ID: 900528698

View in Genome Browser
Species Human (GRCh38)
Location 1:3142135-3142157
Sequence CCCCGGAAATGGCCCTGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900528698_900528708 2 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528708 1:3142160-3142182 TGGTCTTCCAGGAAGAGGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 248
900528698_900528709 3 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528709 1:3142161-3142183 GGTCTTCCAGGAAGAGGTTGGGG 0: 1
1: 0
2: 0
3: 31
4: 270
900528698_900528713 13 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528713 1:3142171-3142193 GAAGAGGTTGGGGCCAGGGCTGG 0: 1
1: 0
2: 6
3: 86
4: 823
900528698_900528706 -3 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528706 1:3142155-3142177 GGGTCTGGTCTTCCAGGAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 242
900528698_900528704 -9 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528704 1:3142149-3142171 TTTCCGGGGTCTGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 99
900528698_900528707 1 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528707 1:3142159-3142181 CTGGTCTTCCAGGAAGAGGTTGG 0: 1
1: 0
2: 0
3: 25
4: 336
900528698_900528712 9 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528712 1:3142167-3142189 CCAGGAAGAGGTTGGGGCCAGGG 0: 1
1: 1
2: 6
3: 52
4: 524
900528698_900528714 14 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528714 1:3142172-3142194 AAGAGGTTGGGGCCAGGGCTGGG 0: 1
1: 0
2: 5
3: 74
4: 611
900528698_900528715 15 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528715 1:3142173-3142195 AGAGGTTGGGGCCAGGGCTGGGG 0: 1
1: 0
2: 14
3: 120
4: 1059
900528698_900528716 16 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528716 1:3142174-3142196 GAGGTTGGGGCCAGGGCTGGGGG 0: 1
1: 2
2: 22
3: 215
4: 1565
900528698_900528710 8 Left 900528698 1:3142135-3142157 CCCGTCCAGGGCCATTTCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 900528710 1:3142166-3142188 TCCAGGAAGAGGTTGGGGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900528698 Original CRISPR CCCCGGAAATGGCCCTGGAC GGG (reversed) Intronic
900524372 1:3121293-3121315 CCCTGAAAATGGCCCTGGTTTGG + Intronic
900528698 1:3142135-3142157 CCCCGGAAATGGCCCTGGACGGG - Intronic
901231149 1:7642309-7642331 CCCTGGAAATAGCCCTGGAATGG + Intronic
902949415 1:19870230-19870252 CCCCAGAAATGGCCATTGAGTGG - Intergenic
903504658 1:23825075-23825097 CATCGGAAAGGGCCCTGGGCGGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
920177661 1:204113105-204113127 CCCCTGAAATTCCCCTGGGCTGG - Exonic
920184718 1:204152430-204152452 CCCGGGAAATGGCTCTGCAGGGG + Intergenic
920973033 1:210758666-210758688 GCCTGGAAATGGACCTGGAGAGG + Intronic
1065136219 10:22673019-22673041 TCCAGGAAGTGGCCCTGGACAGG - Intronic
1065142078 10:22727813-22727835 ACAGGGAAATGGCCCTGGCCAGG - Intergenic
1066575150 10:36817342-36817364 CACCAGAAATCGCCCTGGAGAGG + Intergenic
1067416604 10:46107357-46107379 CCCCAGAAAAGGCACTGAACAGG - Intergenic
1069750785 10:70743939-70743961 CCTGGGAGATGTCCCTGGACAGG - Intronic
1073461964 10:103670963-103670985 GCCCTGAAATGCCCCTGAACAGG + Intronic
1075714484 10:124548198-124548220 TCACGGAAATGGCTCTGGAGTGG - Intronic
1077235117 11:1478211-1478233 CCCTGGAAATGGCACTGCACAGG + Intronic
1079035849 11:17019422-17019444 GGCTGGAAAGGGCCCTGGACAGG - Intergenic
1080304660 11:30823248-30823270 TCCTGAAAATGTCCCTGGACTGG + Intergenic
1081701135 11:45153494-45153516 CCCAGGAGATGGCCCAAGACTGG - Intronic
1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG + Intronic
1089166658 11:116482777-116482799 CACCAGACATGGCCATGGACTGG + Intergenic
1089750734 11:120649372-120649394 CACCAGAAGTGGCCATGGACAGG + Intronic
1090088332 11:123671245-123671267 CGCTGGAAATTGCCCTGGCCAGG - Intergenic
1091347579 11:134865426-134865448 CACTGGAAATGGCCCTTGAGGGG + Intergenic
1091353094 11:134913396-134913418 CACCAGCAATGTCCCTGGACGGG + Intergenic
1091777058 12:3191420-3191442 CCTATGAAATGGCACTGGACAGG - Intronic
1098901432 12:76115696-76115718 CCTCGGGAATGACCCTGGCCAGG - Intergenic
1102534076 12:113568024-113568046 CCCTGGAAATGACCTTGGGCTGG - Intergenic
1106169367 13:27275703-27275725 CCCTGGAACTGGCCCAGCACAGG + Intergenic
1108224668 13:48275908-48275930 CCCAGATAATGGCCCTGGCCAGG - Intergenic
1113203386 13:107890853-107890875 CCCAGGACATGGCTCTGTACAGG + Intergenic
1119650990 14:76382558-76382580 CCCTGGAAATAGCCATTGACAGG + Intronic
1120053727 14:79898111-79898133 CCAGGGAAATGGCCTTGGAGAGG + Intergenic
1122477149 14:102018351-102018373 CTCCAGACAGGGCCCTGGACAGG + Intronic
1123137086 14:106038056-106038078 CCCCAGGAAAGGCCCTGGAGTGG - Intergenic
1126584724 15:50272627-50272649 CCCCCAAAATGGCCATGAACTGG + Intergenic
1128460227 15:67861364-67861386 CCCCAGAAGTGTCCCTGGCCTGG - Intergenic
1128557401 15:68641197-68641219 CCCCGGGGATGGGCCTGGGCAGG - Intronic
1128999115 15:72318716-72318738 CCCTGAGAATGGGCCTGGACTGG + Intronic
1132674637 16:1116642-1116664 GCCTGGAAATGGACCTGGAGGGG + Intergenic
1133231002 16:4366436-4366458 CCCCTCAAAAGGCCCTGGAGTGG - Intronic
1134062556 16:11207926-11207948 CCCCAGAAAGAGTCCTGGACAGG - Intergenic
1136028459 16:27485296-27485318 GCCTGGAAGGGGCCCTGGACTGG + Intronic
1139201377 16:64980915-64980937 CCCTGGAATTTCCCCTGGACCGG - Intronic
1140040335 16:71403248-71403270 CCCAGCAATTGGCCCAGGACAGG + Intergenic
1141700203 16:85638867-85638889 CCCCGTCAATGGCTCTGGGCCGG + Intronic
1144202822 17:12956550-12956572 CCCAGGAAGGGGCCCTGGACTGG - Intronic
1144775736 17:17783708-17783730 CCCCGGATCTGGTCCTGGCCGGG + Intronic
1146682250 17:34816586-34816608 CTACGCACATGGCCCTGGACGGG + Intergenic
1148743906 17:49907955-49907977 CCCCAGAAAGAGCACTGGACTGG + Intergenic
1152032332 17:77851676-77851698 CCCCTGAAATGGGCTTGAACAGG + Intergenic
1153724164 18:7937918-7937940 TCCCTGAAATGGACCAGGACAGG - Intronic
1157369656 18:47099211-47099233 CACCAGAAATGGAGCTGGACAGG - Intronic
1161777654 19:6272487-6272509 TACCAGAAAGGGCCCTGGACAGG - Intronic
1161977772 19:7615743-7615765 CCCCGGAAAGGGCACTGGGCAGG - Intronic
1162788463 19:13050952-13050974 CCTTGGAGATGGCCCTGGGCAGG + Intronic
1163577016 19:18116953-18116975 CCCCAGCATTGGGCCTGGACTGG + Intronic
1165303779 19:34990506-34990528 GGCAGGAAATGGCCTTGGACTGG + Intergenic
1168688429 19:58362507-58362529 GCCCGGAAGTGGCCCTGCACGGG - Intronic
926118764 2:10229619-10229641 CTCCAGCAATGGCCCTGGCCAGG - Intergenic
927685840 2:25169727-25169749 ACTGGGAAATGGCCCTGGAAAGG - Intergenic
930003917 2:46881287-46881309 CCCTGGAAAGAGCCCTGGAGTGG - Intergenic
932492944 2:72133058-72133080 CGCCGGAAATGGGCGTGAACAGG + Exonic
932572497 2:72945435-72945457 TCCAGGGAATGGCCCTGGGCAGG - Intronic
933451697 2:82461408-82461430 CCCCTGAAATGGCGATGGAAAGG - Intergenic
936286655 2:111186529-111186551 CCCTGGAAATGGAACTGAACAGG - Intergenic
938386790 2:130872458-130872480 TCCCGGAAAGGGGCCTGGGCAGG - Intronic
942064629 2:172258953-172258975 CCCTGGGAATGGCCCTTTACTGG - Intergenic
947587423 2:231365099-231365121 GCCAGGAAATGGCGCTGGTCTGG + Intronic
947822343 2:233080904-233080926 CGCAGCAAATGCCCCTGGACCGG - Intronic
948387553 2:237591099-237591121 CCCAGGATCTGACCCTGGACTGG - Intronic
1168769894 20:408271-408293 CCCCGGAAGTGGGGCGGGACTGG - Exonic
1173896488 20:46554899-46554921 CCCGGGAGGTGGACCTGGACAGG + Intergenic
1173916645 20:46712994-46713016 GCCTGGAAGTGGCCATGGACAGG - Intronic
1174363908 20:50044718-50044740 CCCAGGAAATGGCAGTGGAGAGG - Intergenic
1175816277 20:61884720-61884742 CCCGGGAAATTCACCTGGACAGG + Intronic
1175940823 20:62536821-62536843 CCCAGGAGATGGCCCTGGGCCGG - Intergenic
1178710249 21:34910675-34910697 CCCTGGACATGGTCCTGGCCTGG - Intronic
1179149243 21:38796022-38796044 ACCCGGAAGTGACCCTGGGCCGG + Intergenic
1180943999 22:19679728-19679750 CCCCGGACCAGGCCCTGGCCCGG + Intergenic
1181750294 22:24984449-24984471 CACGGGAAATAGCCCAGGACAGG + Intronic
1181882244 22:25990272-25990294 CCCCAGAAAGAGCACTGGACTGG + Intronic
1181950451 22:26550112-26550134 ACCCTGAAATGTCCCTGGAAGGG + Intronic
1183406701 22:37633708-37633730 CACCGGAAAAGGCCCTGCAAAGG + Intergenic
1183605414 22:38864793-38864815 CCCGGGAAGTGGCCCAGGGCTGG + Exonic
1184035365 22:41915384-41915406 GCCCGGAATTGCCCCGGGACGGG + Intergenic
1184727388 22:46354935-46354957 CCCCAGGACTGGCCCTGGTCTGG - Intronic
950021724 3:9792464-9792486 CCCCGGAACTGGCTATGGGCGGG + Exonic
950461014 3:13122273-13122295 CCCCTGCAAAGGCCCGGGACAGG + Intergenic
950634964 3:14308058-14308080 ACCTAGAAAGGGCCCTGGACTGG - Intergenic
950791240 3:15474079-15474101 CACCTGAAATGGCTGTGGACAGG + Intronic
952660398 3:35839672-35839694 CACCAGAAATGGCCATGGCCCGG + Intergenic
954675632 3:52313957-52313979 CCCTAGAAAGGGCTCTGGACGGG - Intergenic
955496924 3:59543020-59543042 ACCAGGAAATGGCTCTGGAATGG - Intergenic
957287186 3:78231734-78231756 CACTGGAACTGGCCTTGGACTGG - Intergenic
960084207 3:113573311-113573333 CTCAGGAGATGGCCCTGGGCTGG + Intronic
960939388 3:122923482-122923504 CCCCAGAGATGGGCATGGACTGG + Intronic
962230559 3:133661911-133661933 ACCCGGAAATTGCCCAGAACGGG + Intergenic
968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG + Intergenic
976125426 4:81829151-81829173 CCCAGGAAATTGCCCTTGGCTGG - Intronic
978105338 4:104895460-104895482 CCCCAGAGGTGGCCCTGGTCTGG - Intergenic
984590036 4:181606879-181606901 TCCCGCAAATGGCCCTGGGCTGG - Intergenic
984964595 4:185128799-185128821 CCCCAGAAATGGGCCTGGCAGGG + Intergenic
985128969 4:186723408-186723430 CCCCAGCAATGGCCCCGGATCGG + Intronic
986782518 5:11079635-11079657 CCAGGGAAAAGGCCCTGGAGAGG - Intronic
991753831 5:69844338-69844360 ACCCGGAAGTCGCGCTGGACCGG - Intergenic
991803448 5:70401065-70401087 ACCCGGAAGTCGCGCTGGACCGG - Intergenic
997870853 5:137504144-137504166 CAAAGGAAATGGCCCTAGACAGG - Intronic
1006168656 6:32080742-32080764 CCAGGGGAATGGCACTGGACAGG + Intronic
1007412945 6:41675316-41675338 CCCTGGAAAGGGACCTGGACAGG - Intergenic
1007820903 6:44559899-44559921 CCCCGGATCTGGCCATAGACTGG + Intergenic
1014696179 6:124623911-124623933 CCCCAGAAATGGATCTTGACTGG + Intronic
1015916627 6:138224116-138224138 CCCTGGAAATGGTCCTGCAGAGG + Intronic
1019191122 6:170251560-170251582 CCCCTGCAATGCCCCTGGGCAGG + Intergenic
1019432814 7:1007304-1007326 CCCCTGCAGAGGCCCTGGACTGG - Intronic
1028655455 7:93200890-93200912 GGCCGGAACTAGCCCTGGACAGG + Intronic
1032094643 7:128931981-128932003 CCCTAGCAACGGCCCTGGACAGG + Intergenic
1033439063 7:141362269-141362291 CCCAGCAAATGGCCCTGGTGGGG - Intronic
1034344732 7:150379307-150379329 CCCCGGGAATGGCCAGGGCCGGG + Intronic
1035292677 7:157849669-157849691 TCCCGTAAATGTCCCTGGCCAGG - Intronic
1041564413 8:59260859-59260881 CCCAGGAAATGGCCCAAGGCTGG + Intergenic
1041727756 8:61033610-61033632 CCCGGGGAATTGCCCTCGACTGG + Intergenic
1044546416 8:93465329-93465351 CCCAGGAACTGTCCCTAGACAGG - Intergenic
1048934559 8:139344183-139344205 CCTGGGAAAGGGCCCTAGACCGG + Intergenic
1049232098 8:141489769-141489791 CCCAGGAGGTGGCCCAGGACAGG - Intergenic
1049470982 8:142774895-142774917 CCCCATAAATAGCCCTGGACAGG + Intronic
1049593963 8:143475059-143475081 CCCCAGGAAGGGCCCTGGAGTGG - Intronic
1056487416 9:87072959-87072981 CCCAGCAACTGGCCCTGGTCGGG + Intergenic
1061817822 9:133206991-133207013 CCCCAGAAGTGGCCCTTGGCAGG + Intronic
1062002535 9:134223951-134223973 CCCCGGACATGGCCTTGGCCTGG + Intergenic
1193476114 X:81967966-81967988 CCAAGGAGATGGCCCTGGAAAGG - Intergenic
1196562942 X:117172933-117172955 CCCCAGACAAGGCCCTGGGCTGG - Intergenic