGTGGGTCCCACCCAGGG + Intronic
950170650 3:10837072-10837094 TGGCAGGAGGGGCTGGCCCTGGG + Intronic
954801904 3:53192052-53192074 TGTCTGGAGGGCCATTCCCTAGG + Intronic
955019649 3:55106936-55106958 TGGCTGGAGTGACCCGCCCTTGG + Intergenic
966044252 3:175530349-175530371 TGGCTGGATGGTCAGTGACTTGG - Intronic
967817402 3:193811021-193811043 TGGATGGAGAGTCCATCACTAGG - Intergenic
976388209 4:84483418-84483440 TGGGGGCAGGCTCCGTCCCTGGG - Intergenic
976896204 4:90115385-90115407 TGGCTGGATGGTCAGGGCCTAGG + Intergenic
979758887 4:124374704-124374726 TGGCAGGAGTGTAGGTCCCTGGG + Intergenic
986261551 5:6151951-6151973 TGGCTGGAGGGTCAGGGACTTGG - Intergenic
987305186 5:16630806-16630828 TGGCTGGAGGGTGGGTACTTGGG + Intergenic
989135706 5:38152205-38152227 AGGCTGGTGGGTTCATCCCTTGG - Intergenic
990999162 5:61765691-61765713 TGGCTGGAGAGTCTGTCCAGTGG + Intergenic
995427650 5:112043154-112043176 TGGCTGGATGGTCAGGCACTTGG - Intergenic
997362398 5:133303455-133303477 TGGCTGGAGAGCCAGACCCTGGG - Intronic
1006062426 6:31433784-31433806 TGGCTGGAGGGTCAGGGACTTGG + Intergenic
1006855718 6:37131780-37131802 TGTCCTGAGGGTCCTTCCCTGGG + Intergenic
1007767644 6:44170396-44170418 GGGCTGGAGGGTCTGCTCCTAGG + Intronic
1008441447 6:51536275-51536297 TACCTGGAGGGTCCTTCCCCTGG - Intergenic
1013441780 6:110179179-110179201 TGGCTGCAGGGACCGCCCCGGGG - Intronic
1017718693 6:157229849-157229871 TGCCTGGAGTGTCCTCCCCTAGG - Intergenic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1019287040 7:228863-228885 TGGCTGGAGGGTCCCACGCTGGG + Exonic
1019875658 7:3808323-3808345 CAGATGGAGGGTCGGTCCCTAGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1034969788 7:155411657-155411679 TGGCTGGAGGGGTCAGCCCTTGG - Intergenic
1035119826 7:156557433-156557455 TGACTGCAGGCTCCGCCCCTGGG - Intergenic
1035248091 7:157577980-157578002 CGGCTGGTGGGTCCTGCCCTGGG + Intronic
1035268936 7:157708526-157708548 TGGACGGAGGGGCCGTCCCAGGG + Intronic
1037819131 8:22127318-22127340 TGGCTGGGGGGACAGGCCCTGGG + Exonic
1037879891 8:22567380-22567402 TGGCTGCTGGGTCCTCCCCTGGG - Intronic
1038704582 8:29881635-29881657 TGGCTGGTGGCTCTGTCCCAGGG - Intergenic
1044591543 8:93917581-93917603 TGGATGGAGGGGCTGGCCCTCGG + Intronic
1049387770 8:142353037-142353059 TGGATGGAGGTTCCTTCCATGGG - Intronic
1049747846 8:144270556-144270578 TGGCTGGCGGGCCGGGCCCTCGG - Intronic
1050312376 9:4366705-4366727 TGGCTGGAGGCTCCAGGCCTAGG + Intergenic
1051145532 9:14023420-14023442 TGGCTGGAGTGTGTGTGCCTGGG - Intergenic
1052560184 9:30075450-30075472 TGGTTGAAGTGTCCATCCCTTGG + Intergenic
1057279784 9:93701345-93701367 TGCCTGGAGGGCCCTTCCCCTGG - Intergenic
1192762307 X:74105873-74105895 TGACTGGAAGGTCCCACCCTTGG - Intergenic
1197100256 X:122644944-122644966 TGGCTCAGGGGTCTGTCCCTAGG + Intergenic
1199144375 X:144348405-144348427 TGGCTGGATGGTCAGGGCCTTGG - Intergenic
1199979913 X:152915223-152915245 TGGCTGGTGGGTCAGCCCCAGGG + Intronic