ID: 900536425

View in Genome Browser
Species Human (GRCh38)
Location 1:3179912-3179934
Sequence ATCCGGTGGCAGCCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900536425_900536434 29 Left 900536425 1:3179912-3179934 CCTTCCCCAGGCTGCCACCGGAT 0: 1
1: 0
2: 0
3: 12
4: 210
Right 900536434 1:3179964-3179986 ACGAATGACAAGGTTCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 159
900536425_900536433 26 Left 900536425 1:3179912-3179934 CCTTCCCCAGGCTGCCACCGGAT 0: 1
1: 0
2: 0
3: 12
4: 210
Right 900536433 1:3179961-3179983 TTAACGAATGACAAGGTTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 76
900536425_900536432 19 Left 900536425 1:3179912-3179934 CCTTCCCCAGGCTGCCACCGGAT 0: 1
1: 0
2: 0
3: 12
4: 210
Right 900536432 1:3179954-3179976 AAAGACATTAACGAATGACAAGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900536425 Original CRISPR ATCCGGTGGCAGCCTGGGGA AGG (reversed) Intronic
900536425 1:3179912-3179934 ATCCGGTGGCAGCCTGGGGAAGG - Intronic
900623819 1:3599152-3599174 CTGCGGGGCCAGCCTGGGGAGGG + Intronic
902059431 1:13629702-13629724 ATCAGTTGGCAGCCTGCTGAGGG - Intergenic
902256625 1:15193263-15193285 AGGCAGTGGCAGCCTGGAGAGGG - Intronic
902788798 1:18751038-18751060 AGTCAGTGGCAGCCTAGGGAGGG - Intergenic
903362019 1:22782893-22782915 AGGGGCTGGCAGCCTGGGGAGGG - Intronic
903981093 1:27188827-27188849 ATCCTGTGGGAGGCTGAGGAGGG - Intergenic
904538782 1:31218866-31218888 AGCTAGCGGCAGCCTGGGGACGG + Intronic
904672282 1:32174767-32174789 CTTCCCTGGCAGCCTGGGGAAGG + Exonic
904873533 1:33636339-33636361 AGGTGGTGGAAGCCTGGGGATGG - Exonic
906039431 1:42776547-42776569 ATCGGGGGGCGGCCCGGGGAGGG - Intronic
906264948 1:44421593-44421615 ATGGGGGGGCTGCCTGGGGAGGG + Intronic
912320713 1:108710152-108710174 AATCAGTGGCTGCCTGGGGATGG - Intergenic
912532471 1:110336196-110336218 ATCTGCTGGAAGCCAGGGGAGGG + Intergenic
912553165 1:110497523-110497545 ACTGGGTGGCAGCCTGGGTATGG + Intergenic
916398581 1:164420127-164420149 ATCAGTTGGCAGCCTGGGATTGG - Intergenic
919866926 1:201789515-201789537 ATTCTCTGGCAGCCTGGGTATGG - Intronic
920084415 1:203404902-203404924 AGCAGGTGACAGCCTGGGGTTGG + Intergenic
920108129 1:203568924-203568946 CTGAGGAGGCAGCCTGGGGAAGG - Intergenic
921693876 1:218184607-218184629 TTCCGGTGGCAGACTGAAGAAGG - Intergenic
921784752 1:219216796-219216818 TTCAGATTGCAGCCTGGGGAGGG - Intergenic
924246878 1:242093801-242093823 CTTCGGGGGCAGCCTGGGGTGGG + Intronic
1062951541 10:1507396-1507418 CTCCGGATGCAGCCTGGTGAAGG - Intronic
1067036682 10:42926004-42926026 AGCAGGGGGCAACCTGGGGAAGG - Intergenic
1069944869 10:71978899-71978921 ATGGGGAGGCATCCTGGGGAGGG - Intronic
1070821345 10:79356925-79356947 ATCCAGTGGCTGCCTGGGAAGGG - Intergenic
1070823148 10:79374988-79375010 AGGCTGTGGCTGCCTGGGGAGGG + Intergenic
1070877268 10:79826032-79826054 GTCCGGGGGCAGCGTGGGGGAGG - Intergenic
1071643765 10:87342076-87342098 GTCCGGGGGCAGCGTGGGGGAGG - Intergenic
1072429761 10:95360504-95360526 ATCAGTTGGCAGCCTGGGATTGG - Intronic
1073119230 10:101111392-101111414 GACAGGTGGCAGCCTGAGGAGGG + Intronic
1073251108 10:102120751-102120773 ATCCGGCGGCACCCGGAGGACGG - Intergenic
1073301917 10:102476014-102476036 TGCTGCTGGCAGCCTGGGGAAGG + Exonic
1073526609 10:104188984-104189006 ATCTGCTGACCGCCTGGGGAAGG - Intronic
1074047169 10:109849786-109849808 ATTAGGTGGCAGCCAGGTGAGGG - Intergenic
1076086618 10:127637575-127637597 ATCTGGTGGCAGCCATGGGCAGG + Intergenic
1076667017 10:132099041-132099063 ATTCGGGGGCATCCTGGGGTGGG - Intergenic
1076681512 10:132174195-132174217 AGCAGGAGGCAGCTTGGGGATGG - Intronic
1077464167 11:2725693-2725715 AGCCGAGGGCAGCCTGGGGAAGG + Intronic
1077947853 11:6921725-6921747 ATCCAGATGCAGTCTGGGGAAGG + Exonic
1078066431 11:8081802-8081824 ACCATGTGGCCGCCTGGGGAAGG + Intronic
1079108210 11:17587843-17587865 ATGAGGTGGGAGACTGGGGATGG + Intronic
1080896914 11:36455184-36455206 TTCAGGTGCCAGCCTGGAGAGGG + Intronic
1084025951 11:66449666-66449688 AGGTGGTGGCAGCCTAGGGAGGG - Intronic
1089766758 11:120773519-120773541 ATGCAGTGGCAGCCTGGAGTGGG + Intronic
1091040025 11:132268861-132268883 CTCAGTGGGCAGCCTGGGGAAGG + Intronic
1094751703 12:33416989-33417011 ATGTGGTGGGAGCCTGTGGAAGG + Intronic
1095144753 12:38712501-38712523 AATTGGTGGCAGCCTGGGCATGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1099989779 12:89709370-89709392 ATCCGCGGGGAGCCTGGGGGCGG + Intergenic
1100677827 12:96887291-96887313 ATCCTGTGGCAGTCTGGGCAGGG + Intergenic
1102541542 12:113622936-113622958 GACCAGTGGCTGCCTGGGGATGG - Intergenic
1104822005 12:131682494-131682516 GTCCAGTGGCTGCCTGGGGGAGG - Intergenic
1105920509 13:24958946-24958968 AGCCGGGGGCAGAGTGGGGAGGG + Intergenic
1113293590 13:108932861-108932883 ATCAGGTGGCAGTCTGTGGGGGG + Intronic
1116935165 14:50732292-50732314 AACGGGTGGCAGGCTGGGCAGGG - Intronic
1117325810 14:54668003-54668025 ATCTGGTGGCAGCCTGCGGGAGG - Intronic
1117527616 14:56625448-56625470 AACCGGTGGAATCCTGTGGAAGG + Exonic
1118320301 14:64748840-64748862 ACCTGGTGGCAGCCAGGGAAAGG - Exonic
1119265959 14:73263448-73263470 AGCCGGGGGCAGGTTGGGGAGGG + Intronic
1119479212 14:74949323-74949345 ATTCGGTGGCCCCCTGGGCAGGG + Intronic
1121559224 14:94862178-94862200 AAGCGGTGTCAGCCTGCGGATGG + Intergenic
1121999399 14:98634469-98634491 ATTCACTGGCAACCTGGGGATGG + Intergenic
1122785203 14:104160343-104160365 ATCAGGGGGCAGCCTGAGGCTGG - Intronic
1125390818 15:39190981-39191003 ACTCACTGGCAGCCTGGGGAAGG - Intergenic
1125414890 15:39442120-39442142 ATCTGCTGCCAGACTGGGGAGGG + Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1129296980 15:74604946-74604968 CTCCTGTGGCTGACTGGGGAGGG + Intronic
1134019979 16:10914921-10914943 CTCCCGCCGCAGCCTGGGGAAGG - Intronic
1134264615 16:12682474-12682496 AAGCAGTGGCAGCCTGGGGTGGG + Intronic
1134406068 16:13959731-13959753 GTCCTGTGGCCGCCTGGGGTGGG - Intergenic
1136544244 16:30947042-30947064 AGGCGGTGGCAACCTGGGGATGG - Exonic
1137676970 16:50308589-50308611 GGTCGCTGGCAGCCTGGGGAGGG - Intronic
1138002655 16:53298210-53298232 TTCCAGTGGCACCATGGGGAAGG + Intronic
1138497679 16:57418093-57418115 ATCCGGTGCAAGCTGGGGGATGG + Intergenic
1138567526 16:57844525-57844547 ATCAGGATGCACCCTGGGGAGGG + Intronic
1139798270 16:69500252-69500274 ATGCTGTGGCATCTTGGGGAGGG + Intergenic
1140034891 16:71364477-71364499 ATCCGCCGGCAGGCTGGGGCTGG - Intronic
1140218150 16:73024615-73024637 ATCCAATGGCAGCCTTGGGCTGG + Intronic
1140222443 16:73053749-73053771 AGCCTGTGGCTGCCTGGGGAAGG - Intronic
1140625708 16:76791965-76791987 ATCAGGTAGCAGCATGTGGAAGG + Intergenic
1141999822 16:87657917-87657939 AGCTGGTGGCTGCCAGGGGATGG + Intronic
1142201941 16:88765257-88765279 ACTCGGAGGCAGCCTGGAGAGGG + Intronic
1142850135 17:2700823-2700845 ACCCTGTGGCAGGCAGGGGAGGG + Exonic
1143583842 17:7841801-7841823 AGCCGGGGGAAGGCTGGGGAAGG + Intronic
1143604189 17:7971965-7971987 AGTCGATAGCAGCCTGGGGATGG + Intergenic
1144779056 17:17798824-17798846 CTCCGGTGACAGCATGGGGAGGG - Intronic
1144827631 17:18115211-18115233 AACCGCTGGCAGCCTGGTGCAGG + Intronic
1146287935 17:31586920-31586942 ATCTGGTGGCAGGCCTGGGAAGG - Intergenic
1146478465 17:33182150-33182172 ATACGGTGACAGCCTGGAGCAGG + Intronic
1146633663 17:34488381-34488403 ATCAGGTGCCAGACTTGGGAAGG - Intergenic
1148472941 17:47906857-47906879 ATGAGTTGGCAGCCTGTGGAAGG + Intronic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1149538553 17:57451501-57451523 TTCAGGTGCCAGCCTGGGCATGG + Intronic
1149644942 17:58233814-58233836 CTCTGGTGGAAACCTGGGGAGGG - Intronic
1149700167 17:58648600-58648622 CTCTGGTGGCAGCTTGGGGTAGG + Intronic
1151590369 17:75039823-75039845 CTACAGTGGCTGCCTGGGGATGG - Intronic
1151599884 17:75099790-75099812 ATGCCCTGGCAGCCTTGGGAGGG + Intronic
1151872210 17:76844033-76844055 ATCTGGTGGCCTCCTGGGGAAGG + Intergenic
1152467462 17:80474287-80474309 ATACTGTGGCACCCTGGGTATGG + Intronic
1160672804 19:374183-374205 ATGTGGTGGCAGCTGGGGGAGGG + Intronic
1161219838 19:3113498-3113520 CACCGCTGGCGGCCTGGGGACGG + Intronic
1161321704 19:3644406-3644428 AACCGGGGTCTGCCTGGGGAGGG + Intronic
1161730444 19:5957298-5957320 ATGAGCTGGCAGCCTGTGGAAGG - Intronic
1162334702 19:10053116-10053138 ATCAGGTTGTAGTCTGGGGAAGG - Intergenic
1163035243 19:14565903-14565925 ACCCGGTGGCATTCTGGGGGAGG + Exonic
1163410211 19:17149405-17149427 ATATGATGGGAGCCTGGGGAAGG - Intronic
1165510813 19:36265805-36265827 ACCCGGTGGCAGGGTGGGGGTGG + Intergenic
1166819694 19:45570065-45570087 CGCCCGTGTCAGCCTGGGGATGG - Intronic
1166938528 19:46349508-46349530 ATCCGGTGGGAGCCGTGAGAGGG + Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
1167793681 19:51695545-51695567 ATCCAGGGCCAGCCTGGAGAAGG + Intergenic
1168563506 19:57403609-57403631 ATGGGGTGGCTGCCTGGGGCTGG - Intronic
925035258 2:680166-680188 ACCCAGAGGCAGCCTTGGGAGGG + Intergenic
927702608 2:25277419-25277441 ATCAGGTGGCGGCCTGGGGGCGG + Intronic
933614407 2:84469562-84469584 TGCCTGTGGCAGCGTGGGGAAGG + Intergenic
937161435 2:119766122-119766144 ATCCTGGGGCAGGGTGGGGAGGG - Intronic
942657183 2:178226141-178226163 ATGCAGTGACAGCCTGGGTAGGG + Intronic
943266403 2:185738435-185738457 AAGCTGTGGGAGCCTGGGGATGG + Intergenic
943780885 2:191822491-191822513 ATCCTGTGGCAGGCAGGGAAAGG - Intergenic
945976978 2:216278513-216278535 ATCTGGGGGCAGGCTGGGCATGG - Intronic
946379296 2:219333834-219333856 ATCCTGTGGCAGTCTGGTTAGGG + Intergenic
946504822 2:220287660-220287682 ATCCAGTGTTAGCCAGGGGATGG + Intergenic
948724196 2:239921809-239921831 ATCTGGGGGCAGGGTGGGGACGG + Intronic
1169217535 20:3802176-3802198 GGCAGGTGGCAGCCTGGGCATGG + Intronic
1169219886 20:3815949-3815971 ATCCAGCGGCAGACAGGGGAAGG - Intergenic
1172844464 20:37921449-37921471 CTCTGGTGGCAGGCAGGGGAAGG - Intronic
1172883271 20:38215325-38215347 ATAGGCTGGAAGCCTGGGGATGG - Intronic
1173740174 20:45394793-45394815 ATGGGGTGGCAGCCTGGCGCTGG - Intronic
1175472898 20:59245399-59245421 TTCGGGTGCCTGCCTGGGGATGG - Intronic
1176101072 20:63364828-63364850 AGCCAGTGGCAGCCTGGAGTTGG - Intronic
1177799835 21:25817882-25817904 ATCAGTTGCCAGACTGGGGATGG - Intergenic
1179890378 21:44332186-44332208 AGCCTGTGCCAGGCTGGGGATGG - Intronic
1180145563 21:45916720-45916742 GCCTGGTGGCAGCCTGGGGGTGG - Intronic
1180175017 21:46083135-46083157 ATGTGGTGGCAGGCGGGGGAGGG - Intergenic
1181277934 22:21698498-21698520 CACCCGTGGCAGGCTGGGGACGG + Exonic
1181830817 22:25558919-25558941 CTCTGGTGGCTCCCTGGGGAGGG + Intergenic
1182097708 22:27637308-27637330 ATCAGGTGGCAGCCGGGGACAGG + Intergenic
1183700740 22:39449601-39449623 ACCTGGGGGCTGCCTGGGGAAGG + Intergenic
1183786394 22:40031386-40031408 TTAGGGAGGCAGCCTGGGGAAGG + Exonic
1185222426 22:49635851-49635873 TTCCGGAGGGAGCCTGGGGACGG + Intronic
1185222460 22:49635932-49635954 TTCTGGAGGGAGCCTGGGGAGGG + Intronic
1185372092 22:50465655-50465677 AGCCGGGGCCAGCCTGGGGGTGG + Intronic
950614442 3:14147820-14147842 ACACGGAGGCGGCCTGGGGAAGG + Intronic
952889303 3:38029967-38029989 ATCCGGCGTCATCCCGGGGAAGG + Intergenic
953525976 3:43690617-43690639 GTCAGGTGGCACCTTGGGGACGG - Intronic
954432474 3:50478215-50478237 CTCAGCTGCCAGCCTGGGGAGGG + Intronic
955305094 3:57822616-57822638 ATCCTGTAGCAGCCAGGTGATGG + Intronic
958109021 3:89115033-89115055 ACCAGGTGACAGCCAGGGGAAGG + Intronic
960372870 3:116862578-116862600 TTCCATTGGCAGCCAGGGGAAGG - Intronic
960941457 3:122937679-122937701 ACCTGGTGTCAGCCTGGGGCAGG - Intronic
961457931 3:127033443-127033465 CTCCTGTGGCACCCTGGGGAAGG - Intronic
961471163 3:127113882-127113904 ATCTGGAAGCAGCCAGGGGAGGG + Intergenic
961579838 3:127871591-127871613 AACCCGTGGCTGCCTGGGGCTGG - Intergenic
968452858 4:683322-683344 AGCAGGTGGCAGCCAGGGCAAGG + Exonic
968966319 4:3770739-3770761 ATGGGGTGCCAGCATGGGGAGGG + Intergenic
969080724 4:4615962-4615984 ATCTGGAGGCAGCGAGGGGAAGG - Intergenic
969094003 4:4718606-4718628 ATCAAGGGGCAGCCTGTGGATGG - Intergenic
969114540 4:4862956-4862978 AGCCGGTGGCAGCATGGGCTTGG - Exonic
969453940 4:7290482-7290504 TTCTGTTGGCAGCATGGGGAAGG - Intronic
969621500 4:8281090-8281112 CTCCAGGGGCAGCCAGGGGAAGG - Intronic
969898363 4:10325710-10325732 AGCAGGAGGCAGCCTGAGGATGG + Intergenic
971742255 4:30535673-30535695 ATCCAGTGGCAGTCTTGGTAAGG - Intergenic
972430586 4:38977890-38977912 ATCCGAGGGCTGCCTGGGCATGG - Intronic
974866114 4:67582596-67582618 ATCTGGTAGAAGCCTGGGCATGG - Intronic
976602303 4:86949612-86949634 ACCCGGTGGCATTCTGGGGGAGG - Intronic
978296771 4:107214549-107214571 ATCCGTTGGCAGCATGGAGTGGG + Intronic
979195705 4:117917426-117917448 AGCAGGTGCCAGCTTGGGGAGGG - Intergenic
981528463 4:145730998-145731020 GTGCGGTGGCAGACTGTGGAGGG + Intronic
982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG + Intronic
982276284 4:153639859-153639881 ATCTGGTGGGAGGCAGGGGATGG + Intergenic
984186169 4:176546273-176546295 AACCAGTGGCATCCTGGTGAGGG - Intergenic
985589777 5:758460-758482 ACCAGGAGACAGCCTGGGGATGG + Intronic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
994186831 5:96824289-96824311 ATCCACTGGCAGCCTGGGTTGGG + Intronic
997649863 5:135508473-135508495 ATCAGGTGGCAGCCAGGGCTCGG + Intergenic
997654543 5:135545411-135545433 CCCCTGTGGCTGCCTGGGGATGG + Intergenic
999099469 5:149011179-149011201 GTTAGGTGGCAGCCTGGGGTTGG + Intronic
999622981 5:153490975-153490997 GTGAGGGGGCAGCCTGGGGAGGG + Intronic
999871392 5:155755004-155755026 CAGAGGTGGCAGCCTGGGGAGGG - Intergenic
1001287441 5:170434437-170434459 ATCGGGTGGCATCCTGGATAGGG + Intronic
1001299402 5:170523171-170523193 TTCCGGTGGCAGGGTGGGGCAGG - Intronic
1001489334 5:172144659-172144681 ATTCGAAGGAAGCCTGGGGAAGG + Intronic
1002093721 5:176818810-176818832 GTCAGGAGGCAGCATGGGGATGG - Intronic
1003364726 6:5461539-5461561 AACAGGTGGCTGCCTGGGGCTGG - Intronic
1007356443 6:41321329-41321351 AGCAGATGGCAGCCTGGAGAGGG - Intergenic
1008224540 6:48898049-48898071 TTCTGGTGGCAGGGTGGGGATGG - Intergenic
1011908302 6:92402165-92402187 ATGGGGTGGGAGGCTGGGGAAGG - Intergenic
1016324051 6:142879732-142879754 AGACTGTGGAAGCCTGGGGAGGG - Intronic
1018060007 6:160082829-160082851 CTCCTGAGGCAGCATGGGGAAGG + Intronic
1018078153 6:160234459-160234481 CTCCTGTGGCAGGGTGGGGAAGG - Intronic
1023217934 7:37885412-37885434 ACCCAGTGACAGCCTGAGGATGG + Intronic
1030107772 7:106000981-106001003 TTCTGGTGGCAGCCATGGGATGG + Intronic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1032524917 7:132572765-132572787 ATCAGGTGGGAGTCTGGGGAGGG + Intronic
1033221869 7:139532322-139532344 ATCCAATGGCTGCCTGAGGAAGG - Intronic
1034567789 7:151929393-151929415 CTCCGGGGCCAGCCTGAGGAAGG - Intergenic
1034630400 7:152526087-152526109 CTCCCCTGGCAGCCAGGGGAGGG - Intergenic
1034715810 7:153240237-153240259 AGCCGGTGGCAGGCTGGGCTGGG + Intergenic
1035722864 8:1805294-1805316 ATCTGGGGGCAGGGTGGGGAGGG - Intergenic
1039342489 8:36666483-36666505 ATAGGGTGGGAGGCTGGGGAAGG - Intergenic
1039400767 8:37267054-37267076 AGCTGGTTTCAGCCTGGGGAGGG + Intergenic
1039478508 8:37854788-37854810 ATCTGGTGGGAGTCTGGTGAAGG - Intergenic
1045111887 8:98944432-98944454 GGCCTGGGGCAGCCTGGGGAGGG + Exonic
1049498364 8:142947320-142947342 AGCCCATGGCAGGCTGGGGAGGG - Intergenic
1050755756 9:9001257-9001279 ATCCCCTTGGAGCCTGGGGAAGG + Intronic
1051045193 9:12864953-12864975 AGCAGGTGGGAGGCTGGGGAGGG - Intergenic
1051265885 9:15307608-15307630 ATGCGGTGGCCACCTGGCGAGGG - Intergenic
1055883591 9:81032389-81032411 ATCCGTTGGCAGCCTGTGATTGG - Intergenic
1057825765 9:98371099-98371121 CATCCGTGGCAGCCTGGGGATGG - Intronic
1061819473 9:133218200-133218222 ATCCAGTGCCAGCCTGGAGGTGG + Intergenic
1061929760 9:133826474-133826496 CTCCGGTGGCTGCATGAGGAGGG - Intronic
1062049685 9:134440852-134440874 ATGCTTAGGCAGCCTGGGGAGGG - Intergenic
1062160649 9:135077768-135077790 ATCAGAAGCCAGCCTGGGGAAGG - Intronic
1062405202 9:136392940-136392962 CCCCGGTGGCAGCCTGGAGGTGG - Intronic
1062500275 9:136849133-136849155 GTCCGGTGGCACCCTTGGAACGG - Exonic
1186885767 X:13912041-13912063 ATGTGGTTGGAGCCTGGGGAAGG - Intronic
1189288025 X:39865996-39866018 ACAGGGTGGCAGCCTTGGGAGGG + Intergenic
1191849570 X:65576068-65576090 ATCAGGTGGCAGAATTGGGAAGG - Intergenic
1192146487 X:68686315-68686337 ATCCGCGGGGAGCCCGGGGAGGG - Intronic
1193705845 X:84819896-84819918 AGCCTGTGGCAGGGTGGGGAAGG + Intergenic
1198255241 X:134918695-134918717 ATCTACTGGCAGCCTGGGTAGGG - Intergenic
1200152887 X:153959883-153959905 GTGCGGGGGCAGCCTGGGGCAGG + Exonic