ID: 900537601

View in Genome Browser
Species Human (GRCh38)
Location 1:3186560-3186582
Sequence CTGGCCGCGCCTCCCGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900537601 Original CRISPR CTGGCCGCGCCTCCCGCCTC GGG (reversed) Intronic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
900610733 1:3543566-3543588 CTCGCCCCGCCTCCCGCCCGGGG - Intronic
900631901 1:3640912-3640934 CTGGCCGAGGCTCCCCACTCAGG + Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
901922900 1:12548876-12548898 GTGGCGGCGGCTCCCGCCCCAGG - Intergenic
902169591 1:14599139-14599161 CTGGCCGCGGCTCCCGGGCCCGG - Exonic
902662639 1:17915841-17915863 CTGGACCCTCCTTCCGCCTCTGG + Intergenic
902916929 1:19644823-19644845 CGCGCCGCGCCTCTCGGCTCTGG + Intronic
903588812 1:24438587-24438609 CTGGCCGAGGCTTCCCCCTCAGG - Intronic
904237373 1:29123949-29123971 CCGGCCCCGCCTCCAGCCCCCGG + Intergenic
904770292 1:32877444-32877466 CTGGCCCAGCCTCTGGCCTCAGG + Intergenic
905308388 1:37034075-37034097 CTGGCGGCGCCTCCGGAGTCTGG - Exonic
905726562 1:40257708-40257730 TGGGCCGCGGCTCCCGCCTGAGG - Intergenic
907491854 1:54813668-54813690 CTGGCCCGGCCTCCGGCCTCCGG + Intronic
910200109 1:84690450-84690472 CTCGCAGCGCCTCCCGCCCGCGG + Exonic
912497111 1:110098734-110098756 CTGGCCCTGCCTCTCCCCTCTGG - Intergenic
915440494 1:155942642-155942664 CCTGCCGGGGCTCCCGCCTCAGG - Exonic
915747773 1:158177932-158177954 CTGGCCCCGCGCCCCGCCCCAGG + Intergenic
916210780 1:162357966-162357988 CTGACCCTGCCTCTCGCCTCAGG - Intronic
917202530 1:172532879-172532901 CTCGCCGCTCCGCCCGCCCCAGG - Intronic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
917846884 1:179026610-179026632 GTTGCCCCGCCTTCCGCCTCCGG - Intronic
920021318 1:202958413-202958435 CCGGCCACACCTCCCGCCCCGGG + Intronic
920409575 1:205749366-205749388 CAGGCCCCGCCTCCCGGATCGGG - Intronic
923683999 1:236142032-236142054 CCAGCCGCGCCCCGCGCCTCGGG - Intergenic
1065131539 10:22625729-22625751 GTGGCCCTGCCTCCTGCCTCTGG - Intronic
1065483515 10:26216311-26216333 CCGCCCGCACTTCCCGCCTCTGG + Exonic
1067071888 10:43138496-43138518 CGGGCGGCGCCTCACGCCTTGGG - Exonic
1067455842 10:46418746-46418768 ATGGCCAGGCCTCCGGCCTCAGG - Intergenic
1067631358 10:47965893-47965915 ATGGCCAGGCCTCCGGCCTCAGG + Intergenic
1068560803 10:58512837-58512859 CTGCCCGCGCCTCCATCCGCAGG - Intergenic
1070745720 10:78932550-78932572 ATGGCCGCCCCTTCCCCCTCTGG + Intergenic
1070956635 10:80468150-80468172 CTGGCCCAGCCTCCATCCTCTGG + Intronic
1072710897 10:97714853-97714875 CTGGCCCCTCATCCAGCCTCCGG + Exonic
1075016565 10:118914015-118914037 CTGGCTGTACCTCCCTCCTCCGG + Intergenic
1075865970 10:125719614-125719636 CCGGCCCCGCCTCCCGCTGCGGG - Exonic
1076610359 10:131722412-131722434 CTGGCCGACCTTCACGCCTCTGG - Intergenic
1076630107 10:131847239-131847261 GTGGGCGCCCCTTCCGCCTCTGG + Intergenic
1076724638 10:132407692-132407714 CTGGCTGCTCCCCCCGCCCCAGG + Intronic
1076919993 10:133446351-133446373 CCCACCGCGCCCCCCGCCTCGGG + Intergenic
1077093630 11:790279-790301 CGGGACCCGCCTCCTGCCTCTGG - Intergenic
1077170991 11:1165630-1165652 CTGGCAGCTCCACCGGCCTCCGG - Exonic
1077332037 11:1988075-1988097 CTGGCTGAGCCTCCCACATCTGG - Intergenic
1078594384 11:12674319-12674341 CAGGCCCCGCCTCCAGCCCCGGG + Intergenic
1078681928 11:13485495-13485517 CTGGCTGCCCCTCCTGGCTCAGG - Intergenic
1080638767 11:34146303-34146325 CTGGCCGCGAATTCGGCCTCTGG + Exonic
1081873038 11:46391847-46391869 GGGGCCGCGCCGCCCGCCCCGGG + Intergenic
1083296197 11:61716956-61716978 CTGGGGGCTCCTCCTGCCTCTGG - Intronic
1084274113 11:68043140-68043162 CTGGCCCCGCCTCCTCCTTCAGG + Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1089244749 11:117110714-117110736 CGGCCGGCGCCTCCCGCCCCGGG - Intergenic
1089496182 11:118909725-118909747 CTGGCTGCGCCTCCTGCCTCGGG + Intronic
1089789027 11:120929232-120929254 CTGCCCACGCCACCCGCCGCGGG - Intronic
1090405472 11:126473491-126473513 CAGGCCGAGGCTCCCACCTCGGG + Intronic
1202815018 11_KI270721v1_random:43251-43273 CTGGCTGAGCCTCCCACATCTGG - Intergenic
1091690012 12:2589542-2589564 CTGCCCCGGCCTCTCGCCTCAGG - Intronic
1097109242 12:56645920-56645942 GTGGCCGCTGCTCCGGCCTCCGG - Exonic
1097981723 12:65742461-65742483 CTGGCCCGGCCTCCCCCCGCCGG - Intergenic
1098595953 12:72273103-72273125 CTGGCCACCCCACCCGCCTCGGG - Exonic
1102029040 12:109729470-109729492 CAGGCCCTGCCTCCTGCCTCTGG - Intronic
1102278188 12:111598789-111598811 CAGGCCGGGCCTCCCGCCGCCGG + Exonic
1102962064 12:117099358-117099380 CTGGCCTCGGGTCCGGCCTCGGG + Exonic
1103604858 12:122078965-122078987 CCGTCCCCGCCGCCCGCCTCCGG + Exonic
1103700992 12:122848699-122848721 CGGGCTGTTCCTCCCGCCTCGGG + Intronic
1103764745 12:123271923-123271945 GCGGCCGCGCCCCGCGCCTCCGG + Exonic
1104044369 12:125151491-125151513 CTGGCCTCTCCTCCTGCCGCAGG - Intergenic
1105512460 13:21061684-21061706 CCGGCCGTGCTTCCTGCCTCCGG + Intergenic
1105913242 13:24890771-24890793 ATGCCTGCACCTCCCGCCTCTGG + Intronic
1113615982 13:111681030-111681052 CTGGCCAGCCCACCCGCCTCAGG - Intergenic
1113621450 13:111765923-111765945 CTGGCCAGCCCACCCGCCTCAGG - Intergenic
1114269022 14:21090391-21090413 CCCGCCGCGCCTTCCACCTCTGG + Exonic
1118908703 14:70043339-70043361 CTGGCTGTGCCTCCTGCCTTGGG + Intergenic
1120229780 14:81829718-81829740 CTGGCCGCCCCACCAGCCCCGGG - Intergenic
1120881221 14:89416799-89416821 TCGGACGCGCCTCCCGCCCCGGG + Intronic
1121565842 14:94908523-94908545 CTGGGCGCTTCTCCCACCTCTGG + Intergenic
1122781065 14:104143780-104143802 CTGGCAGTGGCACCCGCCTCGGG + Intronic
1124628851 15:31326187-31326209 GTGGCCGCGCCTAGAGCCTCAGG - Intergenic
1126848675 15:52784878-52784900 CTGGCGGCGCCCCTCGCCCCGGG + Intronic
1128067884 15:64775653-64775675 CCGGCCCCGCCCCCCGCCGCCGG - Intergenic
1128769949 15:70274475-70274497 CTGGCCCAGCCTCTGGCCTCTGG + Intergenic
1131108468 15:89750170-89750192 CTGGATGCCCCTCTCGCCTCTGG - Exonic
1131177279 15:90217896-90217918 CTGCTCCCACCTCCCGCCTCTGG - Intronic
1132563858 16:611511-611533 CTTCCCGCACCTCCCTCCTCCGG - Intronic
1132565011 16:618089-618111 CTGGCCGCCCCGCTCCCCTCAGG + Intronic
1132568416 16:633657-633679 CCTGCCGCGCCTGCCGCCTCCGG + Exonic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1133283752 16:4681158-4681180 CTGACCGTGTCTCTCGCCTCTGG + Intronic
1133286748 16:4694253-4694275 CGGGCCCCGCCCCCCGCCCCGGG + Intronic
1133784419 16:8963586-8963608 CGGGGCCCGCCTCCCGCCGCCGG + Intronic
1133809014 16:9146903-9146925 CTGGGCTCACCTCCAGCCTCTGG + Intergenic
1136318630 16:29468197-29468219 CAGGCCCCTCCTCCCTCCTCTGG - Intergenic
1136433202 16:30207543-30207565 CAGGCCCCTCCTCCCTCCTCTGG - Intronic
1137375174 16:47946275-47946297 CTGGCCGCCTCTCCCACCCCTGG - Intergenic
1137731478 16:50693604-50693626 CGGGCCACGACTCCCGGCTCCGG - Intronic
1138202628 16:55101403-55101425 CTGGCTGCCCCACCCACCTCCGG + Intergenic
1138574357 16:57897985-57898007 CTTGCCGGACCTCCAGCCTCTGG - Intronic
1139319860 16:66105675-66105697 CTGGCAGAGCCTCCTGCTTCGGG - Intergenic
1140442609 16:74999223-74999245 CCGGGCGCGTCCCCCGCCTCAGG - Exonic
1140476549 16:75242029-75242051 CTGGCCGCCCCTGCCTCCACAGG - Intronic
1142325299 16:89411050-89411072 CTGGCCGCCCCTCCCTCTGCAGG - Intronic
1142812355 17:2401217-2401239 CTGGCCCCGCCCCCCGGATCCGG + Intergenic
1143474723 17:7196085-7196107 CTGGCTGCGCCTCAGGCCTGGGG + Intronic
1146438992 17:32877159-32877181 CTGGTCCCGCCTCCAGCCTGGGG + Exonic
1150983485 17:70169421-70169443 CTGGCCGCGCGGCCGGCCCCGGG - Intronic
1151582428 17:74987942-74987964 CGGGCCGGGCCTCCAGCGTCGGG - Exonic
1151660534 17:75515999-75516021 CGGACAGCGCCTCCCGCCCCCGG + Intergenic
1151679407 17:75615671-75615693 CTGGCTGCTCCTCCTGCTTCAGG + Intergenic
1151797020 17:76353412-76353434 AGGCCCGCGCCTCCCGCCCCAGG + Intronic
1151954930 17:77375411-77375433 CTGGCCTCCCCTCCCGCCACAGG - Intronic
1151961862 17:77409769-77409791 CTGGCCGCGGCGCGCCCCTCCGG - Intronic
1152258107 17:79252053-79252075 CTGACCACGCCTCATGCCTCTGG + Intronic
1152648602 17:81481693-81481715 CGGGCCGCGCCCCCGCCCTCCGG - Intergenic
1152724115 17:81936914-81936936 CTGGCCGCTCCTCCCGCAGCCGG + Intronic
1152736752 17:82000992-82001014 CTGCCTGCCCCTCCCGCCTCGGG + Intronic
1152820678 17:82436172-82436194 CTGGCTGCTCCTCCAGCCCCTGG + Intronic
1153070365 18:1098323-1098345 CTGGCCGGCCCGCCAGCCTCGGG + Intergenic
1153805647 18:8706468-8706490 CTCGCCGCGCCCCTCGCCGCGGG + Intronic
1154217153 18:12423624-12423646 CTGGCCGCACCTTCAGCTTCAGG - Intronic
1155392204 18:25349892-25349914 CTGCCCGCGCGCCCCTCCTCCGG + Intronic
1156149085 18:34222738-34222760 CTGGCCTCCCTCCCCGCCTCGGG - Intronic
1160223775 18:76996991-76997013 TTGGCCTCTCCTTCCGCCTCGGG + Intronic
1160680720 19:410746-410768 CAGGACCCTCCTCCCGCCTCAGG - Intergenic
1160769042 19:822122-822144 CTGGCGCCGCCTCCCACCGCCGG + Intergenic
1160859098 19:1230194-1230216 CCGGCCGGCCATCCCGCCTCTGG + Exonic
1160909238 19:1467255-1467277 CCGGCCCCTCCTCCCGCCGCCGG - Exonic
1161087438 19:2341516-2341538 CTGGCCGGGCCTCCCCCATGAGG + Intronic
1161160915 19:2761506-2761528 CTGCCCACGCCTCCCGTCTGAGG + Exonic
1161251864 19:3285062-3285084 CTAGCCGCGCCTCCTACCTCTGG + Intronic
1161560273 19:4969209-4969231 CGGGCCGCGCACGCCGCCTCAGG + Exonic
1162131746 19:8530273-8530295 CGGGCCGCTCCTCCAGCCCCAGG + Exonic
1162657184 19:12140073-12140095 CTCGCCGCGCCTCCTGGATCTGG - Intronic
1163116001 19:15188938-15188960 CTGTCCCCGCCCCCTGCCTCAGG + Intronic
1163220030 19:15912025-15912047 CTGAGCGCGGCTCCCGGCTCAGG + Intergenic
1163828790 19:19538122-19538144 CTGGCTGTGCCTCCGTCCTCAGG - Intergenic
1164619709 19:29687348-29687370 CTGGCTGCGCCTCTGGCCCCAGG - Intergenic
1165772568 19:38387727-38387749 CTGGCCCCGCCTCCCCCCAGAGG + Intronic
1166733551 19:45071602-45071624 CAGGCCTCGCCGGCCGCCTCAGG + Exonic
1167306810 19:48714395-48714417 CTGGCCGCGCCTCAAGCCCAAGG - Exonic
1167738787 19:51311938-51311960 CCGGCCGAGCCCCCCGCCCCCGG - Intronic
1167967376 19:53158444-53158466 CTGACCCCTCCTCCCGCCCCGGG - Intronic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1168328762 19:55553842-55553864 CTGGCCTCCCCTCTCGCCTCTGG + Intergenic
1168354140 19:55691661-55691683 CTGGCCGCCTCCCCCGCCACGGG + Intronic
1168404325 19:56102988-56103010 CTGGCCTCCCCTCCCGCCCTGGG - Intronic
1168584759 19:57583550-57583572 TCGGCCCCGCCTCCCGCCTCTGG + Intronic
925540511 2:4961388-4961410 CTGGCCGCTGGTCCCTCCTCTGG - Intergenic
925845254 2:8028311-8028333 CCGGCCGCGCCACCCCACTCTGG + Intergenic
926308551 2:11657902-11657924 CTGGCGTCCCCTCCTGCCTCTGG - Intergenic
927477249 2:23423332-23423354 CAGGCCGTGCCTCCCACCCCAGG + Intronic
927794258 2:26034324-26034346 ATGGCCTCCCCTCCCCCCTCAGG - Exonic
927811871 2:26184992-26185014 CTGCCCGCGCCGCGCGCCCCCGG + Exonic
928135651 2:28685615-28685637 CAGGCCCCGCCTCCCGCATTGGG - Intergenic
929665641 2:43831903-43831925 CTGGCCCCCCCGCCCGCCCCGGG - Intronic
932780233 2:74554700-74554722 CCCGCCCCGCCTCCCGCCGCAGG + Exonic
933919299 2:87028445-87028467 CTGTCTGCTCCTCCTGCCTCTGG - Intergenic
933946977 2:87295379-87295401 CTGGCAGTGACTCCAGCCTCAGG - Intergenic
934003695 2:87741462-87741484 CTGTCTGCTCCTCCTGCCTCTGG + Intergenic
936333213 2:111566176-111566198 CTGGCAGTGACTCCAGCCTCAGG + Intergenic
936388699 2:112054284-112054306 CAGGCCCCGCCTCCCCACTCAGG + Intergenic
936388707 2:112054303-112054325 CAGGCCCCGCCTCCCCACTCAGG + Intergenic
937202821 2:120216413-120216435 CTGGGCGAGCCGCCCGGCTCCGG + Intergenic
937956808 2:127426388-127426410 CTGGCTGCTCCTCTCCCCTCAGG - Intronic
946187844 2:217991180-217991202 CTGGGCCCTCCTCCCTCCTCTGG - Intronic
946354607 2:219176979-219177001 CGGGCCCCGCCTTCCGCCGCCGG - Intronic
947715351 2:232336360-232336382 CTGGCCCCTCCTTCGGCCTCTGG - Intronic
947793093 2:232878861-232878883 CTGGGGACCCCTCCCGCCTCTGG - Exonic
947918034 2:233847300-233847322 CAGGCAGCGCTGCCCGCCTCAGG + Intronic
948468618 2:238163877-238163899 CTGGCCGCGCCCCTGGCCCCGGG + Exonic
948866526 2:240777787-240777809 CCGGCCTCGCCTCCCTGCTCTGG + Intronic
1169164018 20:3407394-3407416 CCGGCGACGCCTCCCGCCGCAGG - Intronic
1171308496 20:24126333-24126355 CTGGCCTCCTCTCCCTCCTCAGG + Intergenic
1173818390 20:46005018-46005040 CTGGCTGCCCCTCCCCTCTCTGG + Intergenic
1175824905 20:61931508-61931530 GTCGCCGCCCCTCTCGCCTCCGG + Intronic
1175943218 20:62547396-62547418 CAGGCCCCCCTTCCCGCCTCCGG + Intergenic
1176027987 20:62995950-62995972 CTGGCCGCACCTGCCCCTTCCGG + Intergenic
1178376394 21:32071022-32071044 CTGCCCTCACCTCCTGCCTCTGG + Intergenic
1179209705 21:39314177-39314199 CTCGCCGCGCCTCCCGCAGAGGG + Intronic
1179522480 21:41954050-41954072 CCGGCCGCGCCCCCTCCCTCGGG - Intergenic
1180014257 21:45072590-45072612 CTGGCCGGGCCTCCCTCCCGTGG - Intergenic
1180650045 22:17369790-17369812 CCGGCCGCGCCGCCCTCCTCTGG - Exonic
1182073060 22:27476906-27476928 CTCGCCCCACCTCCCGTCTCAGG - Intergenic
1182447272 22:30397184-30397206 CTGGCCCGGGCTCCCGCCTCGGG + Intronic
1183788372 22:40045089-40045111 CGGGCCGCGCCGCGCGCCCCCGG - Intronic
1183988056 22:41580105-41580127 CTGGCTGCACCTCCCTTCTCTGG + Intronic
1184669078 22:46003437-46003459 CAGGCCAAGCCTCCCGCGTCCGG - Intergenic
1185270717 22:49928353-49928375 CTGGCCCTGCATCTCGCCTCTGG + Intergenic
1185281071 22:49970135-49970157 CTGGCCCCTCCGCCTGCCTCAGG - Intergenic
1185412808 22:50694878-50694900 CTGGCTGTGCCTCCCCCTTCAGG - Intergenic
950583505 3:13878199-13878221 CTGGCCGCCCCGCCCGCCCGCGG - Intronic
953761336 3:45689512-45689534 CCCGCCGCGCCTCAGGCCTCTGG - Intronic
953909188 3:46883210-46883232 ATGGCCGGGCCCCCCGCCCCCGG - Intronic
954152261 3:48663427-48663449 TTGGCCTCTGCTCCCGCCTCGGG - Intergenic
954796127 3:53161995-53162017 CGGGCCTCGCCTCCCGCCCCTGG + Intronic
954838826 3:53494308-53494330 CTGGCGCCGCCTGCCTCCTCCGG + Intergenic
962809187 3:138946978-138947000 CTCGCCGCCCCTCCCCGCTCAGG + Exonic
962851736 3:139313248-139313270 CTGGCTGGGCCTCCAGGCTCTGG - Intronic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
968628851 4:1639988-1640010 CTGGCTGCGCCTCAGGCCTCTGG - Exonic
968729386 4:2262458-2262480 TTGGCCGCGCGCCCCGCCACCGG - Intergenic
968759754 4:2436712-2436734 CTGGCAGTGCCTCCCCACTCAGG - Intronic
976398502 4:84582905-84582927 CTGCCCGGGCCTCCCGCACCAGG - Intergenic
977544322 4:98359019-98359041 CTGCCCCCACCTCCCACCTCAGG - Intronic
981722476 4:147815465-147815487 CTCCCCCCGCCCCCCGCCTCCGG - Intronic
984908209 4:184649187-184649209 CCGGCCCAGGCTCCCGCCTCCGG + Intronic
985524377 5:394692-394714 CTGGCTGTGCCTCCTGTCTCTGG + Intronic
985827961 5:2206734-2206756 CTGGCCGGGCCTCCCTCCGTCGG + Intergenic
987416865 5:17671090-17671112 CTTGCCCTGCCTCCCACCTCAGG - Intergenic
998130174 5:139647909-139647931 TTGGCCGCGCCCCCCAGCTCAGG - Intronic
998168238 5:139856581-139856603 CTGGCCCCTCCTCCCAGCTCAGG + Intronic
1001035127 5:168291932-168291954 CCGCCCGCTCCTCCCGCCGCCGG - Intronic
1001959591 5:175872155-175872177 CTGGGGGCGACTCCCTCCTCCGG - Intronic
1002166709 5:177352074-177352096 CTGGCCGCAAGTCCCGTCTCTGG + Intergenic
1002368310 5:178730199-178730221 ACGGCCACCCCTCCCGCCTCGGG - Intronic
1006185530 6:32179647-32179669 CTGGCCGTGTCTCCAGCCACTGG - Exonic
1007400444 6:41599731-41599753 CAGGCCCCGCCTCTGGCCTCAGG - Exonic
1011273213 6:85601126-85601148 CTGGTCTCAACTCCCGCCTCAGG - Intronic
1011983962 6:93419140-93419162 CCGGCCGCGCCTCCGGCGCCGGG - Intronic
1016552399 6:145296417-145296439 CTTGCCGTGCCTCCTGTCTCTGG - Intergenic
1018127472 6:160695622-160695644 CTGCCTGCTCCTCCCGCCTCTGG + Intergenic
1018149049 6:160921432-160921454 CTGTCTGCACCTCCTGCCTCTGG - Intergenic
1018739327 6:166715170-166715192 CTGGGCTTGCTTCCCGCCTCGGG - Intronic
1019343479 7:519111-519133 CTCCCCGCGCCACCCTCCTCCGG - Exonic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1019533267 7:1514226-1514248 CTGCCTCCGCCTCCGGCCTCCGG - Intergenic
1019709000 7:2509887-2509909 CTGGCTGTGTCTCCAGCCTCAGG - Intergenic
1022111547 7:27235486-27235508 CTCGCCGCGACTTCCGCCTCTGG + Intergenic
1025068068 7:55874772-55874794 CTTGCCGTGCCTACCCCCTCTGG - Intergenic
1029439050 7:100577373-100577395 CTGCCGGCTCCTCCCGCCTGAGG + Exonic
1033288682 7:140063026-140063048 GCGGCTGCGCCTTCCGCCTCAGG + Exonic
1035187672 7:157139077-157139099 ATTGCCGCCCCTCCCGCCCCAGG + Exonic
1037808276 8:22070303-22070325 CTGGCCATGCCCCCCGTCTCTGG + Exonic
1037902339 8:22695228-22695250 CAGGCTGCGCCTCCCGCCCCCGG + Intergenic
1040954938 8:52970109-52970131 CTGGCCGGCCCTGCCGCCCCCGG - Intergenic
1044857718 8:96493733-96493755 CGCGCCGCGCCTCCCTCCCCGGG - Exonic
1049387084 8:142348514-142348536 CTGGCCCCCGCTCCCGCCCCAGG + Intronic
1049387112 8:142348582-142348604 CTGGCCCCCGCTCCCGCCCCAGG + Intronic
1049387140 8:142348650-142348672 CTGGCCCCCGCTCCCGCCCCAGG + Intronic
1049548520 8:143246047-143246069 CCTGCCGCTCCTCCCGCCGCAGG - Intergenic
1049656406 8:143800451-143800473 CTGGCCGCCCTTCCCCCTTCGGG - Intronic
1049835788 8:144734625-144734647 CAGGCAGCGCCTCCCTCTTCAGG - Intronic
1055049344 9:71963638-71963660 CTGGCCGGCCCTGCCGCCCCGGG + Intronic
1057034707 9:91803388-91803410 CTGTCCCCTCCTCCAGCCTCTGG - Intronic
1058412311 9:104747631-104747653 CCCGCCGCGCCTCCCGCGCCGGG + Intergenic
1059102196 9:111482819-111482841 CAGGCCGCCCCGCCCGCCGCCGG - Intronic
1060665125 9:125428213-125428235 CCTGCAGCCCCTCCCGCCTCTGG + Intergenic
1060849173 9:126860624-126860646 CAGCCCGCGCCCCCCGCCCCCGG - Intergenic
1061003785 9:127917029-127917051 CCGGCCCCGCCCCCTGCCTCTGG - Intronic
1061517280 9:131097041-131097063 CCGCCTCCGCCTCCCGCCTCCGG + Intronic
1062162038 9:135086141-135086163 CTGGCTTCGCCCCCCTCCTCTGG - Intronic
1062170965 9:135134385-135134407 CAGGCCGCGCCTCGCCCCTGGGG + Intergenic
1062192833 9:135256505-135256527 CTGGGCGCAGCCCCCGCCTCTGG + Intergenic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1186567367 X:10677801-10677823 CTGGCCGCACCCCCCACCCCAGG + Intronic
1189325422 X:40108441-40108463 CTGGCCGCCGCTCCCTCCCCTGG - Intronic
1190319720 X:49172780-49172802 CTGGCAGCGCCACTCCCCTCAGG + Intronic