ID: 900535931

View in Genome Browser
Species Human (GRCh38)
Location 1:3177524-3177546
Sequence CAGCAGCCCTGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 1, 2: 10, 3: 76, 4: 704}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900535931_900535939 19 Left 900535931 1:3177524-3177546 CCACCTTCCCTCCAGGGCTGCTG 0: 1
1: 1
2: 10
3: 76
4: 704
Right 900535939 1:3177566-3177588 AGTGCCGGCTGCATGCTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 82
900535931_900535937 4 Left 900535931 1:3177524-3177546 CCACCTTCCCTCCAGGGCTGCTG 0: 1
1: 1
2: 10
3: 76
4: 704
Right 900535937 1:3177551-3177573 AATGAGCTGGACCACAGTGCCGG 0: 1
1: 0
2: 3
3: 13
4: 130
900535931_900535936 -9 Left 900535931 1:3177524-3177546 CCACCTTCCCTCCAGGGCTGCTG 0: 1
1: 1
2: 10
3: 76
4: 704
Right 900535936 1:3177538-3177560 GGGCTGCTGCAAGAATGAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900535931 Original CRISPR CAGCAGCCCTGGAGGGAAGG TGG (reversed) Intronic
900143697 1:1149237-1149259 CTCCAGCCCCCGAGGGAAGGAGG + Intergenic
900200270 1:1401621-1401643 CAGCAGCCCAGCAGGGATTGGGG - Intronic
900345973 1:2210451-2210473 AAGCAGGCGTGGAGGGTAGGAGG - Intronic
900425483 1:2576487-2576509 CAGCAGCCCCAGAGGCAAAGAGG + Intergenic
900428737 1:2592308-2592330 CATCAGCGCTGCAGGGGAGGGGG - Intronic
900436974 1:2635422-2635444 CAGCAGCCCTGGGGCCAGGGTGG + Intergenic
900439543 1:2646816-2646838 CAGCAGATCCTGAGGGAAGGTGG - Intronic
900521177 1:3106199-3106221 GAGCAGCCCTGGTGAGCAGGTGG + Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
901184858 1:7366371-7366393 GAGCAGCCCTGGAGAGAAGGGGG - Intronic
901254116 1:7806234-7806256 CAGCAGCACTGCAGGCAAGCAGG + Intronic
901325643 1:8363768-8363790 CAGCAGCCTTGGAGAGCAAGAGG + Intronic
901522153 1:9793370-9793392 CAGCTGCCGTGGATGGATGGGGG - Intronic
901628407 1:10636258-10636280 CAGCAGCCCAGGAGAGGAGAGGG + Intergenic
901646468 1:10719509-10719531 AAGCAGCGCTGTGGGGAAGGTGG + Intronic
901883526 1:12207564-12207586 TGGCAGCCCTGTAGGGAACGGGG + Exonic
902038577 1:13475634-13475656 CAGAAGCCCAGGAAGGATGGAGG - Exonic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902278564 1:15357697-15357719 CTGGAGCCCTGGAGGAAAGGGGG + Intronic
902599509 1:17531576-17531598 AGGCAACCCTGCAGGGAAGGTGG - Intergenic
902876136 1:19341989-19342011 CAGCATCCCTGGAGAGTAGGAGG - Intronic
902923164 1:19679269-19679291 CAGCGGCCCTGGTGGGCAGCGGG - Exonic
903283309 1:22262589-22262611 CAGCAGCCCAGTGGGGCAGGAGG - Intergenic
903435395 1:23344948-23344970 CGGCAGCCAGGGAGGGAAAGAGG - Intergenic
903460449 1:23516959-23516981 CAGCAACCCCAGTGGGAAGGGGG - Intronic
903499971 1:23795334-23795356 CTCCAGGCCTGCAGGGAAGGAGG - Exonic
903787518 1:25871346-25871368 CAGAAGCCCTGGAGAGCACGAGG + Intergenic
903807020 1:26012859-26012881 GATCAGGCCTGGAGGGAAGCAGG - Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904260884 1:29287015-29287037 CAGCAGCCCTGGCAGGGATGGGG + Intronic
904335797 1:29797002-29797024 TCGCATCCCTGGAGGGAATGTGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
904617171 1:31756146-31756168 CAGCTGCCCTGGAGAGGCGGGGG - Exonic
904648615 1:31987450-31987472 CAGCAGCCTGGGTGGGGAGGGGG - Intergenic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905548171 1:38816556-38816578 CAACAGCCCAAGGGGGAAGGTGG - Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
905797669 1:40824587-40824609 CAGCTTCCCGGGAGGGATGGGGG - Intronic
905878946 1:41451087-41451109 CACCTGCCCTGCAGGGCAGGTGG - Intergenic
905878947 1:41451088-41451110 CACCTGCCCTGCAGGGCAGGTGG + Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906116255 1:43359152-43359174 ACGGAGCCCTGGAGGAAAGGAGG - Exonic
906161293 1:43650728-43650750 CAGCGACCCTGCAGGGCAGGGGG + Intronic
906297910 1:44660266-44660288 CCCCAGCCCAGGTGGGAAGGAGG - Exonic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906696712 1:47828175-47828197 CAGGAGCCCTAGAGAGAAGGAGG - Intronic
907205588 1:52767850-52767872 CAGCACCCCAGCAGGGAAGCAGG + Intronic
907443120 1:54490524-54490546 CAGGAGCCCTGCAGGGAGGGAGG - Intergenic
907519783 1:55015579-55015601 CAGCAAGCCTGGGGGTAAGGAGG + Intergenic
909987399 1:82178575-82178597 GAGCAGGCCTGGGTGGAAGGTGG + Intergenic
910556572 1:88541248-88541270 CAGCAGCCTTGGAGGGCTGAAGG - Intergenic
910561779 1:88599013-88599035 TTGCATCCCTGGAGAGAAGGCGG + Intergenic
910891629 1:92026037-92026059 CAGCCGCCCTGTCCGGAAGGTGG - Intergenic
914441529 1:147711768-147711790 CAGCAGCCCAGCAGGGAGAGGGG - Intergenic
914827080 1:151144350-151144372 CAGCAGCTCCTGAGGGCAGGGGG - Intronic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
915304140 1:154968377-154968399 CAGGAGACCAGTAGGGAAGGAGG - Intronic
915493525 1:156265458-156265480 CAGAAGCCCTGGAGGGACTTGGG + Intronic
916173357 1:162018624-162018646 CAGAGGCCCTGGCAGGAAGGTGG + Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916609577 1:166377861-166377883 TGGAAGCCCTGGAGGGGAGGAGG - Intergenic
917032932 1:170714764-170714786 AAGTTGCCCTAGAGGGAAGGTGG - Intronic
918177772 1:182060486-182060508 CAGAAGCCATGGATGGAGGGAGG + Intronic
918179327 1:182072594-182072616 CAACATCTCTGAAGGGAAGGGGG + Intergenic
919701862 1:200639096-200639118 CAGCAGCCCAGGGGGCCAGGTGG - Intronic
919748870 1:201024428-201024450 GAGCTGCCCTGGGGGAAAGGAGG + Intergenic
919843162 1:201623617-201623639 GAGCAGGCAGGGAGGGAAGGGGG + Intronic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
919887557 1:201946049-201946071 GCACAGCCCTGGAGGGGAGGAGG - Intronic
920038750 1:203082675-203082697 CAGGAGCCCTGTAGAGAAGTGGG - Intergenic
920186783 1:204164461-204164483 CAGCAGTCCTGAAGGTAGGGAGG - Intronic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920386051 1:205570495-205570517 CACCAGCTCTGGAAGCAAGGTGG - Intronic
922414211 1:225405590-225405612 CAGCATCCCAGGGTGGAAGGTGG - Intronic
922895341 1:229095797-229095819 CAGCTACCCTGGAGGCAAGGTGG + Intergenic
923025207 1:230198320-230198342 CAGCAGCCCAGGAGAGTACGAGG + Intronic
923025217 1:230198360-230198382 CAGCAGCCCAGGAGCGTACGAGG + Intronic
923025226 1:230198399-230198421 CAGCAGCCCAGGAGAGTACGAGG + Intronic
923025235 1:230198438-230198460 CAGCAGCCCAGGAGCGTACGAGG + Intronic
923025244 1:230198477-230198499 CAGCAGCCCAGGAGCGTACGAGG + Intronic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
924389898 1:243543113-243543135 CAGCAGCTCTGGCAGGGAGGAGG - Intronic
924421094 1:243910875-243910897 CAGCAGGCCTGGAGGGTTCGGGG + Intergenic
1062804314 10:405809-405831 GAGGAGCCCTGGAGGGGAGCTGG - Intronic
1062856283 10:781043-781065 AAGCAGCCCAGGAGGGCAGGTGG - Intergenic
1062905477 10:1176638-1176660 CAGCAGCCCTGGGAAGTAGGAGG + Intergenic
1063200382 10:3781564-3781586 CACCAGCCCTGGAGGGAGCCGGG - Intronic
1063339802 10:5252507-5252529 CAGCAGCCATGGAGGGCCTGAGG - Intergenic
1063343929 10:5294144-5294166 CAGCAGCCATGGAGGGCCTGAGG + Intergenic
1063685280 10:8231136-8231158 CAGCAGCACAGGAAGGAAGCAGG + Intergenic
1063822731 10:9855754-9855776 CAGCAGCCCTGTCCGGGAGGTGG - Intergenic
1064080048 10:12301089-12301111 CAGCTACCCTGGAGAGGAGGTGG + Intergenic
1064448558 10:15420164-15420186 CAGCAGCTCAGGATGCAAGGTGG - Intergenic
1065970192 10:30799879-30799901 CGGGAGCCCTTGTGGGAAGGAGG - Intergenic
1067575247 10:47404573-47404595 CCTCAGCCCAGGAGGGAAGGAGG - Intergenic
1067689797 10:48494421-48494443 AGGCAGCCCTGGAGGGCAGAGGG + Intronic
1067714086 10:48673110-48673132 CAGCTGGCCAGCAGGGAAGGTGG - Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068944733 10:62718446-62718468 CAAGATCACTGGAGGGAAGGAGG - Intergenic
1069609997 10:69766565-69766587 CCACAGCCCTGTGGGGAAGGGGG + Intergenic
1069753469 10:70759823-70759845 CAGCTGCTCTGGATGGAAGTGGG - Intronic
1070007074 10:72435140-72435162 CAGCACTTTTGGAGGGAAGGTGG + Intronic
1070647369 10:78211175-78211197 AGGCACCCCTGGAGGGAGGGAGG + Intergenic
1070751259 10:78965310-78965332 CAGCAGCACTGGGGGCAGGGCGG + Intergenic
1070912686 10:80132471-80132493 TGGGAGCCCGGGAGGGAAGGCGG - Intronic
1071100365 10:82029743-82029765 CAGGAGCCCTGCAGTGAAGATGG + Intronic
1071167361 10:82822375-82822397 CAGCAGCCCAGCAGGGAGAGAGG + Intronic
1071630239 10:87213889-87213911 AGGCAGCCCTGCAGGCAAGGAGG + Intergenic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075389835 10:122084219-122084241 TGACAGCCCTGGAGGAAAGGAGG + Exonic
1076642413 10:131927640-131927662 GAGCTGCCCCGGAGGGAGGGAGG - Intronic
1076725361 10:132410550-132410572 CAGCACCACTGCAGGGGAGGGGG + Intronic
1076812987 10:132898815-132898837 CACCAGCCGAGGAGGGGAGGGGG - Intronic
1077029951 11:460961-460983 CAGCAGCCTTGCTGGGCAGGAGG - Intronic
1077043320 11:534040-534062 CAGCACCCCAGGAGAGGAGGGGG - Intronic
1077216344 11:1396724-1396746 CAGCAGCCCTGCTGGGCAGCCGG + Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077286363 11:1767770-1767792 AGGCAGCCCTGGTGGGAAGAGGG - Intergenic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078087406 11:8242555-8242577 CAGCAGCCCAGGATGGGATGGGG - Intronic
1078456992 11:11483170-11483192 CAGCAGGCATAGAGGCAAGGAGG - Intronic
1078508669 11:11969519-11969541 CACCAGCCCTTGAGCCAAGGGGG + Intronic
1079082983 11:17427147-17427169 CAGCTGGCCTGCAGGGAGGGAGG + Exonic
1079237692 11:18701558-18701580 CAGCAGACCTGGGGGTAAGAGGG - Exonic
1079812389 11:25011097-25011119 CAGCAACCCTCGAGGGCATGGGG + Intronic
1080008012 11:27429920-27429942 CTGCAGCCCTGCAGGGCAGGGGG + Intronic
1080225710 11:29957607-29957629 CAGAATCCCTGGAGAGAGGGAGG - Intergenic
1080715050 11:34792199-34792221 CAGAGGTCCTGGAGTGAAGGAGG - Intergenic
1081840596 11:46198593-46198615 CAGCAGCCTTGGAGGGTAGTGGG + Intergenic
1081853608 11:46290488-46290510 TTGCAGCCCTGGAGAGAAAGGGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083458977 11:62798614-62798636 GAGCAGCCCAGGAGGCACGGTGG - Intronic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1083721478 11:64605792-64605814 CAGCAGCCCTTGGAGGGAGGAGG - Intergenic
1083811542 11:65109363-65109385 CGACAGCCCTGGGGAGAAGGGGG + Exonic
1083871737 11:65492541-65492563 CAACAGCCCTGTGGGGGAGGTGG - Intergenic
1084327038 11:68406467-68406489 CAACAGCCCAGCAGGGAAAGGGG - Intronic
1084515997 11:69638286-69638308 CAGCCGCCCTGGTGGAAAAGCGG + Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084694113 11:70743843-70743865 CAGCAGCCGGGTAGGAAAGGAGG - Intronic
1084956954 11:72696703-72696725 CAGCAGCCCAGGCGGGGTGGGGG - Intronic
1085407215 11:76270349-76270371 CAGCAGCCATGCTGGGGAGGGGG - Intergenic
1085417708 11:76330254-76330276 CGGCAGCCTGGGAGGGGAGGAGG - Intergenic
1085430575 11:76444816-76444838 CAGCAAACCTGGAGCGAAAGAGG + Intergenic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1086888260 11:92226829-92226851 CAGCAGCCGCGGCGGGAGGGAGG + Intergenic
1088679490 11:112226713-112226735 CCCCAGCCCTGGAGGGGTGGGGG + Intronic
1088764322 11:112961829-112961851 GCGCAGCCCTGGAGGGAGCGGGG - Intronic
1088893954 11:114064086-114064108 CAGCATCTCAGGAGGGATGGGGG + Exonic
1088994641 11:114985853-114985875 CAGGTGCCCAGGAGGGCAGGAGG + Intergenic
1089351838 11:117825715-117825737 CAGGAGTCCTGGGGCGAAGGAGG - Intronic
1089602887 11:119626015-119626037 CTGCTGCCCTGAAGGGCAGGGGG - Intronic
1089697435 11:120224888-120224910 CAGCAGCCGGATAGGGAAGGGGG + Intronic
1089966684 11:122659334-122659356 GAGCAGGCCTGGAGAGAGGGAGG + Intronic
1090626911 11:128615921-128615943 AATCAACCCTGGAGGGAAGGGGG + Intergenic
1090958255 11:131533415-131533437 CACCAGCCCAGGAGAGAATGGGG + Intronic
1091935870 12:4434120-4434142 CAGAAGCCATGGAGGGCAAGGGG + Intronic
1092013727 12:5139138-5139160 CAGCAGCCCTGGAGAGCAGGAGG + Intergenic
1092164788 12:6336220-6336242 GAGCCTCCCTGGAGGGAGGGAGG + Intronic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1094539024 12:31347629-31347651 CAGCAGCCCCGGAGGAGATGAGG + Intergenic
1094808271 12:34111080-34111102 CAGCAGCCCACAAGGCAAGGGGG - Intergenic
1095446659 12:42288783-42288805 CAGAAGCCCTGGGGGACAGGAGG - Intronic
1096191305 12:49622148-49622170 CGGCAGCCCCCGGGGGAAGGTGG + Intronic
1096457611 12:51800451-51800473 CTGCATCCCTGGAGGGACTGTGG - Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097960361 12:65526470-65526492 CAGCTGCCCTGAAGGAACGGAGG + Intergenic
1100277909 12:93088471-93088493 CAGACTCCCTGGAGTGAAGGGGG - Intergenic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1100734280 12:97509724-97509746 CAGGAGCCCTGGATTGATGGAGG + Intergenic
1102021400 12:109685949-109685971 CAGCAGCCCTGGGAGCAAGAGGG + Intergenic
1102035943 12:109770599-109770621 TTGCAGCCCGGGAGGGAAGCAGG + Intergenic
1102585121 12:113917480-113917502 AAGCATCCTTGGAGGGAAGATGG - Intronic
1102644095 12:114392769-114392791 CAGCAGCCATTGAGGGAAACAGG + Intronic
1102844596 12:116165953-116165975 CAGCAGCCCTTGGTGGCAGGAGG - Intronic
1102915953 12:116752288-116752310 CAGCACCCCAGCAAGGAAGGTGG - Intronic
1103703916 12:122861400-122861422 AGGCAGCCCTGGAGAGGAGGTGG + Exonic
1103911456 12:124354689-124354711 CAGCAGCCCTGGCTGGAACATGG - Intronic
1103932852 12:124459772-124459794 CAGCAGCCGAGGAGGTGAGGGGG - Intronic
1104478167 12:129087583-129087605 CAGAGGCCCAGGAAGGAAGGAGG + Intronic
1104747787 12:131221001-131221023 CTGCCACCCTGGAGGGAGGGAGG - Intergenic
1104898523 12:132175823-132175845 CGGCAGCCCTGGGGGGTGGGGGG - Intergenic
1104980538 12:132571475-132571497 GGGCAGCCCTGCGGGGAAGGGGG - Exonic
1105214077 13:18274199-18274221 CAGCAGCCCTGGTGGACAGTGGG + Intergenic
1105249564 13:18685734-18685756 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1105416835 13:20220734-20220756 CAGCAGTCCTGGGGGAGAGGTGG + Intergenic
1105811552 13:24000648-24000670 CAGAAGCCCTGTGGGGAAAGAGG + Intronic
1105821797 13:24086891-24086913 GAGCAGCCCAGGAGGGAACCAGG + Intronic
1107708591 13:43131229-43131251 CAGCAGCTTTGGAAGTAAGGTGG - Intergenic
1109620552 13:64899897-64899919 CAGCTGCTCTGGAGTGAAGTAGG + Intergenic
1110664659 13:78102364-78102386 CAGCTGCTCTGAAGGGAAGTTGG - Intergenic
1111478601 13:88789630-88789652 TATGAGCCCTGGAAGGAAGGTGG + Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1112274176 13:98001027-98001049 CAGCTGCCCTCCAGGGCAGGTGG - Intronic
1112350892 13:98632150-98632172 CAGAAGCCCAGCAGGAAAGGAGG + Intergenic
1112485139 13:99812826-99812848 TAGCAGCCCTGGAGACAAGTGGG + Intronic
1112595708 13:100805138-100805160 CTGGATCCCTGGAGGGATGGAGG - Intergenic
1113078971 13:106496571-106496593 TGGCAGCCCTGGAGAGAAAGTGG + Intronic
1113552527 13:111204250-111204272 CGACAGCCCTGGAGAGAAGGTGG + Intronic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1113944662 13:114037329-114037351 CCTCAGCCTTGGAAGGAAGGAGG + Intronic
1114233330 14:20802985-20803007 CAGCAGCCCTAGAAAGACGGCGG - Exonic
1116928613 14:50668064-50668086 CGGCGGCTCGGGAGGGAAGGAGG - Exonic
1118151976 14:63199520-63199542 CAGTAGCCATGGACAGAAGGTGG - Intergenic
1118745248 14:68768572-68768594 GAGCAGCCCTTGAGGCCAGGTGG - Intergenic
1118749446 14:68795502-68795524 CCGCAGCCTTGGAGGGAAAGCGG - Intronic
1119090151 14:71773611-71773633 CAGCAGGCCTGGAAGGAACCTGG + Intergenic
1120869957 14:89328339-89328361 CAGCAGCCCTGGATGAATGGGGG + Intronic
1120869996 14:89328529-89328551 CAGCAGCCCTGGATGAATGGGGG + Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121685259 14:95830955-95830977 CAGGAACTCTGGAGGGAAAGGGG - Intergenic
1121769118 14:96516397-96516419 TAGGAGCCCAGGAGGGAGGGAGG - Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1122169453 14:99859979-99860001 CAGCAGCCCTGCAAGGTGGGTGG + Intronic
1122258688 14:100499737-100499759 CAGGAGCTCTGGAAGGAAGGAGG - Intronic
1122262249 14:100530331-100530353 CAGCAGGCCTGGGAGGAGGGAGG - Intergenic
1122267829 14:100554886-100554908 CAGCGTGCCTGGCGGGAAGGTGG - Intronic
1122338111 14:101007140-101007162 CAGCAGCCCCGGCTGGCAGGGGG - Intergenic
1122428195 14:101623770-101623792 CCTAAGCCCTGGAGGGAGGGAGG - Intergenic
1122782685 14:104150231-104150253 AAGGAGCCCTGCAGAGAAGGAGG - Intronic
1122809315 14:104280246-104280268 CTGCAGGCCGGGAGGCAAGGAGG + Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1122855127 14:104556452-104556474 CTGCACCCCTGGAGGGACGAGGG + Intronic
1122971436 14:105153830-105153852 CAGCAGCCATCCAGGGAGGGTGG + Intronic
1123629404 15:22250842-22250864 CAGCCGCTCTGGAGGGGACGGGG + Intergenic
1123757257 15:23406644-23406666 CAGCAGGCAAGGAAGGAAGGAGG - Intergenic
1124322608 15:28726281-28726303 CAGCACCCCGGGAGGCGAGGCGG - Intronic
1124345157 15:28917343-28917365 AAGGAGCCCTGGAGGGGAGCAGG - Intronic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1124937549 15:34186807-34186829 CAAGAGTCCTGGATGGAAGGGGG + Intronic
1125598464 15:40902492-40902514 CAGCACTCCTGGAAGCAAGGGGG - Intronic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1126506139 15:49406546-49406568 CAGCAGCTTTGGCGGGAGGGTGG + Intronic
1127611246 15:60639690-60639712 CAGCACCTCAGGAGGGGAGGCGG + Intronic
1127863674 15:63014552-63014574 CAGGAACCCTGGAGCCAAGGTGG + Intergenic
1128245813 15:66132081-66132103 CAGAAGCCCTGGACAGGAGGAGG - Intronic
1128457996 15:67843716-67843738 CAGCCCCACCGGAGGGAAGGAGG + Intergenic
1128707383 15:69846848-69846870 CTGCAGCCCTGTAAGGAGGGTGG - Intergenic
1128725036 15:69982128-69982150 AACCTGGCCTGGAGGGAAGGAGG + Intergenic
1129670783 15:77606607-77606629 GAGCAGACCTGGATGGGAGGAGG - Intergenic
1129693767 15:77729057-77729079 CATAAGCCTTGCAGGGAAGGAGG - Intronic
1129901523 15:79154813-79154835 CAGGAGCATTGGGGGGAAGGAGG + Intergenic
1130326201 15:82882278-82882300 CCACAGGCCTGGAGAGAAGGTGG + Intronic
1130911595 15:88274766-88274788 CAGGAGCCCTGGGGGAGAGGTGG - Intergenic
1130956464 15:88630469-88630491 CAACAGCCCTGGAGAGAGAGAGG - Exonic
1130991453 15:88878249-88878271 CACCCGCCCTGGGGGAAAGGGGG + Exonic
1131693843 15:94855205-94855227 GAGCAGCCATGGTGGGAAAGAGG - Intergenic
1132243897 15:100279986-100280008 CACCAGCCCTGGGGGGGATGGGG - Intronic
1132465950 16:77591-77613 CAGCATCCCTGGGCGGAAAGAGG + Intronic
1132617257 16:847844-847866 CCGCAGCCCTGCAGGGAGGGTGG + Intergenic
1132637631 16:960190-960212 AAGCATCCCTGCGGGGAAGGAGG + Intronic
1132677452 16:1126604-1126626 CCGGAGCCCTGAAGGGGAGGGGG - Intergenic
1132688291 16:1171318-1171340 CAGCAGCCCAGGGGGGTAAGAGG + Intronic
1132731951 16:1367040-1367062 CAGCAGCCCTGCAGGCAGGCTGG + Intronic
1132733846 16:1376067-1376089 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733867 16:1376129-1376151 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733899 16:1376227-1376249 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733911 16:1376257-1376279 CCCCAGCCCTGGAGAGAGGGAGG - Intronic
1132733923 16:1376299-1376321 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733946 16:1376369-1376391 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132777437 16:1603171-1603193 CAGCAGCCATGGGGAGGAGGTGG - Intronic
1134012987 16:10868920-10868942 TGGCAGCCCTGGAGGGAAGCTGG - Intergenic
1134568909 16:15274769-15274791 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1134684727 16:16150527-16150549 CAGCAGCCCTGCAGTGGTGGGGG - Intronic
1134733525 16:16481593-16481615 CTGGAGCCCTGCTGGGAAGGAGG - Intergenic
1134933975 16:18230689-18230711 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1135182559 16:20288399-20288421 CAGCAGCACTTGAAGGCAGGTGG - Intergenic
1135403415 16:22181681-22181703 CTGCAGCCCTGTGGGGAAGGTGG - Intronic
1135635355 16:24071082-24071104 CATCAGCCCTGGAGTGGAGGGGG - Intronic
1136035643 16:27537920-27537942 CATCAACCCTGGAGGAAAAGAGG + Exonic
1136129511 16:28211327-28211349 GGGCACCCCAGGAGGGAAGGGGG + Intronic
1136247575 16:28984594-28984616 CAGGAGCCCTGGGGTGAAGACGG - Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1137282737 16:46992327-46992349 CGGCAGGCCTGGGTGGAAGGGGG - Intergenic
1137670647 16:50276309-50276331 CAGCAGCACTGGGGGTGAGGAGG - Intronic
1137821398 16:51449207-51449229 AAACACCCCTGGAGGGAAAGAGG + Intergenic
1138151656 16:54662549-54662571 CAGCAGACCTGCAGGAGAGGAGG + Intergenic
1139325908 16:66152420-66152442 CAGGAACCCTGCAAGGAAGGTGG - Intergenic
1139476254 16:67203915-67203937 CAGCAGCCATGAAGGGCAGTGGG + Exonic
1140143604 16:72284425-72284447 CAGCAGATCTGGAAGGATGGAGG - Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1141506455 16:84481525-84481547 CTGCTGCCCTGGAGAGAGGGAGG - Intronic
1141547269 16:84778806-84778828 ATGCATCCCTGGAGGGAAGTCGG + Intronic
1141562508 16:84878941-84878963 CAGCTGCCCTGGAGGCTGGGTGG + Intronic
1141598750 16:85112754-85112776 CAGCTTCCCTGAAGGGAGGGAGG - Intergenic
1141602502 16:85135056-85135078 CAGCAGCCCTGAAAGGCTGGGGG - Intergenic
1141607174 16:85160709-85160731 CAGCTGCTCTGGAAGGCAGGGGG + Intergenic
1141921419 16:87138230-87138252 CAGCAGCCATGGATGGGAGTTGG - Intronic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1141974153 16:87503594-87503616 CAGCTGCTCTGGAGGGGACGGGG - Intergenic
1142151765 16:88515648-88515670 CAGCAGCCCTGCAGGAGGGGTGG + Intronic
1142364995 16:89645516-89645538 CACCACCCCTGGAGTGATGGAGG + Exonic
1142850196 17:2701056-2701078 CAGAAGCACTGGAGTGCAGGTGG + Intronic
1143110542 17:4550382-4550404 CACCAGCCCAGGGGGGCAGGCGG + Intronic
1143577045 17:7799973-7799995 CAGCAGCTGGGGAGGGAATGGGG - Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144732579 17:17537181-17537203 CTGCTGCCCTGGAAAGAAGGAGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145746844 17:27326215-27326237 CTCCAGACCTGGAGGGCAGGCGG + Intergenic
1145797994 17:27667068-27667090 GAGCAGCCCAGGAGGGCAGAGGG - Intergenic
1146056780 17:29585274-29585296 CAGCAGCCCAGGCAGGAAGCCGG + Intronic
1146391620 17:32428472-32428494 CAGCAGCCCTGGTTGGAGGAGGG + Intergenic
1146566222 17:33915341-33915363 GAACAGCCCTGGAGGGAGGTGGG - Intronic
1146790959 17:35750311-35750333 CAGCACCTCTGGAGTGGAGGCGG + Exonic
1147120087 17:38330674-38330696 CAGCAGAGCTGGAGCCAAGGTGG + Exonic
1147156883 17:38548494-38548516 GGGCAGCCTGGGAGGGAAGGGGG + Intronic
1147220012 17:38923037-38923059 CTGCACCCCTGGAGGGGAGCAGG - Intergenic
1147224692 17:38967544-38967566 CAGAAGCCCTAGCGGGAAGGAGG + Intergenic
1147265416 17:39231633-39231655 CAGCAGCCATGGTGGGGTGGGGG + Intergenic
1147362857 17:39942638-39942660 CAGCACCCCTGGCAGGCAGGAGG + Intronic
1148112246 17:45151810-45151832 CAGAACCTCTGCAGGGAAGGGGG + Exonic
1148201813 17:45754178-45754200 CGGCAGCCTTGAGGGGAAGGGGG - Intergenic
1148323489 17:46771051-46771073 CCACAGCCCAGGAGGGGAGGCGG - Intronic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1148790385 17:50169309-50169331 AAGCAGCATGGGAGGGAAGGGGG - Intronic
1149026211 17:52030378-52030400 CAGCACCCATGGAGAGGAGGAGG + Intronic
1149451176 17:56751256-56751278 GAGCTGGCCTGGAGGGCAGGAGG - Intergenic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149805116 17:59609997-59610019 AAGCAGCCTTGCAGGAAAGGTGG + Intergenic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150303356 17:64064176-64064198 CAGGAGCCCTGGAGGGAGAGCGG + Intronic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1151715144 17:75827483-75827505 CAGCTGCCCTGGGGGGAGGGTGG - Exonic
1151732567 17:75920128-75920150 CAGCAACCAGGGAGGGGAGGTGG + Intronic
1151759532 17:76092794-76092816 CAGCATCCCTGGAGGCAATTGGG - Intronic
1152024976 17:77802984-77803006 CACCAGCCCAGGTGGGCAGGAGG + Intergenic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152254074 17:79227320-79227342 CACCAGCCCAGGAGGAAAAGGGG - Intronic
1152277347 17:79365832-79365854 CTGCTGCCCGAGAGGGAAGGGGG + Intronic
1152280481 17:79382305-79382327 CTGCATCCCTGCAGGGATGGGGG + Intronic
1152660665 17:81540475-81540497 CAGCAGCCCCTGAGGCCAGGAGG - Exonic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1154047508 18:10920803-10920825 CAGCAGTCTGGGAGGCAAGGTGG + Intronic
1154268337 18:12898088-12898110 GAGCAGCAGTGCAGGGAAGGAGG - Intronic
1154439265 18:14373157-14373179 CATCAGTCCTGTAGGGATGGGGG + Intergenic
1155054025 18:22169806-22169828 CAGCCCGCCCGGAGGGAAGGAGG - Intronic
1155398699 18:25415358-25415380 CAGCACCTGTGGAAGGAAGGAGG - Intergenic
1157301782 18:46484665-46484687 CAGCAGTCCTGGAGAGAGTGAGG + Intronic
1157793855 18:50557830-50557852 CAGTAGCCCTGGAGGATATGGGG - Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1159751176 18:72304055-72304077 CAGCAGACCAAGAGGGAATGAGG + Intergenic
1160555882 18:79724875-79724897 AAGCAGCCATGGAGGGAGGACGG - Intronic
1160567704 18:79797749-79797771 CAGCTGCCCTTGGGGGCAGGAGG - Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160799535 19:961286-961308 CAGCCGCCCGGAAGGGAAGGAGG + Intronic
1160866230 19:1257352-1257374 GCCCAGCCCTGGAGGGCAGGCGG + Exonic
1160870766 19:1276794-1276816 CAGCAGCCCGGGAGGCAGGGAGG - Intronic
1160963632 19:1735915-1735937 GAGGAGGCCAGGAGGGAAGGGGG + Intergenic
1161010496 19:1957420-1957442 GAGCAGCCTGGGAGAGAAGGGGG + Intronic
1161298528 19:3531896-3531918 CAGCGCCCCTGGAGGCCAGGTGG - Exonic
1161451153 19:4346120-4346142 CCCCAGCCCTGGAGGGATGGAGG - Intronic
1161495527 19:4584079-4584101 CAGGAGCCCTGGGCGGGAGGAGG - Intergenic
1161579564 19:5073369-5073391 CAGCAGCCCCGGTGGGGAGCAGG + Intronic
1161990643 19:7682173-7682195 GAGCAGGCCGGGAGGAAAGGAGG - Intronic
1162023292 19:7878815-7878837 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1162119744 19:8456324-8456346 TAGCAGCACAGGAGGGAAGAAGG - Intronic
1162146019 19:8612352-8612374 GAGAGGCCCTGGTGGGAAGGAGG - Intergenic
1162339945 19:10086326-10086348 CAGCAGCCGCGCAGGGCAGGGGG - Exonic
1162536321 19:11264632-11264654 CAGCAGCCTGAGAGGCAAGGCGG - Intergenic
1162588984 19:11578527-11578549 CCGCAGCCTGGGAGGGCAGGAGG + Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1163127477 19:15251994-15252016 CAGCTGTCCTGGCGGGAAGGAGG - Intronic
1163251138 19:16127056-16127078 GAGGAGCCAGGGAGGGAAGGAGG + Intronic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1163369921 19:16896319-16896341 CCGCTGCTCTGGAAGGAAGGGGG + Exonic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163716532 19:18875869-18875891 CAGAAGCCCAAGAGGCAAGGAGG + Intronic
1163723407 19:18909117-18909139 AAGCAGCCCCGGAGAGCAGGCGG - Intronic
1163842539 19:19620033-19620055 CAGCAGCAATGGAGAGAACGTGG - Intergenic
1165305406 19:35000224-35000246 CCCCAGCCCGGGAGGGAAGGCGG - Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1166219206 19:41354076-41354098 CTTCAGCCCTGGGGGAAAGGGGG + Intronic
1166524933 19:43504805-43504827 CAGCAGCCCGGAAGTGGAGGGGG + Exonic
1167723076 19:51192258-51192280 CAGCAGCTCAGGAAGGAGGGAGG + Intergenic
1167761123 19:51450006-51450028 CAGCAGCTCAGGAGGGACAGAGG - Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168147299 19:54426902-54426924 GAGCAGCCCAGGAGGGAGGCGGG + Intronic
1168327697 19:55546575-55546597 CAGCACTCCTGGTGTGAAGGAGG - Intergenic
1168643098 19:58042844-58042866 CAGCGGCCCTGGTGGGAGAGGGG - Intronic
924962675 2:47517-47539 CAGCAGCCCGGAAGGCAGGGAGG + Intergenic
925134413 2:1516339-1516361 CTGGAGCCCTGGGGGGACGGGGG - Intronic
925173524 2:1767136-1767158 CAGCAGCCCATGAGGCAGGGTGG - Intergenic
925201037 2:1967976-1967998 CTGCACCCCAGGAGGGGAGGAGG + Intronic
925385539 2:3459461-3459483 GAGCTGCCCTGGGGGGAGGGTGG - Intronic
926953200 2:18266376-18266398 CAGCACCCCTGGAGGCCAGCAGG + Intronic
927645516 2:24874578-24874600 CAGAAGCCCAGCCGGGAAGGAGG - Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927680366 2:25135185-25135207 GATGAGCCCTGGAGGGAAGCGGG - Intronic
928374568 2:30764300-30764322 GAGCAGCCTGGGAGGGAATGGGG + Exonic
928432769 2:31234388-31234410 CAGCAGCCCAGGCCGGAGGGAGG - Exonic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929450671 2:42034964-42034986 AAGCTGCCCTTGAGGGAAAGTGG + Intergenic
930025088 2:47024880-47024902 CAGCACCCCTGGGGAAAAGGCGG - Intronic
932036380 2:68251635-68251657 CAGCAGCTCTGGAGAGTAAGTGG + Intronic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932171182 2:69557896-69557918 CAACAGCCCAGGAGGTAGGGAGG - Intronic
932595043 2:73088345-73088367 CAGCCACCCTGGAGAGGAGGAGG - Exonic
932625520 2:73293173-73293195 CGGCTACCCTGGAGGTAAGGAGG - Exonic
933157870 2:78994078-78994100 CAGCAGCCCTGTGAGGAAGGAGG - Intergenic
933650581 2:84846996-84847018 AGGCTGCCCTGGAGGGAAGCTGG + Intronic
933656206 2:84888981-84889003 CAGCAGCACGGAAGGGAAGCTGG + Intronic
933980166 2:87542874-87542896 CAGCTGCCCTGGGGGCAGGGAGG + Intergenic
934300242 2:91772551-91772573 CAGCAGCCCTGGTGGACAGTGGG - Intergenic
934656383 2:96118571-96118593 CAGCATCCCTTGAAGGAAGATGG - Intergenic
934768909 2:96895646-96895668 CAGCAGCCCTGGGGGCAGGGCGG + Intronic
935341323 2:102062141-102062163 CAGCAGTTCTGGAGTGAGGGTGG - Intergenic
936039704 2:109140946-109140968 CAGCAGCCCCGGATGGAAGGTGG - Intronic
936048100 2:109202244-109202266 AGGCAGCACTGGAGGCAAGGTGG - Intronic
936096582 2:109534920-109534942 AAGCAGTGCTGGAGGGGAGGGGG - Intergenic
936313661 2:111407917-111407939 CAGCTGCCCTGGGGGCAGGGAGG - Intergenic
938236297 2:129709486-129709508 CAGCTGCTCTGGGGGGATGGGGG - Intergenic
938256235 2:129861910-129861932 CAGCTACCCTGGTGGGAAGCTGG - Intergenic
938292296 2:130156668-130156690 CAGCAGCCCTGCAGGGGATGGGG + Exonic
938373938 2:130791901-130791923 CAGCAGCCCAGGAGAGCATGGGG - Intergenic
938421922 2:131153280-131153302 CAGCACCACAGGAGGGGAGGAGG - Intronic
938464252 2:131516299-131516321 CAGCGGCCCTGCAGGGGATGGGG - Intergenic
938571958 2:132569503-132569525 CAGCAGCTGTGGTGGGGAGGGGG + Intronic
938648596 2:133356438-133356460 CAGCAGAGCTGTAGGGAAAGTGG - Intronic
939103665 2:137924975-137924997 CATCAGGCCTGTAGGGATGGGGG - Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940089197 2:149897048-149897070 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940089412 2:149898993-149899015 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940956223 2:159731139-159731161 CAGCACTCTGGGAGGGAAGGTGG - Intronic
942444530 2:176069200-176069222 CAGGGGCCCTGGGAGGAAGGTGG + Intergenic
942591534 2:177552330-177552352 CAGCTGCCGAGTAGGGAAGGGGG - Exonic
944527575 2:200635684-200635706 CAGCATGCATGGAAGGAAGGAGG + Intronic
944665272 2:201954233-201954255 CAGCTGCCCTGAAGGAAAGCTGG + Intergenic
944667800 2:201971591-201971613 TGGCAGCCCTGTGGGGAAGGGGG - Intergenic
944751088 2:202710693-202710715 CAGCAGGCAAGAAGGGAAGGGGG - Intronic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946246957 2:218393269-218393291 CAGCCACCCTGGGGGGCAGGAGG + Intronic
946752450 2:222906110-222906132 CAGCAGCCCTGGAAGAGGGGAGG - Intronic
946772741 2:223106028-223106050 CAGCAGATTTGGAGGGAAAGGGG - Intronic
947311470 2:228808577-228808599 CAGCAGACCTGCAGAAAAGGGGG - Intergenic
947505724 2:230707140-230707162 CTGCAGCCCTGGAAGTGAGGAGG - Intergenic
947566646 2:231198540-231198562 GAGCAGCCTGGGAGGGAAGGTGG - Exonic
947588184 2:231369988-231370010 CAGCATCTCTGGAGTGCAGGGGG - Intronic
947868505 2:233418720-233418742 GAGCAGCTTTGGGGGGAAGGAGG - Intronic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948309224 2:236972534-236972556 CAGCAGCCCTGGAGGGTGCAAGG + Intergenic
948456927 2:238108935-238108957 CAGCAGCGCTGCCGGGAGGGGGG - Intronic
948458214 2:238117052-238117074 CAGCTGCCCTGGAGGCATGGGGG + Intronic
948716038 2:239864486-239864508 CTGCAGCTATGGAGGGTAGGGGG + Intergenic
948723430 2:239918006-239918028 CAGCAGCCCTGGACTCCAGGTGG + Intronic
948893245 2:240917008-240917030 CAGCAGCCCAGTGGGGGAGGGGG - Intergenic
948912101 2:241009884-241009906 CGCCAGCCCTGAAGGGAAGGAGG - Intronic
948916319 2:241036446-241036468 CAGGAACCCTGGAGGGGAGGCGG + Intronic
948933745 2:241149356-241149378 CAGCCGCCCTGGGGAGATGGCGG + Intronic
948970042 2:241418381-241418403 GGGCAGCCCTGGGGGGCAGGAGG - Intronic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1168897588 20:1334495-1334517 CAGCAGCCTTCTACGGAAGGTGG + Intronic
1168923226 20:1558342-1558364 GAGGAGGCCTGCAGGGAAGGCGG + Exonic
1169464202 20:5823191-5823213 CAGCAGCCAGTGAGGGCAGGAGG - Intronic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1170606439 20:17878360-17878382 CAGCAGCCGTGGAGGCAGGCGGG + Intergenic
1171099419 20:22368585-22368607 CATGAGACCTAGAGGGAAGGAGG - Intergenic
1172127362 20:32632754-32632776 CAACAGCCCTGGGAGGCAGGTGG + Intergenic
1172916930 20:38450321-38450343 CAGCATCCCTGGAGTGAGGAGGG - Intergenic
1173428828 20:42967730-42967752 TAACAGCCTAGGAGGGAAGGAGG - Intronic
1173703587 20:45094183-45094205 GATGAGTCCTGGAGGGAAGGAGG - Exonic
1173823796 20:46034799-46034821 CTGCAACCCTGCAAGGAAGGTGG + Intronic
1173866221 20:46314121-46314143 CAGCAGCCCTGGGGAGAGGCAGG - Intergenic
1174170601 20:48615952-48615974 CAGGAGCCATGGAGAGTAGGAGG - Intergenic
1174898678 20:54476071-54476093 CAGCATCCCTGGAGGGTGGACGG + Intronic
1175258885 20:57662805-57662827 CATCAGCCCTGGAGGGAGGGAGG + Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175555219 20:59848108-59848130 CAGTATACCAGGAGGGAAGGAGG - Intergenic
1175756565 20:61533799-61533821 CCACAACCCTGGTGGGAAGGAGG + Intronic
1175835975 20:61994678-61994700 CAACAGTCCTGGTGGGGAGGGGG + Intronic
1175957225 20:62617588-62617610 CTGCTGCCCATGAGGGAAGGAGG - Intergenic
1176087255 20:63303808-63303830 CTGCACACCTGGAGGGAGGGAGG - Intronic
1176212783 20:63933190-63933212 CAGCAGGCAGGCAGGGAAGGGGG - Exonic
1176456415 21:6916251-6916273 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1176834590 21:13781311-13781333 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1178721755 21:35016763-35016785 AAACAGCCCTGGATGGAAGGGGG - Intronic
1178882558 21:36460943-36460965 CAGCAGCCCAGGGGAGAAGCAGG + Exonic
1179343094 21:40531237-40531259 CAGCAGCCTTGGGGAGAGGGAGG - Intronic
1179719021 21:43305095-43305117 CAGCAGCCCATGGGGGAAGCAGG - Intergenic
1179924492 21:44526814-44526836 GAGCAGCCCTGACAGGAAGGTGG + Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180157628 21:45985811-45985833 CACCAACTCTGGAGGGAAGTGGG - Intronic
1180581903 22:16845904-16845926 CAGCACCCCTGGAAGGTGGGCGG - Intergenic
1181136897 22:20773697-20773719 CATCAGTCCTGGAGAGCAGGTGG + Intronic
1181404667 22:22674177-22674199 CTGCAGCCCTGGGAGGATGGTGG - Intergenic
1181413248 22:22739693-22739715 CTGCAGCCCTGGGTGGATGGTGG - Intronic
1181673901 22:24439666-24439688 CCTCAGCCCTGTAGGAAAGGTGG - Intronic
1181779908 22:25185056-25185078 CAGCACCCCAGGCTGGAAGGGGG - Exonic
1181801699 22:25351937-25351959 CAACAGCCCAGCAGGGAAAGGGG + Intronic
1182075866 22:27495058-27495080 CAGGAGACCTGGAGAAAAGGAGG + Intergenic
1182517428 22:30867033-30867055 CACCACCCCTCAAGGGAAGGTGG - Intronic
1183922119 22:41177685-41177707 CAGCCACCCTGGAGCCAAGGAGG + Exonic
1184075736 22:42176361-42176383 CTGCTGCGCTGGAAGGAAGGGGG + Intronic
1184092896 22:42301668-42301690 GAGCAGCAAGGGAGGGAAGGTGG + Intronic
1184093643 22:42305193-42305215 CAGCAGCCTTGGGGGCCAGGAGG - Intronic
1184116455 22:42425551-42425573 CGGCAGACAGGGAGGGAAGGAGG - Intronic
1184254018 22:43276860-43276882 ATGCTGCCCTGGAGGGAAGCTGG - Intronic
1184411492 22:44328854-44328876 CTGCAGACCTGGAGGGCTGGGGG - Intergenic
1184507529 22:44913462-44913484 CAGCAGCCCTGTGAGGAAGGAGG + Intronic
1184629032 22:45761351-45761373 CAGGGGCCCTGGAGAGAATGAGG - Intronic
1184871354 22:47240348-47240370 CCGCAGCCCTGGTGGGCAGGAGG + Intergenic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185086699 22:48744720-48744742 CCGCAGCCCTGGGAGGCAGGGGG + Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
1185141175 22:49102124-49102146 CCGCAGCCCTGGCAGCAAGGCGG + Intergenic
1185199440 22:49492457-49492479 CAGCTGCCCGGGAAGGAAGGTGG + Intronic
1185222398 22:49635773-49635795 CAGAAGCCATGGAGGTAAGCCGG - Intronic
1185251267 22:49802795-49802817 CAGGAGCCCTGGAGGCTACGAGG + Intronic
1185272411 22:49935388-49935410 GAGCGGCCCTGCCGGGAAGGGGG + Intergenic
1185377554 22:50489175-50489197 CAGCAGCCGCCCAGGGAAGGGGG - Intronic
949526296 3:4907891-4907913 CAGCAACCCTGAAGGGAGGCAGG + Intergenic
949534375 3:4984408-4984430 GAGCTGCCCCGGAGGGAGGGAGG + Exonic
949632950 3:5949001-5949023 ATGAAGCCCTGGAGAGAAGGTGG + Intergenic
949845503 3:8366356-8366378 CAGCATTCCTGGAGGGCAAGAGG - Intergenic
950532653 3:13561484-13561506 CAGCCGGCATGCAGGGAAGGAGG - Intronic
950583467 3:13878125-13878147 CAGCTGCCCGGCAGGGAGGGAGG - Intronic
950674698 3:14547692-14547714 GAGCAGCCCCTGAGGGGAGGAGG - Intergenic
950715869 3:14847458-14847480 TAGCATCCCTGGTGGGATGGAGG + Intronic
950738934 3:15034226-15034248 CTGCAACCCTGCAGGGCAGGAGG - Intronic
951253751 3:20425277-20425299 CAGTTTCCCTGGAGAGAAGGAGG + Intergenic
952906404 3:38141836-38141858 CACCTGCCCTGTGGGGAAGGAGG - Exonic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953535394 3:43773443-43773465 GACCAGCCCTGGTGGCAAGGAGG + Intergenic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
953848292 3:46446008-46446030 CACCAGCTCTGGTGGGCAGGAGG + Intronic
954107198 3:48415753-48415775 CGGCAGCCTGGGAGGGGAGGTGG + Exonic
954199432 3:49015373-49015395 CAGCATGCCTTGAGGGGAGGAGG + Exonic
954384789 3:50238364-50238386 GAGCAGGCCTGGTGGGATGGGGG - Intronic
954509778 3:51113532-51113554 CAGCAGCTCTGGAGTCAGGGTGG - Intronic
954525906 3:51271052-51271074 TATCACCCCTGGAAGGAAGGAGG - Intronic
954680911 3:52345480-52345502 CACCAGCCCTGCAGGGATAGGGG - Exonic
954692521 3:52403221-52403243 CAGCAGCCCAGTGGAGAAGGAGG - Exonic
955996939 3:64687698-64687720 CCGCAGCCAAGGAGGGCAGGAGG - Exonic
956685590 3:71824623-71824645 CAGGAACCCTGGAGGGAGGGAGG + Intergenic
956700116 3:71951462-71951484 TATCAGCCCTGGCTGGAAGGAGG + Intergenic
956737861 3:72252300-72252322 CAGCAGCTCTGGAGGAGATGTGG - Intergenic
956929652 3:74028603-74028625 CAGCATCCCTAGAGGGAAGGTGG + Intergenic
958448841 3:94248159-94248181 AAGCTTCCTTGGAGGGAAGGAGG - Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
960279617 3:115766643-115766665 AAGCTGTCCTGCAGGGAAGGAGG + Intergenic
960948407 3:122982691-122982713 CAGCAGACCTGGGGGGTGGGGGG - Intronic
960992262 3:123319648-123319670 CAGCACCCTGGGTGGGAAGGAGG - Intronic
961003405 3:123389012-123389034 CAGGAGTCATGGAAGGAAGGAGG + Intronic
961004214 3:123393785-123393807 CAGCAGCCGGGGCGGGAGGGAGG - Intronic
961084416 3:124054436-124054458 TAGCAGCCAGGTAGGGAAGGAGG - Intergenic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961461411 3:127052570-127052592 CAGGAGGCCTGGAGGAAATGGGG - Intergenic
961496602 3:127297359-127297381 TGGCAGCCCTGGAGGAAAGAAGG + Intergenic
961633003 3:128314971-128314993 AAGCAGCCCTGAAGAGCAGGTGG - Intronic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
962319608 3:134379290-134379312 GAGTAATCCTGGAGGGAAGGAGG + Intergenic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962974298 3:140432781-140432803 CATCAGCCCTGAGGGGAAGAGGG + Intronic
963130070 3:141849708-141849730 TAGCAGGCCAGGAGAGAAGGAGG + Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
966198171 3:177334386-177334408 CAGAAGCCCAGGATGGCAGGTGG + Intergenic
966862577 3:184238778-184238800 CGGCAGCCCTGCTGAGAAGGGGG - Exonic
967035351 3:185645286-185645308 CAGAAGCCCTGGGGGGCGGGAGG + Exonic
967260271 3:187634849-187634871 CAGAAGCCTGGGAGGGAAGAAGG - Intergenic
967315927 3:188152524-188152546 CAGGAGACCTGGATGGGAGGAGG + Intergenic
967327614 3:188257910-188257932 TAGCAGCACTGGGTGGAAGGTGG - Intronic
967718391 3:192789311-192789333 CAGGAGCCCAGGAGGGTTGGGGG - Intergenic
968035323 3:195543411-195543433 GAGCAGCCCGGGCGGGACGGAGG - Intergenic
968148678 3:196320396-196320418 CAGCAGCCCTGGAGAGGAAAGGG + Intronic
968290302 3:197533696-197533718 CAGCAACCCTGGTGGAAAGAGGG - Intronic
968435120 4:581106-581128 CAGAAGCTCTGGTGGGAGGGAGG - Intergenic
968501357 4:951667-951689 ATGCAGGCCTGGAGGGAGGGAGG - Exonic
968659609 4:1793633-1793655 CAGCAGCCAGGGAGGGAAGGGGG + Intronic
968727197 4:2253254-2253276 AAGCAGGCCAGCAGGGAAGGCGG - Intronic
968953927 4:3708647-3708669 CACCAGCACTGAAGGGATGGAGG + Intergenic
969094826 4:4724408-4724430 CAGCTGCTCTGGAGAGATGGAGG - Intergenic
969174045 4:5385603-5385625 CAGCAGCCCTGGGAGGAGTGTGG - Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969235598 4:5863278-5863300 CAGCAACCCTGCAAGGTAGGAGG + Intronic
969425064 4:7119449-7119471 CTGCAGCCCTGGGAGGAAGAGGG - Intergenic
969615197 4:8247904-8247926 GAAGTGCCCTGGAGGGAAGGAGG + Intergenic
969651112 4:8468903-8468925 CAGCATCCCTGCCCGGAAGGAGG - Intronic
969978944 4:11134270-11134292 CAGCAGCCCTGGGTGTCAGGTGG - Intergenic
971318882 4:25589274-25589296 CACCAGCCATGGAAGGAAGATGG + Intergenic
974855795 4:67459359-67459381 CATCACCCCTGGAGGGTAAGAGG - Intergenic
975764787 4:77655602-77655624 CAGCAGACCTGCAGTGGAGGGGG + Intergenic
977798613 4:101198530-101198552 CAGGAGCACAGAAGGGAAGGAGG + Intronic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
978929796 4:114296366-114296388 CAGCAGCTGTGGAGGGTATGCGG - Intergenic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
979923045 4:126524952-126524974 CAGAAGCCCAGGAGGAAAAGTGG - Intergenic
979980576 4:127249505-127249527 TGGTAGCCATGGAGGGAAGGGGG + Intergenic
981366672 4:143912162-143912184 CGGCGGCTCCGGAGGGAAGGAGG - Intergenic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985692286 5:1319966-1319988 TGTCAGCCCTGGAGGGAAGCGGG + Intronic
985800455 5:2002399-2002421 CAGCAGCCCTGGAAGCAGGCAGG - Intergenic
985970773 5:3376852-3376874 CAGCAGCCACGCAGGGAAGCTGG - Intergenic
986013686 5:3739493-3739515 GAGCAGTCCAGGATGGAAGGAGG + Intergenic
986773292 5:10992855-10992877 CAGGCTCTCTGGAGGGAAGGAGG - Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
989774091 5:45181989-45182011 CCGAAGTCCTGGTGGGAAGGTGG - Intergenic
990241840 5:53823815-53823837 CAGCAACCCAGGAGCGAAGTCGG - Intergenic
992103047 5:73425904-73425926 CAACAGCCCTGGAAGAAATGAGG - Intergenic
993118506 5:83746514-83746536 CAGCCACCCTGGAGGAAAAGAGG - Intergenic
993467961 5:88270597-88270619 CAGAATACCTGGAGGGAAGGTGG + Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
996065183 5:119071479-119071501 CCGCCGCCCCTGAGGGAAGGAGG + Exonic
997046551 5:130325867-130325889 CAGCAGCAATGGAGGAAATGAGG + Intergenic
997583553 5:135031613-135031635 CAGGAACCCTAGAGGGAGGGAGG - Intronic
997748796 5:136324928-136324950 CTGCAGCCCTAAAGGGAGGGAGG - Intronic
998796974 5:145831177-145831199 CAACAACCCTGGAAGGTAGGTGG + Intronic
999198899 5:149802274-149802296 CAGCAAGCCAGGAGGGACGGAGG - Intronic
999316661 5:150588514-150588536 CAGCAGCCATGGAAGAAAGTAGG + Intergenic
1000672204 5:164076928-164076950 AGGCAGCCCTGGTGGGATGGGGG - Intergenic
1001705897 5:173741070-173741092 CAGAAGACCTGGAGGTCAGGAGG - Intergenic
1001747003 5:174099702-174099724 CATCAGCCCTGGAAAGAACGTGG - Intronic
1001758137 5:174186395-174186417 CAGCAGCCCTGCAGAGCTGGGGG - Intronic
1001980474 5:176034514-176034536 AAGGAGCCCTGGAGGGTGGGTGG - Intronic
1002043618 5:176530540-176530562 CAGCTGCCCTGGAGCCCAGGTGG + Intronic
1002236987 5:177809551-177809573 AAGGAGCCCTGGAGGGTGGGTGG + Intergenic
1002347930 5:178561066-178561088 CACCAGCCCTGCAGGGAGGGAGG + Intronic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002942843 6:1733255-1733277 CAGCAGCCCAGGGAGGAGGGCGG + Intronic
1003311309 6:4971999-4972021 CTGCAGGCCTGGAGGGAGTGGGG + Intergenic
1003528354 6:6917101-6917123 CTGCTGCCCTGGTGGGAAGCTGG + Intergenic
1003531409 6:6940369-6940391 CAGGAGCCCACGGGGGAAGGGGG - Intergenic
1003778777 6:9399031-9399053 CAGCGTCCTCGGAGGGAAGGAGG - Intergenic
1003873872 6:10420658-10420680 CAGCAGCCCGGGAGGGTAACTGG - Intergenic
1003893955 6:10589516-10589538 CAGAAGCCTTTGAGGGATGGTGG - Intronic
1004897606 6:20163776-20163798 CAGCAGCCCTGGAGGTGAGGTGG + Intronic
1005813199 6:29531498-29531520 CAGCAGCCCTGGAGAGCAGCAGG + Intergenic
1005840616 6:29742583-29742605 CAGCAGCCCTGGGGTGGAGCTGG - Intergenic
1005871036 6:29974689-29974711 CATCTGCACTGGAGGGGAGGGGG + Intergenic
1006054997 6:31377675-31377697 CAGCAGGCCTTGAGTGAGGGAGG - Intergenic
1006058885 6:31404765-31404787 CATCTGCACTGGAGGGGAGGGGG - Intronic
1006071369 6:31499650-31499672 CACCTGCACTGGAGGGGAGGGGG - Intronic
1006327393 6:33364920-33364942 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1006373770 6:33660458-33660480 AAGCAGCCCAGGAGGTAAGAAGG - Intronic
1006418863 6:33921069-33921091 GAGCAGCCCAGGATGGAAGAAGG + Intergenic
1006931670 6:37692526-37692548 CAGCTGCCCAGGAGGCATGGGGG - Intronic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007599372 6:43072258-43072280 CAGAAGCCCAGAGGGGAAGGAGG + Intronic
1007631040 6:43273886-43273908 CTGCAGCCCTGGACAGAGGGTGG - Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1010010232 6:71040424-71040446 CCTTAGCCCTGGAGGAAAGGAGG - Intergenic
1011884383 6:92076049-92076071 CAGCAGCTCTGTGGGGAAGCAGG - Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1013314556 6:108929132-108929154 GATCAGATCTGGAGGGAAGGAGG - Intronic
1013414267 6:109910730-109910752 CAGCAGCCCTGGAGTGTGTGTGG + Intergenic
1016235417 6:141857915-141857937 CAGCTGCCCAGGATGGAGGGCGG + Intergenic
1016237697 6:141887857-141887879 CTGCTGCACTGGAGGGAATGAGG - Intergenic
1016330192 6:142946288-142946310 CCACAGCCCGGGAGGGGAGGCGG - Intergenic
1016393336 6:143597010-143597032 CAGAAACGCAGGAGGGAAGGAGG - Intronic
1016461900 6:144286452-144286474 CAGCGGCCCTGGAGAGACTGAGG + Intronic
1016577247 6:145583653-145583675 CAGCAGCCATGGTGGCAAAGTGG + Intronic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1016990743 6:149926053-149926075 CAGCAGCCCTGGACCGCAAGCGG - Intergenic
1017119137 6:151007304-151007326 CTGAAGCCCTGCAGGGAAGTGGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1017750785 6:157488640-157488662 CAGCGACCCTTGAGGGAAAGAGG - Intronic
1017758655 6:157551215-157551237 CAGCACCCCAGGAGGAAGGGAGG - Intronic
1018047048 6:159974758-159974780 CAAAGGCCCTGGAGGGGAGGGGG + Intronic
1018875118 6:167815674-167815696 CAGCTGCCCTGGAGGGGCGCTGG - Intergenic
1019351741 7:557183-557205 CAGCAGCCAAGGAGGGAAAGAGG + Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019553506 7:1616968-1616990 CAGCAACTCTGCAGGGCAGGAGG - Intergenic
1019641809 7:2107297-2107319 CAGCAGCCCTGGGGCAGAGGGGG + Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020131694 7:5562527-5562549 CAGGTGCCCCGGCGGGAAGGAGG + Intronic
1021605195 7:22402966-22402988 GAGCAGGCCTGGGGTGAAGGAGG - Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022423566 7:30246469-30246491 CAGCAGCACCGGAGGAAAGCAGG + Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022999496 7:35793408-35793430 CACCAGCCAAGGAGGGAAGGGGG - Intergenic
1023098457 7:36687818-36687840 CAGGATTCCTTGAGGGAAGGTGG + Intronic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1027219152 7:76202801-76202823 CAGGAGCCCTGGGAGGGAGGGGG - Intronic
1027400053 7:77798113-77798135 CAGAAGCCCTGGAGCCAAGCAGG + Intronic
1027414306 7:77958694-77958716 CAGCCTCTCTGGAGGGAAGGTGG + Intergenic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1028938235 7:96489688-96489710 CAGGAGCCTTTGAGGGATGGTGG - Intronic
1029189307 7:98760564-98760586 AAGCGGTCCTGGAGGCAAGGCGG + Intergenic
1029373208 7:100162566-100162588 AAGCAGCCAGAGAGGGAAGGAGG + Intronic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1031080362 7:117251762-117251784 CAGCAGCTCAGCAGGGATGGGGG - Intergenic
1032011808 7:128352017-128352039 CAGCAGCCCGGAAAGGAAAGCGG + Exonic
1032069427 7:128794679-128794701 CAGGAGCCCTGCAGGGAGAGGGG - Exonic
1032423536 7:131802242-131802264 CAGCAGCCCTGGGGGGCTGGTGG - Intergenic
1032658934 7:133961928-133961950 CAGCAGCCTATGGGGGAAGGTGG + Intronic
1032855172 7:135828125-135828147 CAGGAGCCATGGTGGGATGGGGG + Intergenic
1033354072 7:140585468-140585490 CAGGAGCCCGGCAGGGCAGGTGG + Intronic
1033597563 7:142868039-142868061 CAGCAGCCCAGGTGGGGATGAGG + Exonic
1033607861 7:142940589-142940611 CTGGAGCCCAGGAGGGAGGGAGG - Exonic
1034188691 7:149197437-149197459 CTGCAGCCCTGGTAGGAATGTGG + Intronic
1034276603 7:149826559-149826581 TGGCTGCCCTGGAGGGCAGGTGG + Intergenic
1034960775 7:155362990-155363012 AACCAGGCCTGCAGGGAAGGCGG + Intronic
1034969235 7:155408877-155408899 AGAGAGCCCTGGAGGGAAGGTGG - Intergenic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035644820 8:1210748-1210770 CAGCACCCCTGCAGGGCACGTGG + Intergenic
1035648412 8:1246408-1246430 CAGCAGCCGCGGATGGCAGGAGG - Intergenic
1035702185 8:1644429-1644451 CAGCAGCCGTAGAGGCATGGAGG - Intronic
1036656770 8:10681955-10681977 CAGCAGCCTTGGCGGGCAGGAGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037339748 8:17831865-17831887 GGGCAGCGGTGGAGGGAAGGTGG - Intergenic
1039505904 8:38052132-38052154 CAGCAGCCCTGAAGGGACCTTGG + Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1042095711 8:65213771-65213793 AAGCAGACCTTGAGAGAAGGAGG - Intergenic
1042246391 8:66712754-66712776 CGGCGGCCCTGCCGGGAAGGAGG + Intronic
1044375364 8:91463962-91463984 AAGCAGCCCTGAAGAAAAGGAGG - Intergenic
1044798953 8:95933627-95933649 CAGCAGCCCAGCAGGGAGAGGGG - Intergenic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1045488829 8:102654775-102654797 CAGCAGCTGGGGCGGGAAGGTGG - Intronic
1046021844 8:108674832-108674854 ACGCAGCTCTGGAGGGGAGGTGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047964429 8:130035492-130035514 CAGCAGCCCTGGAGCTGAGGAGG - Intergenic
1048775012 8:137935961-137935983 CAGCAGCCCTGGGAGACAGGTGG + Intergenic
1048846789 8:138609857-138609879 CTGCAGCCCAGGAGGGAACCAGG - Intronic
1049152495 8:141044319-141044341 TTACAGCCCAGGAGGGAAGGAGG + Intergenic
1049212911 8:141394971-141394993 CAGCCTCCCTGGAGAGAGGGGGG + Intronic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1049420331 8:142513616-142513638 CAGCCGCCCAGGTGGAAAGGAGG + Intronic
1049449732 8:142654262-142654284 CAGCACCCCAGGAGGGCAGCAGG - Intergenic
1049476948 8:142801280-142801302 AGGCTCCCCTGGAGGGAAGGCGG - Intergenic
1049542515 8:143214998-143215020 CAGCAGCACTGGGGACAAGGCGG - Intergenic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1049766279 8:144356706-144356728 CAGCTGCCCTGCAGAGATGGGGG + Exonic
1049963985 9:762049-762071 CAGCGCACCTGGAGGGATGGTGG - Intergenic
1050025716 9:1332691-1332713 CAGCAACCTTGGAGGAAAAGAGG + Intergenic
1050625576 9:7500610-7500632 AAGCAGCCCTGGAGAGATGTCGG - Intergenic
1050651662 9:7783504-7783526 CAGCAACCCAGGAGAGAAGGTGG - Intergenic
1051162960 9:14229693-14229715 CTGAAGCCCGGAAGGGAAGGTGG - Intronic
1051475369 9:17501621-17501643 CTACTGCCCTGCAGGGAAGGGGG + Intronic
1053362813 9:37501398-37501420 CAGCAGCCCTGCTGGGCAGGCGG + Intronic
1055914789 9:81389916-81389938 CACCAGCCCTAGAGGGAAGAGGG + Intergenic
1055945490 9:81688557-81688579 CAGCTGCCCGGGCGGGGAGGCGG + Exonic
1056580225 9:87884680-87884702 CAGAGGCCCTGGTAGGAAGGAGG - Intronic
1056704399 9:88939762-88939784 TTGAAGACCTGGAGGGAAGGTGG - Intergenic
1056898261 9:90571856-90571878 CATCAGCCCTGGAGTGGAAGAGG - Intergenic
1057442704 9:95093461-95093483 ACGCTGCCCTGAAGGGAAGGAGG - Intergenic
1058820283 9:108723180-108723202 CAGATACCTTGGAGGGAAGGGGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059327420 9:113512659-113512681 CAGCAGCCCTGGCAGCGAGGGGG - Intronic
1060555968 9:124507317-124507339 CGGCAGCCCAGGTGGGACGGTGG + Exonic
1060798212 9:126526804-126526826 CAGCAGCTCTGGAAGGAATGGGG - Intergenic
1061014218 9:127972640-127972662 CTGCAGGCCTGGAGGCAGGGAGG + Intronic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061168626 9:128939161-128939183 CAGTTGCCCGGGAAGGAAGGAGG + Intronic
1061259381 9:129471423-129471445 CAGGAGCCCTGAAGGGTGGGTGG + Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1062000658 9:134214173-134214195 CCAGGGCCCTGGAGGGAAGGAGG + Intergenic
1062145993 9:134989956-134989978 CAACAGCCCTGGGGGAGAGGTGG + Intergenic
1062181440 9:135193243-135193265 CAGGAGCACTGAAGGGAGGGAGG - Intergenic
1062434169 9:136539152-136539174 CAGCAACCCTGGCAGGAAGAGGG - Intronic
1187257179 X:17654185-17654207 CAGGAGACCAGGATGGAAGGGGG - Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189318703 X:40074295-40074317 CAGCAGGCTGGGTGGGAAGGTGG + Exonic
1189475256 X:41347897-41347919 CAGCAGCCCTGTTCAGAAGGTGG + Exonic
1190159096 X:48017200-48017222 CAGCAGCCCTGTCAGGGAGGTGG + Intronic
1191615902 X:63168926-63168948 GAGCAGCCCCTGAGAGAAGGGGG + Intergenic
1191620396 X:63209997-63210019 GAGCAGCCCCTGAGAGAAGGGGG - Intergenic
1192146947 X:68688580-68688602 CTGCAGCCCTGGAGGGACACTGG + Intronic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1192966432 X:76182537-76182559 CAGCAGACCTGCAGGAGAGGGGG - Intergenic
1193262128 X:79420378-79420400 CAGCAACCCTCAATGGAAGGAGG - Intergenic
1195989486 X:110668412-110668434 CAGCTGCCCTGGAGGGATTTAGG + Intergenic
1196677190 X:118432119-118432141 AAGCAACTCTGGAGGTAAGGCGG + Intronic
1197105093 X:122703817-122703839 AAGCAGCCCAGCAGGGAAAGAGG + Intergenic
1198231181 X:134691159-134691181 CAGCAGCCCTGTAAGGTAGGTGG - Intronic
1199744144 X:150761400-150761422 CAGCCCTCCTGGAGGGAAGGGGG - Intronic
1200054767 X:153454503-153454525 CAGCAGCTGGGGAGGGAGGGAGG + Exonic
1200150307 X:153948143-153948165 CAGCAGCCCTGTTTGGGAGGCGG + Exonic
1200156861 X:153981388-153981410 CACCAGGCCGGGAGGCAAGGGGG - Intronic
1200243668 X:154511397-154511419 CTGCCGGCCTGGAGTGAAGGGGG + Intronic
1201730043 Y:17193010-17193032 CTGCTGCCCTGGAGTAAAGGCGG + Intergenic
1201943450 Y:19484011-19484033 CAACAGCCTGGGTGGGAAGGTGG + Intergenic