ID: 900537766

View in Genome Browser
Species Human (GRCh38)
Location 1:3187291-3187313
Sequence TTTTTGGCAGGGCCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 268}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900537755_900537766 20 Left 900537755 1:3187248-3187270 CCTGGCCCTTCTGCCGGCCTCAC 0: 1
1: 0
2: 8
3: 30
4: 307
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537756_900537766 15 Left 900537756 1:3187253-3187275 CCCTTCTGCCGGCCTCACGCAGC 0: 1
1: 0
2: 0
3: 15
4: 130
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537758_900537766 7 Left 900537758 1:3187261-3187283 CCGGCCTCACGCAGCCAATTGTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537754_900537766 21 Left 900537754 1:3187247-3187269 CCCTGGCCCTTCTGCCGGCCTCA 0: 1
1: 0
2: 2
3: 24
4: 306
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537762_900537766 -7 Left 900537762 1:3187275-3187297 CCAATTGTCGGTGGTATTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537760_900537766 3 Left 900537760 1:3187265-3187287 CCTCACGCAGCCAATTGTCGGTG 0: 1
1: 0
2: 0
3: 1
4: 118
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537757_900537766 14 Left 900537757 1:3187254-3187276 CCTTCTGCCGGCCTCACGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 271
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537752_900537766 30 Left 900537752 1:3187238-3187260 CCTGGTGGGCCCTGGCCCTTCTG 0: 1
1: 0
2: 1
3: 42
4: 362
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900537766 Original CRISPR TTTTTGGCAGGGCCCCTGCC TGG Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
900991198 1:6099191-6099213 TGGTAGGCATGGCCCCTGCCGGG - Exonic
901053711 1:6438761-6438783 ATTCTGGCAGGTCCCCTGCTAGG + Intronic
901927338 1:12574689-12574711 TTCTTGGTAAGACCCCTGCCAGG + Intronic
902301253 1:15504455-15504477 TTTTTGGCAGCACCTCTGTCTGG - Intronic
902480591 1:16709570-16709592 ATTCTGGCAGGTCCCCTGCTAGG - Intergenic
903336329 1:22627034-22627056 TGTTTTCCAAGGCCCCTGCCTGG - Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
904986477 1:34553633-34553655 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
910067513 1:83171098-83171120 TTTTTGGTTGTGTCCCTGCCAGG - Intergenic
910082014 1:83352897-83352919 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
911815286 1:102342450-102342472 TTTTTGGTTGTGCCTCTGCCTGG + Intergenic
912253910 1:108039727-108039749 CTTTTGGGAAGGCCTCTGCCTGG - Intergenic
915325131 1:155078131-155078153 ACTTAGGCAGGGCCCCTCCCGGG - Intergenic
916212912 1:162373062-162373084 TTTGTGCCAGGGTCCCTGCAAGG + Intronic
917370594 1:174289767-174289789 TGTTGGGCAGGCCCCCTGACTGG + Intronic
919240790 1:194914063-194914085 TTGGGGGTAGGGCCCCTGCCAGG - Intergenic
919728716 1:200899787-200899809 TCTGTGCCTGGGCCCCTGCCTGG - Intronic
919847540 1:201651009-201651031 TTTTTGGCAGGCACCATGGCAGG + Intronic
919978554 1:202628385-202628407 TCTTTGGCTGGCTCCCTGCCTGG - Intronic
920100775 1:203515761-203515783 TGCTTGGGAGAGCCCCTGCCAGG + Intergenic
921260513 1:213381933-213381955 TTCTTGGCTGGGCCCCAGACTGG + Intergenic
921904204 1:220479090-220479112 TTTTTGGCAGGGGCGCTTCAAGG + Intergenic
922421495 1:225463599-225463621 TTCTTGGCAAGGCCCCTGAGAGG + Intergenic
924008613 1:239640228-239640250 TTTTTGGTAGTGTCTCTGCCCGG + Intronic
1063897052 10:10693474-10693496 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1064913329 10:20427470-20427492 TTTTTCCCAGGGTCCCTGCCTGG - Intergenic
1065020428 10:21497366-21497388 AATTTGGCAGGGCGCCCGCCTGG - Intergenic
1065128462 10:22596845-22596867 CTCTGGGCAGGGCCCCTGCAGGG - Intronic
1066758969 10:38737106-38737128 TTCAGGGCAGGGCCACTGCCAGG - Intergenic
1066784841 10:38992066-38992088 TTTTTGGTTGTGCCTCTGCCAGG + Intergenic
1069294137 10:66823051-66823073 ATTGTTGCAGGCCCCCTGCCAGG - Intronic
1069756501 10:70777069-70777091 TTTAGGGCAAGGCCCCTCCCAGG - Intronic
1070831764 10:79422236-79422258 TTTTTGGCCTGTCCCCTCCCTGG + Intronic
1071324561 10:84499901-84499923 TCCTTGGCAGGGCTCCTTCCAGG + Intronic
1071359054 10:84827600-84827622 GTTTTGGCAGGGCCCTGGCAAGG - Intergenic
1075578139 10:123595861-123595883 GGTGTGGCTGGGCCCCTGCCAGG - Intergenic
1075745054 10:124721280-124721302 ATCCTGGCAGGTCCCCTGCCTGG + Intronic
1075865664 10:125717403-125717425 TTTTTGGTTGTGCCTCTGCCCGG - Intergenic
1076171672 10:128325146-128325168 TTGTTTCCAGGGCCCCTGCAAGG - Intergenic
1076840040 10:133041353-133041375 TTTCTAGCAGGGCACCTGGCAGG + Intergenic
1077247357 11:1546239-1546261 TTCCTGGAAGGGCCCCTCCCTGG - Intergenic
1079134450 11:17768543-17768565 TTGATGGCAGTGACCCTGCCCGG + Intronic
1079975399 11:27084549-27084571 TTTTTGTCAGGGCCCCTAGAAGG + Intronic
1081377843 11:42380479-42380501 TTTTTGGTTGTGTCCCTGCCAGG - Intergenic
1083384504 11:62297385-62297407 TTCTTGTCAGGTCACCTGCCTGG - Intronic
1083620721 11:64048127-64048149 GTGGGGGCAGGGCCCCTGCCCGG - Intronic
1084457861 11:69278681-69278703 TTTTTGGCAGGACCCCAGAGTGG - Intergenic
1084587642 11:70072335-70072357 TTTGTGTCAAGGCCTCTGCCAGG - Intergenic
1084604518 11:70164831-70164853 TTTTTTCCAGGGCCACTGGCCGG - Intronic
1084943142 11:72625095-72625117 CTGTTGTCAGGGCCCCTGGCAGG + Intronic
1085311755 11:75520980-75521002 TTTTTGGCCTGGCCACTGTCTGG - Intronic
1085961883 11:81470639-81470661 AATTTGCCAGGGCCACTGCCTGG - Intergenic
1086432656 11:86750250-86750272 TTTCTGCCAGTGTCCCTGCCTGG + Intergenic
1087067428 11:94040400-94040422 TTTTTGGTTGTGTCCCTGCCCGG - Intronic
1088637608 11:111838576-111838598 TTGTTGGCAAGCCCTCTGCCTGG - Intronic
1089733454 11:120534059-120534081 CTTTTGGCAGGATCACTGCCAGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090893004 11:130943758-130943780 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1090940969 11:131388091-131388113 TTTCTGGAAGGGCCACTCCCAGG + Intronic
1097043865 12:56172873-56172895 TTTATTGGGGGGCCCCTGCCCGG - Intronic
1097303493 12:58043414-58043436 CTTCTGCCAGGGGCCCTGCCTGG - Intergenic
1099774087 12:87101945-87101967 TTTTTGGTTGTGTCCCTGCCCGG - Intergenic
1100941117 12:99723460-99723482 TTTGTGCCTGAGCCCCTGCCTGG - Intronic
1102159593 12:110757700-110757722 TTTGTGCCTGGGCCCGTGCCTGG + Intergenic
1103113890 12:118308581-118308603 TTTTGGGCAGCACCCTTGCCAGG - Intronic
1103332537 12:120164245-120164267 GTTTTGGCTGGGCCACTCCCTGG - Intronic
1104951952 12:132445167-132445189 TGTTTGGCTGGGCCCGGGCCAGG - Intergenic
1105580263 13:21689194-21689216 TTTTCTGAAGTGCCCCTGCCTGG + Intronic
1106603571 13:31208151-31208173 TCTCAGGCAGGGCCCCGGCCCGG + Intronic
1107154656 13:37152419-37152441 TTTTTGGCTGTGTCTCTGCCAGG + Intergenic
1108241499 13:48469089-48469111 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1109105444 13:58244077-58244099 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
1110344502 13:74429871-74429893 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
1113169793 13:107487742-107487764 TTTTTTGTTGTGCCCCTGCCAGG + Intronic
1114728649 14:24966749-24966771 TATTTGGCAGTGTCCCTGCCAGG + Intronic
1116026713 14:39524019-39524041 TTTTTGGTTGTGACCCTGCCCGG + Intergenic
1117280658 14:54237542-54237564 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
1117457245 14:55910862-55910884 TTCCTGGCAAGGCTCCTGCCAGG + Intergenic
1117468283 14:56016477-56016499 TTTTTGGTTGGGTCTCTGCCCGG + Intergenic
1117597701 14:57340551-57340573 TTTTTGGTTGGGTCTCTGCCTGG + Intergenic
1118592887 14:67414222-67414244 CTCCTGGCAGGGCTCCTGCCAGG + Intergenic
1118592888 14:67414224-67414246 TTCCTGGCAGGAGCCCTGCCAGG - Intergenic
1120932835 14:89866212-89866234 TTTTGGGCAGGGGCCCTTCTGGG + Intronic
1121089377 14:91170579-91170601 TTTGTGGCAGAGCCTCGGCCAGG + Intronic
1121435331 14:93915430-93915452 GTCTTGGCAGGTCCCTTGCCAGG - Intergenic
1122133302 14:99618633-99618655 GCATTGGCAGGGCCTCTGCCTGG + Intergenic
1122202432 14:100130706-100130728 TTCATGGCAGGGCCACAGCCTGG + Intronic
1122787093 14:104168830-104168852 GTTGGGGCAAGGCCCCTGCCTGG + Intronic
1125232675 15:37474701-37474723 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
1125412520 15:39420232-39420254 TCAGTGGCAGGGCCCCTGCCAGG + Intergenic
1127299697 15:57640866-57640888 TTATGGGCAGTGCTCCTGCCTGG - Intronic
1130320244 15:82835527-82835549 TCTGTGGCATGGCCACTGCCAGG + Exonic
1132415215 15:101614473-101614495 TTTAAGGCTGGCCCCCTGCCTGG + Intergenic
1133103631 16:3493740-3493762 CATGTGGCAGGGCCACTGCCGGG + Exonic
1134450252 16:14358901-14358923 TTTTGGGCAGGGCCCTGGCAGGG + Intergenic
1136105045 16:28024393-28024415 TTTAGAGCAGGGCCACTGCCGGG + Intronic
1136615887 16:31398119-31398141 TTTAAGACAGGGTCCCTGCCAGG + Intronic
1137714715 16:50591757-50591779 ATTTTCACAGGGCCCCTTCCTGG - Intronic
1142430242 16:90022576-90022598 CCTTTGGCAGGGCCGCTGCCCGG + Intronic
1143251584 17:5527051-5527073 TTTCTGGAAGGGGCCCTGCCCGG + Intronic
1143253310 17:5538155-5538177 GATGTGGCAGGGCCCCTGGCAGG + Intronic
1144944892 17:18964795-18964817 CTCTGGGCAGGGCCTCTGCCGGG + Intronic
1145417362 17:22729648-22729670 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
1147718165 17:42521882-42521904 TTGTGGGCAGGGCCCATGCAAGG - Exonic
1148909258 17:50931727-50931749 TTGTTCGCTCGGCCCCTGCCGGG - Intergenic
1150217716 17:63479568-63479590 TCTGGGGCAGGGGCCCTGCCTGG + Intergenic
1151339305 17:73459447-73459469 ATTTTGGCTGGGCCACTGCCTGG + Intronic
1151394060 17:73808884-73808906 TTTTTGGTTGTGTCCCTGCCAGG - Intergenic
1152647700 17:81477420-81477442 GTGAGGGCAGGGCCCCTGCCTGG + Intergenic
1152665815 17:81568696-81568718 GGTTTGGCCTGGCCCCTGCCTGG - Intronic
1157298503 18:46462678-46462700 TCTTTGGCAGGGCTCCTGGACGG + Exonic
1160064418 18:75561760-75561782 CTTTTGGCAAGGCCTGTGCCAGG - Intergenic
1161067329 19:2245219-2245241 TTGTTGGAAGGGCCCCAGCCAGG + Intronic
1161477314 19:4493886-4493908 CTCTTGGCCTGGCCCCTGCCGGG + Intronic
1161516587 19:4699931-4699953 GTCCTCGCAGGGCCCCTGCCCGG + Intronic
1163332184 19:16646822-16646844 TTGTTAACAGGGCCCCTGGCCGG + Exonic
1163955076 19:20630242-20630264 TTTTTGGTTGGGTCTCTGCCAGG + Intronic
1165129942 19:33625523-33625545 TTTTTTGCTGTGCCACTGCCGGG - Intronic
1165607667 19:37120150-37120172 TTTTTGGCTGTGTCTCTGCCAGG - Intronic
1202714633 1_KI270714v1_random:35478-35500 ATTCTGGCAGGTCCCCTGCTAGG - Intergenic
926155961 2:10454235-10454257 TCTGTGCCAGCGCCCCTGCCAGG + Intergenic
926681330 2:15666037-15666059 TATTTTGCAGGCACCCTGCCTGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928170094 2:28998023-28998045 TTTTGGGCAGGGACCCTGCGGGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
929876376 2:45800331-45800353 TTTATGGAAGGGCTGCTGCCTGG - Intronic
930488756 2:52041879-52041901 TTTTTGGTTGTGTCCCTGCCTGG + Intergenic
931148747 2:59548717-59548739 TATTTGGCTGGGCACCTGACTGG + Intergenic
931884284 2:66599086-66599108 TTTTAGTCAGGCCCCTTGCCAGG + Intergenic
932455508 2:71847047-71847069 TTTTTGCCAGGAGCTCTGCCGGG - Intergenic
934322308 2:91981456-91981478 TTCATGGCAGGGCCAGTGCCAGG - Intergenic
935421715 2:102876489-102876511 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
937468581 2:122155954-122155976 ATGTTGGCAGGCCCCCTGCCTGG + Intergenic
937908819 2:127065458-127065480 TGGTTGGCAGCCCCCCTGCCAGG - Intronic
939390695 2:141565912-141565934 TTTTTGCCAGGCACTCTGCCTGG + Intronic
939923519 2:148145912-148145934 TTTTTGGCTGTGTCTCTGCCAGG + Intronic
942753884 2:179318160-179318182 TTTTTGGTTGCGCCTCTGCCAGG - Intergenic
943047697 2:182878164-182878186 TTTTTGGTTGTGTCCCTGCCAGG - Intergenic
944042842 2:195375679-195375701 TTTTTGGTTGTGCCTCTGCCCGG + Intergenic
944086856 2:195858515-195858537 ATATTGGCAAGGCACCTGCCAGG + Exonic
946381104 2:219349616-219349638 TATGAGGCAGGGCACCTGCCTGG + Intergenic
948034333 2:234846156-234846178 TTTTTGCCAGGGCTCCTGTTTGG - Intergenic
948996792 2:241584829-241584851 CCTCTGGCAGGGCCACTGCCTGG - Intronic
1169214121 20:3783966-3783988 TCTCTGGCAGGGCCCCATCCTGG - Exonic
1169760154 20:9082900-9082922 ATTCTGGCAGAGCCACTGCCAGG - Intronic
1172121789 20:32603053-32603075 CGTGTGGCAGGGGCCCTGCCAGG + Intronic
1175168465 20:57062974-57062996 TTTGGGGCGGGGCCTCTGCCAGG + Intergenic
1175844380 20:62050947-62050969 TCTGTGGGAGGGGCCCTGCCTGG - Intronic
1176171650 20:63699018-63699040 TCTTTGGCAGGTCCCCTCTCGGG - Exonic
1176220469 20:63967153-63967175 TCTTGTGCATGGCCCCTGCCAGG - Intronic
1179884487 21:44307719-44307741 ATACTGGCAGGGCCCCAGCCTGG - Intronic
1180106125 21:45619171-45619193 TTTGTGCCTGGGGCCCTGCCTGG - Intergenic
1180151402 21:45950156-45950178 TTTTTGGCAAGGACACTTCCAGG + Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1181171479 22:21012542-21012564 TTTTGCTCAGGGCACCTGCCAGG + Intronic
1181177872 22:21047979-21048001 TTTTGCTCAGGGCACCTGCCAGG - Exonic
1182047300 22:27285348-27285370 ATTCTGCCAAGGCCCCTGCCAGG + Intergenic
1182228926 22:28821624-28821646 TTTTTGGCAGAGCACCTGGCAGG + Intergenic
1182456007 22:30450955-30450977 TTTGGGGCAGGCCCCTTGCCCGG + Intronic
1182622705 22:31626684-31626706 CTTTGGCCAGGGCCCCAGCCTGG + Intronic
1183181927 22:36266067-36266089 ATTTTGTCCTGGCCCCTGCCAGG - Exonic
1183947486 22:41334887-41334909 TGTCTTGCAGGGCCTCTGCCTGG - Intronic
1184296459 22:43528222-43528244 TTTTGTTCATGGCCCCTGCCAGG - Intergenic
1185053296 22:48564893-48564915 TTTTTTGCAGGGCCACTGGGGGG - Intronic
950119881 3:10474732-10474754 TTTATGGCAGGGGAACTGCCTGG - Intronic
950537552 3:13588456-13588478 GTTCTGGAAGGGCCCCAGCCTGG + Intronic
950659132 3:14455808-14455830 TGCTTGGCAGGGCCCCAGCTGGG + Intronic
952266278 3:31789597-31789619 CTTGAGGCAGTGCCCCTGCCTGG - Intronic
955428749 3:58819820-58819842 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
955816564 3:62849740-62849762 TTTTTGGCTGTGTCTCTGCCCGG + Intronic
955899473 3:63736853-63736875 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
956076637 3:65512834-65512856 TTTTTGGCTGTGTCTCTGCCTGG - Intronic
956389947 3:68760908-68760930 TATGTGCCAGGGCCTCTGCCAGG + Intronic
956642180 3:71425565-71425587 ATTTTGCCAGGGACTCTGCCAGG - Intronic
956654928 3:71540160-71540182 GTTTGGTGAGGGCCCCTGCCAGG + Intronic
957091337 3:75733360-75733382 TTTTTGGCATGTATCCTGCCTGG - Intronic
959169146 3:102823716-102823738 TTTTTGGTTGTGCCTCTGCCAGG - Intergenic
961244576 3:125440430-125440452 TGCATGTCAGGGCCCCTGCCTGG - Intergenic
961475260 3:127141943-127141965 TTCTTGGAAAAGCCCCTGCCGGG + Intergenic
961829583 3:129616568-129616590 TTTCTGTCAGGGCCTCTGACAGG + Intergenic
962235914 3:133706864-133706886 TGTGTGGCAGGACCCCAGCCCGG + Intergenic
962874062 3:139522438-139522460 TCTAGGGCAGGGCACCTGCCAGG + Intronic
964943386 3:162189009-162189031 TTTTTGGTTGTGCCTCTGCCAGG + Intergenic
970348537 4:15177549-15177571 TTTTTGGTTGTGCCTCTGCCCGG - Intergenic
971303180 4:25458402-25458424 TTTAGGGCAGAGCCCATGCCTGG + Intergenic
972622950 4:40766545-40766567 TTTTTGGCTGTGTCTCTGCCTGG + Intronic
973605011 4:52577926-52577948 TGTTTGGTAGGGCCCCTCTCAGG - Intergenic
973712695 4:53645070-53645092 TTTTTGGCGTGGACACTGCCTGG - Intronic
976341848 4:83954644-83954666 TTTTTGGTTGTGTCCCTGCCCGG + Intergenic
976813855 4:89124428-89124450 TTTGTGCCCAGGCCCCTGCCAGG - Intergenic
978952588 4:114579036-114579058 TTTTTTGCTGGGTCTCTGCCAGG + Intergenic
979148110 4:117272776-117272798 TTTTTGGTTGTGCCTCTGCCAGG + Intergenic
979529379 4:121752718-121752740 TTTTTTGCTGTGCCTCTGCCAGG - Intergenic
983404548 4:167311374-167311396 TTTTTGGCAGGGCCGCAGCCTGG - Intergenic
985694289 5:1331238-1331260 ATCTTGGCAGGCCTCCTGCCTGG + Intronic
991546138 5:67783685-67783707 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
991555748 5:67893141-67893163 TTTTTGGCTGTGTCTCTGCCCGG - Intergenic
992815284 5:80431116-80431138 TTTTTGGTTGTGCCTCTGCCAGG - Intronic
993324310 5:86514232-86514254 TTTTTGGTTGTGTCCCTGCCCGG - Intergenic
996873514 5:128217049-128217071 CTCCTGGCAGAGCCCCTGCCCGG - Intergenic
998094200 5:139388161-139388183 GTTTTGGCAGGAGCCCAGCCAGG + Intronic
999064438 5:148670660-148670682 TTTTTTGTAGTGCCTCTGCCAGG + Intronic
999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG + Intronic
999349867 5:150859390-150859412 TTTTTGGCTGTGTCTCTGCCAGG + Intronic
999568127 5:152888921-152888943 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
999584270 5:153073449-153073471 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1002133218 5:177093713-177093735 CCTTTGGCATGGACCCTGCCCGG + Exonic
1008155844 6:48013037-48013059 TTTTTGGCTGGGTCTCTGCCAGG + Intronic
1009445473 6:63737551-63737573 TTTTTGGTTGTGTCCCTGCCCGG + Intronic
1009999791 6:70937430-70937452 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1010000870 6:70947759-70947781 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1010281571 6:74029281-74029303 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
1010310138 6:74375506-74375528 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
1010352003 6:74885746-74885768 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
1010848932 6:80747897-80747919 TTTTTGGTTGTGCCTCTGCCCGG - Intergenic
1010907436 6:81508342-81508364 TTTTTGGCTGTGTCTCTGCCAGG + Intronic
1013902863 6:115178747-115178769 TTTTTGGTTGGGTCTCTGCCCGG - Intergenic
1013999288 6:116346297-116346319 TTTTTTGTTGGGCCTCTGCCAGG - Intronic
1014529238 6:122539644-122539666 TTTTTGGCTGTGTCTCTGCCAGG + Intronic
1015365849 6:132397136-132397158 CTCTTGGCAGGGACCTTGCCTGG - Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1021061104 7:16113591-16113613 TTTTTGGGAGAGACGCTGCCAGG - Intronic
1024294704 7:47832939-47832961 GTTTTGGGTGGGCCCATGCCTGG + Intronic
1026063568 7:67048372-67048394 TTGGTGGTAGGGCCACTGCCTGG + Intronic
1026714782 7:72779102-72779124 TTGGTGGTAGGGCCACTGCCTGG - Intronic
1027171413 7:75875515-75875537 TTTTTGGCTTGGCTCATGCCTGG + Intronic
1027276591 7:76563660-76563682 TTTTTGGTTGTGTCCCTGCCAGG + Intergenic
1027292764 7:76732026-76732048 TTTTTGGTTGTGTCCCTGCCAGG - Intergenic
1029733047 7:102450350-102450372 CTTTTGGGAGGGGCCCTGCTGGG + Exonic
1029965146 7:104732187-104732209 TTTTTGGTTGTGTCCCTGCCAGG + Intronic
1031765522 7:125772471-125772493 TTTATGCCAGGGTCCCTGCGGGG - Intergenic
1032537364 7:132675857-132675879 TTTTTGGCTGTGTCTCTGCCAGG + Intronic
1033551675 7:142453017-142453039 GTTTTGGCAGTGCACCTGCAGGG - Intergenic
1033553962 7:142471861-142471883 TGTTTGGCAGTGCACCTGCAGGG - Intergenic
1034724231 7:153320372-153320394 ATTTTGACAGGGACCCTGCCAGG + Intergenic
1035954370 8:4059971-4059993 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1038702194 8:29859244-29859266 TTTTTGGCCAGGCCTCTCCCAGG - Intergenic
1041826291 8:62099536-62099558 CTTCTCCCAGGGCCCCTGCCTGG + Intergenic
1043069819 8:75623791-75623813 TTTTTGGTTGGGTCTCTGCCCGG + Intergenic
1044156703 8:88857092-88857114 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1044186122 8:89254030-89254052 TTCCTTCCAGGGCCCCTGCCTGG - Intergenic
1044215020 8:89599109-89599131 TTTTTGGCTGTGTCTCTGCCTGG - Intergenic
1044242506 8:89902894-89902916 TTTTTGGCCTGGCCCGGGCCGGG + Intronic
1045450583 8:102320618-102320640 TTTTTGGTAGTGTCTCTGCCCGG - Intronic
1046491063 8:114953331-114953353 CCTTTGCCAGGGCCCCTACCTGG + Intergenic
1048684372 8:136887085-136887107 TTTTTGAAAAGGCCCCTGCTAGG - Intergenic
1049419824 8:142511564-142511586 TCTGGGCCAGGGCCCCTGCCTGG - Intronic
1049431747 8:142568564-142568586 CATCTGCCAGGGCCCCTGCCTGG + Intergenic
1049673514 8:143879839-143879861 TTGCAGGCAGCGCCCCTGCCAGG + Intergenic
1053000986 9:34577338-34577360 TTTATGGCATTACCCCTGCCTGG - Intronic
1055706843 9:79014944-79014966 TTTTTGGAAGGCCCCCTACTAGG + Intergenic
1058545316 9:106054892-106054914 TTTTTGGCCATGCCTCTGCCTGG + Intergenic
1059028745 9:110666526-110666548 TTTTTGGTTGTGCCTCTGCCAGG - Intergenic
1059732228 9:117068471-117068493 TTTTTGGTTGTGCCTCTGCCTGG + Intronic
1060057638 9:120428785-120428807 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1060588708 9:124802580-124802602 TCTTAGGCAGTGCCCCAGCCAGG - Intronic
1061139444 9:128755641-128755663 TCATTGGCAGAGCCACTGCCTGG + Exonic
1061971938 9:134049797-134049819 CTTTGGGCAGGGCCCGTGCCAGG - Intronic
1062244966 9:135561546-135561568 TTCTTGGCAGGGCCTCAGGCGGG - Intergenic
1062300828 9:135867871-135867893 TTGTTTGCAGGGCCCCTGCCTGG - Intronic
1062313396 9:135952264-135952286 TTTTGGGCTAGGCCCATGCCTGG - Intronic
1062354931 9:136157440-136157462 TCTTTGTCAGGGCACCTGCTGGG + Intergenic
1203359117 Un_KI270442v1:195982-196004 TTTTTGGCTGTGTCTCTGCCCGG - Intergenic
1186530049 X:10286335-10286357 TTTTAGGCGGGGCTGCTGCCTGG + Intergenic
1187589848 X:20705469-20705491 TTTTTGGTTGTGCCTCTGCCTGG + Intergenic
1187765696 X:22639386-22639408 TTTTTGGCAGGGAGATTGCCAGG - Intergenic
1190047967 X:47127767-47127789 TTTTGGGCTGGGCTGCTGCCTGG + Intergenic
1190064297 X:47229670-47229692 TGTTGGGTAGGGGCCCTGCCAGG + Exonic
1190374891 X:49779265-49779287 TTTTTGGCTGTGTCTCTGCCAGG + Intergenic
1190601052 X:52093090-52093112 TTTTTGGCTGTGACTCTGCCCGG + Intergenic
1191647303 X:63495768-63495790 TTTTTGGCTGCGTCCCTGCCAGG - Intergenic
1191853284 X:65601958-65601980 TTCTTGGCAGGGGCCCAGCTAGG - Intronic
1192274609 X:69616385-69616407 GGTGTGGCGGGGCCCCTGCCCGG + Exonic
1193011799 X:76684408-76684430 TTTTTGTCAGAGCCCATGTCCGG + Intergenic
1193087612 X:77461134-77461156 CTTTTGGGAAGGCACCTGCCCGG - Intergenic
1193346358 X:80408776-80408798 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1193638982 X:83988298-83988320 TTTTTTGTTGGGTCCCTGCCAGG - Intergenic
1194905339 X:99568994-99569016 TTTTTTGTTGTGCCCCTGCCAGG + Intergenic
1195167293 X:102232943-102232965 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1195191566 X:102454144-102454166 TTTTTGGCTGTGTCTCTGCCCGG - Intronic
1196240689 X:113340290-113340312 TTTTTGGCTGTGTCTCTGCCCGG + Intergenic
1198581692 X:138072750-138072772 TTTTTAGCATGGACCTTGCCTGG + Intergenic
1201919244 Y:19216418-19216440 TTTTTGGTTGTGTCCCTGCCTGG + Intergenic
1202098522 Y:21280576-21280598 TTTTTGGTTGTGCCTCTGCCAGG - Intergenic