ID: 900537766

View in Genome Browser
Species Human (GRCh38)
Location 1:3187291-3187313
Sequence TTTTTGGCAGGGCCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 268}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900537752_900537766 30 Left 900537752 1:3187238-3187260 CCTGGTGGGCCCTGGCCCTTCTG 0: 1
1: 0
2: 1
3: 42
4: 362
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537757_900537766 14 Left 900537757 1:3187254-3187276 CCTTCTGCCGGCCTCACGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 271
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537758_900537766 7 Left 900537758 1:3187261-3187283 CCGGCCTCACGCAGCCAATTGTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537762_900537766 -7 Left 900537762 1:3187275-3187297 CCAATTGTCGGTGGTATTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537760_900537766 3 Left 900537760 1:3187265-3187287 CCTCACGCAGCCAATTGTCGGTG 0: 1
1: 0
2: 0
3: 1
4: 118
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537754_900537766 21 Left 900537754 1:3187247-3187269 CCCTGGCCCTTCTGCCGGCCTCA 0: 1
1: 0
2: 2
3: 24
4: 306
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537756_900537766 15 Left 900537756 1:3187253-3187275 CCCTTCTGCCGGCCTCACGCAGC 0: 1
1: 0
2: 0
3: 15
4: 130
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268
900537755_900537766 20 Left 900537755 1:3187248-3187270 CCTGGCCCTTCTGCCGGCCTCAC 0: 1
1: 0
2: 8
3: 30
4: 307
Right 900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900537766 Original CRISPR TTTTTGGCAGGGCCCCTGCC TGG Intronic