ID: 900534227

View in Genome Browser
Species Human (GRCh38)
Location 1:3169130-3169152
Sequence CTGAGGCTCAGAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900534227_900534231 -2 Left 900534227 1:3169130-3169152 CCTGGACACTTTCTGAGCCTCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 900534231 1:3169151-3169173 AGCTGGCCCTGATGCTAAATGGG 0: 1
1: 0
2: 0
3: 2
4: 87
900534227_900534236 18 Left 900534227 1:3169130-3169152 CCTGGACACTTTCTGAGCCTCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 900534236 1:3169171-3169193 GGGCCCATGGAGGTATTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 147
900534227_900534234 5 Left 900534227 1:3169130-3169152 CCTGGACACTTTCTGAGCCTCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 900534234 1:3169158-3169180 CCTGATGCTAAATGGGCCCATGG 0: 1
1: 0
2: 1
3: 9
4: 143
900534227_900534235 8 Left 900534227 1:3169130-3169152 CCTGGACACTTTCTGAGCCTCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 900534235 1:3169161-3169183 GATGCTAAATGGGCCCATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 70
900534227_900534230 -3 Left 900534227 1:3169130-3169152 CCTGGACACTTTCTGAGCCTCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 900534230 1:3169150-3169172 CAGCTGGCCCTGATGCTAAATGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900534227 Original CRISPR CTGAGGCTCAGAAAGTGTCC AGG (reversed) Intronic
900531849 1:3157792-3157814 CTGAGGCTGGGGATGTGTCCAGG + Intronic
900534227 1:3169130-3169152 CTGAGGCTCAGAAAGTGTCCAGG - Intronic
901924435 1:12556925-12556947 CTGAGGCCCAGAGAGCTTCCGGG - Intergenic
902249675 1:15146086-15146108 AGGAGGCTCAGAAAGTGCCAAGG + Intergenic
902595368 1:17506033-17506055 ATGAGGCTCAGAGAGTGTAAGGG + Intergenic
902922546 1:19675429-19675451 CTGAGGCTCAGAAAGGGTAGAGG - Intronic
903342037 1:22660713-22660735 CTGAGGCTCAGAGAGAGGCAGGG + Intronic
903440001 1:23380569-23380591 CTGAGCCTCAGAACCTGCCCAGG - Intergenic
904273011 1:29362736-29362758 CTGAGGCTCAGGGAGGGTCATGG - Intergenic
904541084 1:31233875-31233897 CAGAGGCTCAGAGAGGGTGCAGG + Intronic
904623086 1:31787288-31787310 CTGAGGCTCAGAAAGGGCAAGGG + Intergenic
904705160 1:32384414-32384436 CTGAGGTTCAGAAAGGGTTTCGG - Intronic
904774867 1:32900653-32900675 CTGAGGCTCACAAGGTCTCTCGG + Intronic
905474821 1:38218643-38218665 CTGAGGCTCAGAGAGGGTCAAGG - Intergenic
905538710 1:38743535-38743557 CTGAGGCTCAGAGAGAGAACTGG + Intergenic
905793099 1:40800669-40800691 CTGATGCTCAGACAGTATCTGGG - Intronic
906143025 1:43544947-43544969 CTGGGGGTCAGAAAGCGTCAGGG + Intronic
906829937 1:49020559-49020581 CTGAGGGCCTGAAAGTGTTCAGG - Intronic
907441991 1:54484669-54484691 CTTAGGGTCAGAAACTGTCCAGG - Intergenic
907659581 1:56379518-56379540 CTGTTGTTCAGCAAGTGTCCAGG + Intergenic
907924109 1:58940057-58940079 CTGGGGCTCTGACAGAGTCCTGG - Intergenic
908071171 1:60462015-60462037 CTGAGGCTTGGAAAGTCTCTTGG - Intergenic
908561112 1:65308116-65308138 TTGGGTCTCAGAAAGTTTCCGGG - Intronic
912419201 1:109531980-109532002 CTGAGCCTCTGAAGCTGTCCGGG + Intergenic
915366605 1:155320425-155320447 AGGAGGCTGAGAAAGTGGCCCGG + Exonic
915444598 1:155967527-155967549 CTGAGGCCCAGCCAGAGTCCAGG - Intronic
915593648 1:156884291-156884313 CAGGGGCTCAGAAAGGGTCGTGG + Intergenic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
917410014 1:174749765-174749787 TTCAGGATCAGAAAGTGACCTGG + Intronic
922143531 1:222915081-222915103 CAGCGACTCAGACAGTGTCCAGG - Intronic
922238989 1:223743188-223743210 CTGAGGCTCAGAGAGGGACCAGG + Intronic
922390894 1:225139871-225139893 CTGAGGGTTAGAAAGTGGGCAGG - Intronic
924006276 1:239615173-239615195 CTGGGACATAGAAAGTGTCCAGG - Intronic
924129485 1:240890739-240890761 CTGAGGCACAGAGAGTTTACAGG + Intronic
924249606 1:242118202-242118224 CAGAGGCTCAAAAAGTGTAAGGG - Intronic
924263405 1:242254697-242254719 CTGAGGCTCAGAGAAAGTGCCGG + Intronic
924795831 1:247291609-247291631 CAGAGGCTCAGGCAGGGTCCAGG - Intergenic
924811842 1:247409888-247409910 CTGTGTCTCAGAAAGTGTAGAGG + Intergenic
1066477361 10:35760967-35760989 CTAAAGATCAGAAAATGTCCAGG + Intergenic
1066721390 10:38343775-38343797 CTGAGGCTCAGAGAAAGTGCCGG - Intergenic
1067546065 10:47193427-47193449 CTGAGTCTCAGTGACTGTCCTGG + Intergenic
1069567513 10:69473633-69473655 CTGAGGCTCAGAAAAGGTAAGGG + Intronic
1069761484 10:70814679-70814701 TTGAGGGTCAGAAAATGTTCTGG - Intergenic
1070746075 10:78934790-78934812 CTGAGGCCCAGAGAGGGGCCAGG - Intergenic
1070805857 10:79270304-79270326 CTGAGGATCAGAAGGGGACCAGG - Intronic
1072481722 10:95815556-95815578 CTGAGGCTCATACAGTGTCTGGG - Intronic
1072617078 10:97057049-97057071 CTAGGGCTGAGAAAGTCTCCAGG - Intronic
1073099490 10:100999422-100999444 CTGAGGCTGAGAGCGTGTCAGGG + Intronic
1073668960 10:105565658-105565680 CTGAGGCTTAGAAAGTTTAAGGG - Intergenic
1075411823 10:122233970-122233992 CTGGTGCTCAGAGGGTGTCCAGG - Intronic
1075452658 10:122562878-122562900 CTGAGGCTCAGAAAGGTTATTGG + Intronic
1075696843 10:124442493-124442515 CAGAGGCTGAGGAACTGTCCTGG + Intergenic
1076509650 10:131003641-131003663 CTGAGGCAAAGAATGTTTCCTGG + Intergenic
1076612943 10:131737762-131737784 CTGAGACTCAGAGAGTCGCCCGG - Intergenic
1077178689 11:1202815-1202837 CTGAGCCCCAGAAAGTCACCAGG - Intergenic
1077182331 11:1222387-1222409 CTGAGGCCCAGAGTGTCTCCTGG - Intergenic
1077317581 11:1926219-1926241 CTGAGGCTCAGAGGATGGCCGGG - Intronic
1077461700 11:2714081-2714103 GAGAGGCTCGGAAAGAGTCCTGG - Intronic
1078685587 11:13527918-13527940 TTGAGGCTCAGAAAGTTTAGAGG - Intergenic
1079710707 11:23679916-23679938 CTGAGGCCCATAAAATCTCCAGG - Intergenic
1079912362 11:26326813-26326835 CTGATACTCAGCAAGTATCCTGG - Intronic
1081772866 11:45660505-45660527 CTGAGAATCAGAAAGTGTTAAGG - Intronic
1081786267 11:45750003-45750025 CAGAGACCCAGAAAGGGTCCAGG - Intergenic
1083109768 11:60394302-60394324 CTGTTTCTCAGAGAGTGTCCAGG - Exonic
1083222039 11:61258885-61258907 CTGGGGCCCAGATAGTGTCCAGG - Exonic
1083614298 11:64018758-64018780 CTGAGGCTCACAGAGTACCCGGG + Intronic
1083620864 11:64048785-64048807 CTGGGGCTCAGAATGGGTTCTGG - Intronic
1084785899 11:71441526-71441548 CAGAGGCCCAGAAAGTGACCAGG - Intronic
1085127823 11:74013802-74013824 CAGAGGCACAGAAAGAGTCAGGG - Intronic
1085705876 11:78786525-78786547 CTGAGGCTCAGAAAGTTGACGGG + Intronic
1088395621 11:109364921-109364943 CTGAGGCTCAGAGAGTTGCTAGG + Intergenic
1088659245 11:112029142-112029164 CTGAGGCTGAGAAAGGTTACAGG - Intronic
1089632560 11:119792881-119792903 CTGAGGCTCAGAAAGATACCTGG + Intergenic
1090660630 11:128879422-128879444 CGCAGGCTCAGAAAGAGTGCAGG - Intergenic
1090854203 11:130598019-130598041 CAGAAGCTCAGAAAGTGACCAGG + Intergenic
1091806573 12:3361277-3361299 CAGAGGCTCAGGAAATGTTCGGG - Intergenic
1092134648 12:6138200-6138222 CTGAGGCTCAGACAGGGTAAGGG + Intergenic
1092527438 12:9317756-9317778 CTGAGGCACAGAAAGAGATCTGG - Intergenic
1095514487 12:42991010-42991032 CTGAGGCTCAGAGAGTTTGAGGG + Intergenic
1096090724 12:48898845-48898867 CTGAGGATCCCAAAGTGGCCAGG - Intergenic
1096238943 12:49949210-49949232 CTGAGGCGCAGAATGTGGCTCGG + Intergenic
1096363078 12:51005081-51005103 CTGAGGCTCAGAAAGGTACAAGG - Intronic
1097247682 12:57615544-57615566 CGGTGACCCAGAAAGTGTCCTGG - Exonic
1098159956 12:67640478-67640500 CTGAGCCTCAGAAAATGAGCAGG - Intergenic
1100566397 12:95798293-95798315 TTTAGGATCGGAAAGTGTCCAGG - Intergenic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1101718763 12:107333221-107333243 CTTAGGGTCAGAAGGTGGCCTGG + Intronic
1102461403 12:113101918-113101940 CTGAGGCCCAGACAGTGTATCGG - Exonic
1102463270 12:113113334-113113356 CTGAGGCTCAGAGAGGTTACTGG + Intronic
1102984881 12:117269939-117269961 CTGAGGCTCAGAGAGGTGCCTGG + Intronic
1103087089 12:118069845-118069867 CTAAGGCTCAGAAAGGGTCAGGG + Intronic
1103189957 12:118992790-118992812 CTGAGGCACAGAAAGAGCACAGG + Intronic
1104852455 12:131883704-131883726 CTGAGGCTCAGAAAATCTTTTGG + Intergenic
1105779109 13:23690850-23690872 CTGTGGCTCAGCTGGTGTCCAGG + Intergenic
1106863681 13:33939388-33939410 GTGAGGCTCAGAGAGCTTCCAGG + Intronic
1107306849 13:39030912-39030934 ATGAGCCTAAGAAAGTGTCTGGG - Intronic
1111455698 13:88481033-88481055 CTGAGCCTCAGAAAGTCTCTTGG + Intergenic
1112415981 13:99203797-99203819 CTGAGGCTCAGATGGTGTGAAGG + Intronic
1113075320 13:106462311-106462333 CTGAGACTCTGGAAGTCTCCGGG - Intergenic
1113271146 13:108675892-108675914 ATGAGGTGCAGAAAGTGCCCTGG - Intronic
1113422427 13:110180920-110180942 CTGAGGCTGAGAAACCATCCTGG + Intronic
1114381826 14:22213846-22213868 CTGAGGATCATAAAAGGTCCTGG - Intergenic
1119110905 14:71972895-71972917 GTGATTCTCAGAAAGTCTCCTGG + Intronic
1119203254 14:72774705-72774727 AATACGCTCAGAAAGTGTCCTGG + Intronic
1119328613 14:73777312-73777334 ATGAGGCTCAGAAATTGATCAGG - Intronic
1119919735 14:78435398-78435420 CTGAGTCTCAGAAAGCTTCAGGG + Intronic
1121338541 14:93091747-93091769 CTGAAGCTCAGACAGGCTCCAGG + Intronic
1121493490 14:94376594-94376616 CTGAGGCTCAGAGAGGCTACTGG - Intergenic
1124382003 15:29175075-29175097 CTGAAGCTAAGCTAGTGTCCCGG + Intronic
1124451349 15:29794403-29794425 CTGAGGCACAGAAAGAAGCCAGG + Intronic
1124641091 15:31397191-31397213 CTGAGGCCAAGAGGGTGTCCAGG + Intronic
1124991807 15:34681782-34681804 TTGAGGTTCAGAAAGTATGCTGG - Intergenic
1126421285 15:48475791-48475813 CTGAAGCTCTGAAATGGTCCTGG + Intronic
1126435568 15:48633929-48633951 CTGAGGCCCAGAGAAGGTCCAGG - Intronic
1128208894 15:65878244-65878266 CAGAGGCTCAGGGAGTGTCAGGG + Intronic
1128222445 15:65978882-65978904 CTGAGGCTCAGAGAGGGTAAGGG - Intronic
1128694070 15:69747330-69747352 CTGAGGCTCAGCAATGGTCCTGG + Intergenic
1129113934 15:73354434-73354456 CTGCAGCTCAGAAAGTCCCCAGG - Intronic
1129342426 15:74894888-74894910 CTGAGGGCCAAAATGTGTCCTGG - Intronic
1129886657 15:79042737-79042759 CTGAGGATCAGAAAGCATGCAGG + Intronic
1130136823 15:81188488-81188510 CTGATGCTCAGAAAGAGGACTGG + Intronic
1130692544 15:86096247-86096269 CTGAGGCTCAGAGACTGCACAGG - Intergenic
1131165052 15:90136164-90136186 ATCAGGCTCAGCAAGTTTCCTGG + Intergenic
1131469868 15:92687478-92687500 CTGAGGCCCAGAAATTGACTTGG + Intronic
1132477038 16:144965-144987 CTGAGGCGATGAAAATGTCCTGG - Intergenic
1132662827 16:1069213-1069235 CTGAGGCTCAGAGAGGGTAAAGG - Intergenic
1132715056 16:1286009-1286031 CTGGGGGTCACAGAGTGTCCTGG - Intergenic
1133020924 16:2966674-2966696 CTGTGGCTCTGAAAGCGACCTGG + Exonic
1133368722 16:5231737-5231759 ATGAGGCTCAAAAAGAGACCAGG - Intergenic
1133411405 16:5572217-5572239 CTGTGGCTCAGAAGCTCTCCAGG + Intergenic
1133915000 16:10101488-10101510 CTGTTGCTCAGAAAGCTTCCTGG - Intronic
1134028072 16:10969817-10969839 CTGAGGTTCAGAAAGGGACTGGG - Intronic
1137603897 16:49774554-49774576 CTGAGGCTCAGAATGCGTAGAGG - Intronic
1137880027 16:52036279-52036301 TTGAGGCACAGAACTTGTCCAGG - Intronic
1138381195 16:56603840-56603862 CTGTGGCTCAGGATGTCTCCTGG - Intergenic
1138488516 16:57362288-57362310 CAGAGTCTCAGTAAGTTTCCAGG - Intronic
1139633544 16:68244918-68244940 CTGAGGCCCAAGAACTGTCCGGG + Intergenic
1140716776 16:77733785-77733807 CTCAGGCTCAGCAAGAGTCCTGG - Intronic
1141778313 16:86139157-86139179 CTGAGGCACAGAGTGTGTCCTGG - Intergenic
1142141508 16:88474712-88474734 CGGAGGCTCGGACAGTGTTCAGG - Intronic
1142676379 17:1516226-1516248 CTGGGGCGCAGCAGGTGTCCCGG - Intronic
1142794178 17:2294468-2294490 CTGAGGTACAGAAAGTGACCGGG - Intronic
1142957033 17:3529330-3529352 CTGAGGCCCAGAGAGGGTCAGGG - Intronic
1144267262 17:13582889-13582911 CTGAGTCTCAGGAACTGTGCAGG - Intronic
1144829776 17:18124661-18124683 CTGAGGCTCTGAAAATGTCCTGG - Intronic
1147776506 17:42905744-42905766 CTAAGGCTCAGAAAGTAGGCCGG + Intronic
1147867456 17:43562575-43562597 CTGAGGCATAGAAAGGTTCCAGG - Intronic
1148192324 17:45688222-45688244 CTGAGGCCCAGACAGGCTCCAGG + Intergenic
1150677048 17:67253152-67253174 CTGAGTCTCAGTATGTCTCCCGG - Intergenic
1153235669 18:2984730-2984752 CTGAGGCCCAGAAAGAGGTCAGG + Intronic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1157168445 18:45380110-45380132 CAGAGGCCCAGAAAGTGTTGTGG - Intronic
1157300320 18:46474388-46474410 CTGTGGGTAAGAAAGTGCCCCGG + Intergenic
1157313287 18:46568389-46568411 TTGAGGCTGAGAAAGGGTTCAGG - Intronic
1158152817 18:54391514-54391536 ATGAGGCTGAGAAAGTGGCTTGG + Intergenic
1158287642 18:55902305-55902327 CTGAGTCTCAGAAAGTTTAAGGG + Intergenic
1159844286 18:73440143-73440165 CTGAGGCTCTGGCAGTGACCTGG + Intergenic
1160372705 18:78388113-78388135 CTGAGACTCAGAAAGGCCCCAGG + Intergenic
1161232277 19:3180239-3180261 CTGAGGCCCAGAGAGGGGCCGGG - Exonic
1161444054 19:4308107-4308129 CTGATACCAAGAAAGTGTCCAGG + Intronic
1161462108 19:4403554-4403576 CTGAGGCTGAGAAACTGGACTGG - Intronic
1162154002 19:8664461-8664483 CTGAGGCTCAGGAGGTGCCGGGG + Intergenic
1162180141 19:8863096-8863118 CTGAGGCTCAGAAAGGGGCGTGG - Intronic
1163172067 19:15538322-15538344 CTGAGCCTCAGAAAGTGGGGAGG - Intronic
1163270112 19:16247963-16247985 CTGAGGCTCAGAAAGGCCACAGG + Intergenic
1163462541 19:17447868-17447890 CTGAGGCTCAAAGAGGGTCCAGG - Intronic
1163548191 19:17951440-17951462 CTGAGGCTCAGAAAGGGGCTTGG + Intronic
1163721304 19:18899453-18899475 CTGACGCTCAGGGAGAGTCCTGG - Intergenic
1164703525 19:30303149-30303171 CTGAGGCTCGGCTGGTGTCCAGG + Intronic
1165326593 19:35117701-35117723 CTGAGGCCCAGGAAGTGTTTAGG - Intronic
1165614225 19:37184569-37184591 GTGGGGCTCAGAGAGAGTCCTGG + Exonic
1166427665 19:42693894-42693916 CTAAGGATCAGAAAGGGGCCAGG - Intronic
1168585021 19:57584824-57584846 CTGAGGCTCAGAAATAATGCAGG + Intronic
1168646665 19:58063385-58063407 CTGAGGCTCAGGAAGGGTCCTGG + Intronic
925134531 2:1516860-1516882 CTGGGGCACAGAAAGAGGCCTGG - Intronic
925188551 2:1865454-1865476 CTAAGGCTCAGAAAGGTTCAGGG - Intronic
926206662 2:10838674-10838696 CAGTGGCTCAGAAAGTGCCGGGG + Intergenic
929950467 2:46406077-46406099 CTGAGGCTCAGAGAGGGCTCTGG - Intergenic
930711739 2:54556840-54556862 CTGAGGTTTAGAAAGAATCCAGG + Intronic
931221744 2:60294988-60295010 CGGAGGCCCAGAGAGTGTGCAGG - Intergenic
931258891 2:60599594-60599616 CTGAGAAGCAGAAAGTTTCCTGG + Intergenic
932066233 2:68564675-68564697 CTGAAGCTCAGACAGCGTGCAGG + Intronic
932220863 2:69997992-69998014 CTGAGGCATAGAAAGTCTCAGGG + Intergenic
932770934 2:74500435-74500457 CAGAGGCTCAGAAACTGCCAAGG + Intronic
934696503 2:96404412-96404434 CTGAGGCTCACAAAAAGCCCTGG - Intergenic
934921881 2:98350643-98350665 CTCATGCCTAGAAAGTGTCCTGG - Intronic
936880663 2:117246647-117246669 CTGACTCTCAGAAATTGGCCAGG + Intergenic
938379029 2:130826320-130826342 GTGAGGCTCAGAAAGTGAGCAGG - Intergenic
938730066 2:134140425-134140447 CAGAGGCTCACAAAGTGGCAGGG - Intronic
938796828 2:134724643-134724665 CTTAGGCTCAGAAAGGGTATGGG - Intergenic
940906066 2:159171071-159171093 GTGAGGCTGATCAAGTGTCCTGG + Intronic
942750676 2:179283301-179283323 CTGACCCAGAGAAAGTGTCCTGG + Intergenic
945848239 2:214973948-214973970 CTCCTGCTCAGAAAATGTCCAGG - Exonic
945859397 2:215103580-215103602 CTGAGGCTCAGAAATTTTGAGGG - Intronic
947137830 2:226992872-226992894 CAGAGGCTCAGAAGGTGTTAGGG - Intronic
947362129 2:229356657-229356679 CGGAGGCTCAGACAATGTCCAGG + Intergenic
947588035 2:231369128-231369150 CTGAGGCTCCCAAGGTGTCAGGG + Intronic
948003768 2:234590621-234590643 CTGAGGGTCACAGAGTGGCCTGG + Intergenic
948930460 2:241128581-241128603 CAGAGGCTCAGAAAGAGGACAGG + Intronic
1168993384 20:2113874-2113896 CTGAGGCTCAGAGAGCTTCAGGG + Intronic
1170218913 20:13920273-13920295 CTAAGTCTTAGAAAGGGTCCTGG - Intronic
1171416411 20:24984052-24984074 CTGAGTCTCAGACAGTGACAAGG + Intronic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1172177980 20:32984203-32984225 CTGAGGCCCAGAAAGGGTGGAGG - Intronic
1172774642 20:37399962-37399984 CTGAGGCTCAGAAAGGGCCCAGG + Intronic
1172809687 20:37638347-37638369 CTGAGGCTCAGAGAGATTCGAGG - Intergenic
1172883687 20:38217568-38217590 CTGAAGCTCAGGAAGTCTCCTGG - Intronic
1173847938 20:46199764-46199786 CTGAGGCTCAGAAAGGTTGAGGG - Intronic
1173977574 20:47198545-47198567 CTGAGACTCAGGAGGTGTCGTGG + Intergenic
1174281666 20:49444306-49444328 CAGGGGCTCCTAAAGTGTCCTGG + Intronic
1174367169 20:50063661-50063683 CTGAGGCTCAGAGACTGGACAGG + Intergenic
1174519631 20:51119522-51119544 CTGGGTCTCAGAATCTGTCCTGG + Intergenic
1175053752 20:56178903-56178925 CTCAGGCTCAGAGAGACTCCTGG + Intergenic
1176305776 21:5122381-5122403 CAGAGGCTCAGACAGTTTACCGG + Intronic
1179035968 21:37759066-37759088 CTGAGCCTCAGATAGGGGCCAGG - Intronic
1179323772 21:40319352-40319374 CTTAGTTTCAGAAAGTGTCAAGG + Intronic
1179851281 21:44139650-44139672 CAGAGGCTCAGACAGTTTACCGG - Intronic
1180096403 21:45557247-45557269 CTGGGGCTCAGACAGCGGCCCGG + Intergenic
1180701152 22:17782072-17782094 CTGTGGCTCAGAATGGGTGCTGG + Intergenic
1181031144 22:20149357-20149379 CAGGGTCTCAGAAGGTGTCCTGG - Intronic
1181182864 22:21079523-21079545 CTGAGGCTGAGAGTGTGTCATGG - Intergenic
1181851322 22:25751973-25751995 CTGAGGCTCAGAGAGCTCCCTGG + Intronic
1182008551 22:26981582-26981604 CAGAGGCTCTGAAAGTCTCTGGG + Intergenic
1182428594 22:30287604-30287626 CTGAGGCTCAGAGAGGGGCAGGG - Intronic
1183575019 22:38682420-38682442 TTGTGGCTCAGAAAATGTACAGG + Exonic
1183601467 22:38842979-38843001 CTGAGGCTCAGAGAGGTGCCTGG + Intronic
949868475 3:8566984-8567006 CTGAGGCTCAGGAAGTGCAGAGG - Intronic
950560626 3:13719541-13719563 CTGAGGCTCAGAAAGGGTGGAGG + Intergenic
951849707 3:27125716-27125738 CTGGGGCTTAGAAAGTGTGGTGG - Intronic
952271290 3:31834493-31834515 CTGATGCTCAGAGCCTGTCCAGG + Intronic
952859571 3:37801832-37801854 CTGAGGCTCAGAAACTGTGGTGG + Intronic
952932002 3:38367758-38367780 CTGACGCCCTGAGAGTGTCCTGG + Intronic
953385151 3:42502130-42502152 CTGGGGCCCAGCAAGTGTCCAGG - Intronic
953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG + Intronic
954448687 3:50560206-50560228 CTTGGGCTCAGAAAGAATCCAGG - Intronic
954582312 3:51709567-51709589 CAGAAGCTAAGAAAGTGCCCTGG + Intronic
960018974 3:112927634-112927656 CTGAGGCAATGAGAGTGTCCAGG + Intronic
961568946 3:127784683-127784705 CTGAAGATCAGAATGAGTCCAGG - Intronic
962149070 3:132873463-132873485 CTCAGGCTCAGATAGCCTCCTGG - Intergenic
963812320 3:149790174-149790196 CTTAGACTCAGAAAATCTCCAGG + Intronic
964435437 3:156646672-156646694 CTAAGGCTCAGAGAGTAACCTGG - Intergenic
964573222 3:158135207-158135229 GTGAGGCTCAGAATGTGTTTTGG + Intronic
966882170 3:184356694-184356716 CTGAGGCTCAAACACTCTCCAGG + Intronic
968915412 4:3495102-3495124 CTGAGGCTCAGAGAGGGGCGGGG - Intronic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
969429921 4:7148125-7148147 CTGAGGCTCAGAAGGTTTAAGGG + Intergenic
969475500 4:7420436-7420458 CTGAGACTCAGAGAGTGTCCAGG + Intronic
969569618 4:8000958-8000980 CTGTGGCTCACACAGCGTCCGGG + Intronic
969618602 4:8267840-8267862 CTGAGTCTCTGAGAGAGTCCAGG - Intergenic
969710146 4:8838490-8838512 CTGAGGCTCTGACAGTGTCTCGG - Intergenic
970313829 4:14810304-14810326 TTGACACTCAGAAAGTGTCATGG - Intergenic
970490800 4:16571623-16571645 CTGAGGCTCAGAAAGGTCCTGGG - Intronic
972346680 4:38198249-38198271 GTCAGGCCCAGACAGTGTCCAGG - Intergenic
972928940 4:44047498-44047520 GTGTGGCTCTGAAAGTGTCTTGG - Intergenic
978197486 4:105988155-105988177 CTGAGGCTCAGAAATAACCCAGG - Intronic
978267236 4:106840943-106840965 CTGAGGCACAGAAAGTTGGCAGG + Intergenic
979960404 4:127013400-127013422 CTTATGCTCAGAATATGTCCTGG - Intergenic
980867997 4:138576383-138576405 CTGAGGCTGAGAAAATTTCTAGG + Intergenic
981338742 4:143595918-143595940 TTGAGGCTCAGAAGGAGTCCTGG + Intronic
984024971 4:174531963-174531985 CAGAAGCACAGAAACTGTCCAGG + Intergenic
985420163 4:189777303-189777325 ATTAGGCTCAAAAAGTATCCTGG + Intergenic
989426217 5:41299113-41299135 CTGAATCTCAGAATGTGACCTGG + Intergenic
990333139 5:54746714-54746736 CTGAGGCGGAGGCAGTGTCCTGG - Intergenic
990341400 5:54826674-54826696 CCAAGGCTTAGAGAGTGTCCAGG + Intergenic
990628281 5:57639124-57639146 AAGAGGCTAAGAAAGTCTCCAGG + Intergenic
992622983 5:78611554-78611576 CTGAGGATCAGAAAGGCTTCAGG + Intronic
995744965 5:115393714-115393736 CTGAGGCCCATAAAATCTCCAGG - Intergenic
997649739 5:135507485-135507507 CTGAGGCTCAGAAAGTTCATGGG - Intergenic
998041848 5:138955537-138955559 CTGAAGCTAAGCAAGTGTCTGGG + Intronic
998150005 5:139751395-139751417 CTGGGGTTCAGAGAGTGCCCAGG + Intergenic
998151490 5:139759941-139759963 CTGAGGCTCAGAGAAAGGCCAGG + Intergenic
998783669 5:145685859-145685881 CTCAGAGTCAGAAACTGTCCAGG - Intronic
999143896 5:149380185-149380207 CTGAGGCTCAGAAAGATTTCAGG - Intronic
999242525 5:150136209-150136231 AAGAGGCTCAGAAAGTGACCTGG - Intronic
999282151 5:150372913-150372935 CAGGGGCTCAGCAAGTGTCAAGG + Intronic
999312653 5:150561768-150561790 CTGAGGCTGGGAATGTGTCCTGG + Intergenic
999331485 5:150676597-150676619 CTGAGGCTCAGAGAGCGGCAGGG + Intronic
1001289818 5:170448917-170448939 CTGAGGCTCAGGGAGTGTAAGGG + Intronic
1001758900 5:174191522-174191544 CGGAGGCTCAGAGAGAGCCCAGG - Intronic
1001995477 5:176153988-176154010 CTGAGGCTCAGGCAGTGGCAGGG - Intergenic
1004264019 6:14133358-14133380 CCGAGGCTCAGAGAGGGTCAAGG - Intronic
1004350049 6:14882984-14883006 GTGAGGCTCAGAGAGTATCGAGG - Intergenic
1004674546 6:17828680-17828702 CTGAGGCTCAGAGAGTGAAATGG - Intronic
1005125954 6:22447114-22447136 CTGAGGACCAGAATGTGACCTGG + Intergenic
1006326584 6:33358513-33358535 CTGAGACTCAGAAAAAATCCTGG + Intergenic
1006361026 6:33587157-33587179 CTGAGGCTCAGAAAGAGGAAGGG - Intergenic
1006947087 6:37791745-37791767 CTGAGGCACAGAGGGTGGCCAGG - Intergenic
1006949067 6:37806439-37806461 CTGAGCCTCAGGAAGTTTCTAGG - Intergenic
1008051380 6:46903324-46903346 CTGTGGCTCAGACAGTCCCCTGG - Intronic
1010114633 6:72288196-72288218 CTGAGGGTCATAGAGTGACCTGG - Intronic
1011207789 6:84919012-84919034 CTGAAGCTCAGGAAGGGTCTGGG + Intergenic
1012249014 6:96959289-96959311 CTGTGGCTCAGAAGCTGTCCCGG - Intronic
1012481321 6:99670397-99670419 TAGTGGCTAAGAAAGTGTCCAGG - Intergenic
1013328318 6:109070406-109070428 CTTAGGCTCAGAAAGTGGACAGG + Intronic
1014218201 6:118773653-118773675 CAGGGGCTCAGAAGGAGTCCAGG - Intergenic
1014572904 6:123032829-123032851 CTGAGGCACAGAAAGTTTAAAGG - Intronic
1016803262 6:148187993-148188015 CTGAGGCTCAGAGAGTTACCTGG - Intergenic
1018124667 6:160670083-160670105 CTGAGGCTCAGAGAAGGTGCAGG - Intergenic
1018132701 6:160747924-160747946 CTGAGGCTCAGAGAATGTGTGGG + Intronic
1018149280 6:160923583-160923605 CTGAGGCTCTGGAAGGGCCCTGG - Intergenic
1018970812 6:168527520-168527542 CAGTGGCTCAGACAGGGTCCTGG - Intronic
1019147491 6:169984553-169984575 CTGAGGCTCAGAGAGGGTGCAGG - Intergenic
1019730002 7:2624315-2624337 CTGAGGCTTAGAGAGTTGCCTGG + Intergenic
1019787329 7:2985433-2985455 CCGGAGCTCAGAAAGTGCCCAGG + Intronic
1020839601 7:13199161-13199183 GTGGGGCTCAGAAACTGACCCGG + Intergenic
1022505315 7:30905893-30905915 CTGAGGCTCAGAGGGTTTTCTGG - Intergenic
1023053454 7:36273187-36273209 CTGAGTGTCAGTAAGTGACCCGG + Intronic
1024096668 7:45987699-45987721 CTGAGGTTCAGGAAGTCTCCTGG + Intergenic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026877567 7:73888215-73888237 CTGAGGCCCAGAGAGGGCCCAGG - Intergenic
1031392475 7:121232450-121232472 CTTAGGCTTAGTAAGTGTTCGGG + Intronic
1033236187 7:139639629-139639651 CTGAGCCTTAGTAAGTGGCCAGG + Intronic
1034501050 7:151451381-151451403 CTGAGGCTCTGGAAGGTTCCTGG + Intergenic
1034870341 7:154677837-154677859 CTGAGGCTGAGGAGGTGGCCTGG - Intronic
1035326151 7:158067473-158067495 CAGAGGTTCAGAACATGTCCTGG - Intronic
1035373725 7:158394606-158394628 CCCAGGCGCAGAAAGTGTCAAGG + Intronic
1035783190 8:2244542-2244564 CTGAGGCTTAGGGAATGTCCGGG + Intergenic
1035808934 8:2475044-2475066 CTGAGGCTCAGGGAATGTCCGGG - Intergenic
1036103057 8:5808626-5808648 CTGAGGCTCAGATAGGATACAGG - Intergenic
1036681686 8:10878805-10878827 TTAAGGCTCAGAAAGTCTACAGG - Intergenic
1037692962 8:21198174-21198196 CTGAGGCTCAAATTGTGTACGGG + Intergenic
1038948461 8:32387782-32387804 CTGAGACTCAGAAAGCCACCGGG - Intronic
1039561186 8:38513781-38513803 CTGAGGCTCAGACAGGCACCTGG + Intronic
1040718417 8:50287465-50287487 CTGAGCCTCAGACAGTCCCCTGG - Intronic
1041325549 8:56659525-56659547 CTGTGGCTCAGACAGTGACTGGG - Intergenic
1045128123 8:99117081-99117103 CTGAGACTCAGAAAGTTTTCAGG + Intronic
1045414787 8:101954923-101954945 CTGAGGCTCAGAGAGGATCAAGG - Intronic
1045842062 8:106592059-106592081 CTGAGGCCCTGAAAGTGATCTGG + Intronic
1046909429 8:119609562-119609584 CTAGGGTTCAGAATGTGTCCTGG + Intronic
1048836247 8:138521506-138521528 CAGAGGCTCTGAAAGAGTCTTGG + Intergenic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1049219718 8:141423528-141423550 TTGAGGCTCAGTGTGTGTCCAGG + Intronic
1053842419 9:42199397-42199419 CAGAGACTCAGAGACTGTCCCGG + Intergenic
1056047571 9:82734717-82734739 ATGAGGCTCAGAGAGTTTCCAGG - Intergenic
1056266356 9:84900382-84900404 CTGAGGCTCAGAGTGTGTGAAGG + Intronic
1056647847 9:88430440-88430462 CAGAGGCTCACCAAGTTTCCAGG + Intronic
1057702919 9:97376550-97376572 CTGAGGCTCAGAGCCTGGCCTGG - Intronic
1057816394 9:98299117-98299139 CTGAGGCTCAGACAGGGCACAGG - Intronic
1057892918 9:98882691-98882713 CTGAGGCCCAGAGAGGGTCAGGG + Intergenic
1057964444 9:99489462-99489484 CTGAGGCTCAGAGAGGTTGCAGG + Intergenic
1060117243 9:120951953-120951975 TTGAGGCTCAGAGAGAGACCTGG + Intergenic
1060390046 9:123269205-123269227 CTGAGGCTCAGAACGGTTCTTGG - Intergenic
1060513944 9:124254166-124254188 CTGAGGCTCAGAAAATAGCCAGG - Intergenic
1060886345 9:127155236-127155258 CAGGGGCTCAGAAAATGGCCAGG - Intronic
1060968227 9:127723409-127723431 CTGAGGCCCAGAGAGGGTCAGGG - Intronic
1061792480 9:133066058-133066080 CTGAGGCTCAGAGAGAAACCAGG + Intronic
1061909159 9:133713673-133713695 CTGAGCCTCAGACAGAGGCCAGG + Intronic
1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG + Intronic
1062008232 9:134252447-134252469 CTGAGCCACAAAAAGTCTCCCGG - Intergenic
1185574085 X:1156404-1156426 CTAAGGGTCAGACAGTGTGCAGG + Intergenic
1186426333 X:9466013-9466035 CTGACGCGCAGAAACTGTCAAGG + Intronic
1186459988 X:9740218-9740240 CTGAGGCTCAGACGGAGTCTGGG + Intronic
1186567723 X:10681708-10681730 GTGAGGTTCAGAAAGTATGCGGG + Intronic
1187016549 X:15335089-15335111 ATGAAGCTCAGACAGTGCCCAGG - Intronic
1188996815 X:36896872-36896894 CTAAGGCTCAGAAAGTGCTCAGG - Intergenic
1189949956 X:46218813-46218835 CTGAGGCCCAGAAGGTGTACTGG - Intergenic
1190106129 X:47562230-47562252 CTCAGCCTCCCAAAGTGTCCTGG - Intronic
1190630529 X:52381283-52381305 CTGAAGCTCAGGAAGTCTGCTGG - Intergenic
1192554538 X:72079454-72079476 CTGAGGCTCAGAAAGGGAAAGGG - Intergenic
1193225678 X:78980322-78980344 CTGAGGCTCAGAAAGTCCCAGGG - Intergenic
1197020131 X:121676935-121676957 CTCAGGCACAGAAAGTCTCCAGG - Intergenic
1199080336 X:143569479-143569501 CTGTGGTTCACAAAGTTTCCTGG + Intergenic
1199807272 X:151312750-151312772 CTGAGGCCCAGAAAGGGTAAGGG - Intergenic
1200325829 X:155237764-155237786 CTGAGGATCAGAAAATGTTCAGG - Intronic