ID: 900538772

View in Genome Browser
Species Human (GRCh38)
Location 1:3192384-3192406
Sequence ATGACCAGGCTCAGGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900538768_900538772 -8 Left 900538768 1:3192369-3192391 CCAGGCTCTGGATTAATGACCAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
900538766_900538772 7 Left 900538766 1:3192354-3192376 CCTGGAGAGACACTTCCAGGCTC 0: 1
1: 0
2: 4
3: 13
4: 219
Right 900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
900538764_900538772 16 Left 900538764 1:3192345-3192367 CCAGAAGATCCTGGAGAGACACT 0: 1
1: 1
2: 3
3: 16
4: 185
Right 900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900538772 Original CRISPR ATGACCAGGCTCAGGGTGTT AGG Intronic
900429781 1:2596156-2596178 ATGACCAGCCTCAAGGGCTTTGG + Intronic
900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
914885213 1:151578949-151578971 ATTACCAGGTTCAGGTTATTAGG + Intronic
916375182 1:164146069-164146091 ATGACCAGGAAGAGCGTGTTGGG - Intergenic
916499636 1:165376020-165376042 TTAGCCAGGCTCAGGGTCTTGGG - Intergenic
922934025 1:229410192-229410214 ATGACCATGCCTGGGGTGTTGGG - Intergenic
923202717 1:231727521-231727543 TTGACCATCCTCTGGGTGTTGGG + Intronic
923517440 1:234709540-234709562 AGGAGCAGGCTCAGGGACTTGGG + Intergenic
1070732968 10:78844222-78844244 AGGAGCAGGCTTTGGGTGTTGGG + Intergenic
1073560135 10:104489265-104489287 ATGTCCAGTCTCAGGGTGAGTGG + Intergenic
1075719907 10:124578540-124578562 ATCAGGAGGCACAGGGTGTTGGG + Intronic
1076791347 10:132778613-132778635 AGGCCCCGGCTCTGGGTGTTGGG - Intronic
1077498818 11:2899698-2899720 ATGAACAGGCTCAGTGTGAATGG - Exonic
1077700028 11:4432525-4432547 ATGTCCAGGCTGTGGGTGGTGGG + Intergenic
1079537638 11:21534081-21534103 ATAACTAGGTTGAGGGTGTTTGG - Intronic
1080740976 11:35064101-35064123 ATGAGCAGGCTGAGGGTGCTTGG - Intergenic
1084162241 11:67356212-67356234 ATCACCAGCCTCTGGGTGTCGGG - Intronic
1084859201 11:72007175-72007197 ATGACCAAGGTCAGGCTGCTGGG - Exonic
1086570268 11:88275790-88275812 AAGAACAGCCTCAGGGTGCTGGG + Intergenic
1086958373 11:92957499-92957521 ATGACAATGCTTAGGGTGGTGGG + Intergenic
1091863296 12:3806206-3806228 AGGACCAGGCGCAGGGGTTTGGG + Intronic
1096237930 12:49942494-49942516 ATGCCCAGGCTGAGGGTGGAGGG - Intergenic
1096756853 12:53806733-53806755 ATGCCCAGGCTCAGAGTCCTTGG - Intergenic
1098989005 12:77044208-77044230 ATGGCCAGGGTAAGGGTGGTGGG - Intronic
1104898583 12:132176014-132176036 GTGAGCAGGCTCTGGGTGTGGGG - Intergenic
1106791977 13:33164933-33164955 ATGAGCAGGCTCAGCATGTGTGG - Intronic
1108316385 13:49241475-49241497 ATCTCCAGACTCAGGGTGGTGGG + Intergenic
1109505125 13:63290259-63290281 ATAACTAGGTTCAGGGAGTTGGG - Intergenic
1113671544 13:112178909-112178931 AGGACCACGATCAGGGTGGTGGG + Intergenic
1114854602 14:26423301-26423323 ATAACCAGGATCATGCTGTTTGG - Intergenic
1121347273 14:93145306-93145328 ATGAGGGGGCTCAGGGTGTGGGG - Intergenic
1125411150 15:39407610-39407632 ATGGCCAGACTCAGGGTGCAGGG + Intergenic
1127996815 15:64157862-64157884 ATGACCAGACTCTGGCTGGTGGG + Intronic
1128743545 15:70098822-70098844 ATCCCCAGGCTGAGGGGGTTGGG + Intergenic
1131352915 15:91717952-91717974 ATTACCAGCCTCAGGGACTTGGG + Intergenic
1131797651 15:96035964-96035986 ATGACCAAGATCAAGTTGTTTGG + Intergenic
1132173769 15:99691010-99691032 ATGATCCAGGTCAGGGTGTTTGG - Intronic
1132862603 16:2078994-2079016 GTGACCAGGGTCAGGGTGCCAGG - Intronic
1133272338 16:4616360-4616382 ATGGACAGCCTCGGGGTGTTAGG + Intergenic
1133332344 16:4982400-4982422 AGGGCCAGGGTCAGGGTGGTGGG - Intronic
1133338549 16:5022100-5022122 ACGACTAGACTGAGGGTGTTGGG - Intergenic
1136047671 16:27627936-27627958 AGGACCAGGCCCAAGGTGTAAGG + Intronic
1137693690 16:50447168-50447190 CTGACCAGGCTCAGAGTGTGTGG - Intergenic
1141846322 16:86611332-86611354 GAGCCCAGGCTCAGGGTGCTGGG - Intergenic
1142221407 16:88856765-88856787 ATGAGCAGGAGCAGGATGTTGGG + Exonic
1142253149 16:89002047-89002069 ATTTCCAGGCTCTGGGTTTTAGG + Intergenic
1145113915 17:20190568-20190590 ATGAGGAGGCTGAGTGTGTTTGG - Intronic
1147026981 17:37594956-37594978 ATGTCCTGGCTGAGGGTCTTAGG + Intronic
1152002660 17:77656094-77656116 ATGAACAGGCTCGGGGTGGATGG + Intergenic
1152343169 17:79736513-79736535 ATGACCAGGCACTGTGTGATAGG + Intronic
1156029530 18:32695995-32696017 ATAAACAGACTCAGGGTGCTTGG + Intronic
1156090720 18:33465544-33465566 GTTACCAGGGTCAGGGAGTTAGG + Intergenic
1157332391 18:46713357-46713379 ATGAACAGGTTTGGGGTGTTGGG + Intronic
1157624573 18:49040346-49040368 ATGACCTGGCCAAGGGTCTTGGG + Intergenic
1161103467 19:2432598-2432620 GTGACCAGGGTCAGGGTGATGGG - Intronic
1161103501 19:2432703-2432725 GTGACCAGGGTCAGGGTGACAGG - Intronic
1161103529 19:2432808-2432830 GTGACCAGGGTCAGGGTGACGGG - Intronic
1161103564 19:2432912-2432934 GTGACCAGGGTCAGGGTGACGGG - Intronic
1161103633 19:2433121-2433143 GTGACCAGGATCAGGGTGACGGG - Intronic
1161103735 19:2433436-2433458 GTGACCAGGGTCAGGGTGACGGG - Intronic
1161103770 19:2433541-2433563 GTGACCAGGGTCAGGGTGACGGG - Intronic
1161103840 19:2433751-2433773 GTGACCAGGGTCAGGGTGACGGG - Intronic
1163482696 19:17567436-17567458 ATGAGCAGGCTCAGTGTGTCAGG - Exonic
1166529547 19:43534347-43534369 ATGACCAGGCTGATGGGGATAGG - Exonic
1166698090 19:44865639-44865661 ATGACCTGGCTCAGAGTCATAGG + Exonic
1167253651 19:48414832-48414854 GTGACCAGGCTTGGGGAGTTTGG - Intronic
927850845 2:26498366-26498388 ACCACCAGGCGCATGGTGTTGGG + Intronic
937146877 2:119655026-119655048 CTGTCCAGGCTCTGGGTGTCTGG - Intronic
937419398 2:121741524-121741546 AAGTCCATGATCAGGGTGTTGGG + Intronic
937499456 2:122462404-122462426 ATGAGCATGCACAGTGTGTTTGG - Intergenic
938803191 2:134782256-134782278 AGCACCAGGGTCAGGGTTTTAGG + Intergenic
940847063 2:158652893-158652915 CTACCCAGGCTCAGGGTGTGAGG - Intronic
942950098 2:181712316-181712338 ATGACCAGGCAGAGGGGGTGGGG + Intergenic
946225385 2:218261614-218261636 AGGCCCAGGCTCAGGGTGCTGGG + Intronic
948932541 2:241141465-241141487 ATGACGGGGCTGAGGGTTTTGGG - Intronic
1169197843 20:3692957-3692979 AGCTCCAGGCGCAGGGTGTTGGG + Exonic
1169199517 20:3701437-3701459 ATCTCCAGGCGCAGGGAGTTGGG + Exonic
1170848347 20:19981342-19981364 ATGGCCTGGGTCAGGGGGTTGGG - Intronic
1174129847 20:48335693-48335715 ATGACCAAGCTCAAAGTGTATGG - Intergenic
1175640362 20:60624434-60624456 AGGGCTAGGCTCTGGGTGTTTGG - Intergenic
1175787787 20:61723103-61723125 ATGACCAGACTCATGGTGATCGG - Intronic
1176075324 20:63245605-63245627 AAGGCCAGGCTCTGGGGGTTGGG - Intronic
1176546250 21:8201743-8201765 TTGACCTGACTCAGGGCGTTTGG + Intergenic
1176565201 21:8384789-8384811 TTGACCTGACTCAGGGCGTTTGG + Intergenic
1182920322 22:34073278-34073300 AGGAGCAAGCTTAGGGTGTTGGG - Intergenic
1183102911 22:35594754-35594776 CAGACCAGGCTCAGGGGCTTGGG + Intergenic
1183524371 22:38314928-38314950 CTGACCAGGAACAGGGTGTCCGG - Intronic
1203251122 22_KI270733v1_random:117980-118002 TTGACCTGACTCAGGGCGTTTGG + Intergenic
954635155 3:52067210-52067232 ACGGGCAGGCCCAGGGTGTTGGG - Intergenic
956047381 3:65210159-65210181 AGTACCAGACCCAGGGTGTTTGG + Intergenic
956090615 3:65662856-65662878 ATTACCAGGGGCAGGGAGTTGGG - Intronic
956963913 3:74436099-74436121 ATGCCTAGGTTCAGGGTATTTGG + Intronic
961868135 3:129968933-129968955 GTGACCAGGCTCAGTGAGGTGGG + Intergenic
962748525 3:138415933-138415955 ATAGTCAGGCTGAGGGTGTTTGG - Intergenic
965511934 3:169577573-169577595 AAGACCAGACTCATAGTGTTAGG + Intronic
965706204 3:171510696-171510718 AAGGCCAGGCTAAGGATGTTTGG - Intergenic
966919644 3:184603173-184603195 AATACCAGGCACGGGGTGTTGGG - Intronic
967895132 3:194389321-194389343 AAGTCCAGGCTCTGGGGGTTAGG - Intergenic
969117221 4:4878205-4878227 ATGGACCGGCTCAGGGTGATGGG + Intergenic
969253859 4:5989682-5989704 ATGACCATGATCAGTGGGTTCGG + Exonic
970278964 4:14433141-14433163 AGGATCAGTCTCATGGTGTTTGG - Intergenic
978294922 4:107193864-107193886 ATAGCAAGGCTCAGGGAGTTGGG + Intronic
978859617 4:113432562-113432584 ATGCCCAGGTTCTGGGTATTAGG - Intergenic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
988655241 5:33204219-33204241 ATTCCCAGTGTCAGGGTGTTTGG + Intergenic
995861160 5:116641977-116641999 ATGAGAAGGCAGAGGGTGTTTGG + Intergenic
997222147 5:132178291-132178313 CTGACCAGGCTAAGGCTATTTGG + Intergenic
1001434607 5:171689371-171689393 ATGCCCAGGCTCTGGCTGGTTGG - Intergenic
1003449836 6:6220275-6220297 AAGAACAGTCTCAGGGTGATGGG + Intronic
1003905898 6:10699397-10699419 ATGCCCAGGCTGTGGGTGTAGGG + Intronic
1005851353 6:29825314-29825336 ATGACCAGGAGCTGGTTGTTGGG - Intergenic
1006961905 6:37940131-37940153 ATGACCAGGCTTAGGTTTATGGG + Intronic
1007588303 6:43006396-43006418 ATGGCCAGGCCCAGGGTGGGAGG + Intronic
1008909365 6:56716809-56716831 CAGACCAGGGTCAGGGTGGTGGG + Intronic
1010038296 6:71351899-71351921 AGGACCATGGTCTGGGTGTTAGG + Intergenic
1014760646 6:125352996-125353018 ATGATGAGGCTCAGGGTAATGGG - Intergenic
1017376840 6:153780474-153780496 ATGGCCTGGCACAGGGTGTTGGG + Intergenic
1018372759 6:163183399-163183421 ATGACCAAACTCAGTGTTTTAGG + Intronic
1019478267 7:1254542-1254564 AGGACCAGGCTCTGGGTGCTGGG - Intergenic
1020129857 7:5553598-5553620 ATGTCCAGTGTCAGGGTGTCAGG - Intronic
1023022020 7:36019222-36019244 GGGAGCAGGCTCAGGGCGTTGGG - Intergenic
1026443090 7:70460639-70460661 AAGACCAGGCTCAGCGGGTGGGG - Intronic
1041010294 8:53535684-53535706 ATGATTAGCCTCAGGGTATTGGG - Intergenic
1043890107 8:85644615-85644637 AAGATGAGGCTCAGGGTGATTGG - Intergenic
1045017119 8:98009714-98009736 ATGCACAGACTCAGGGTGTGGGG + Intronic
1047111800 8:121798571-121798593 ATAAACAGGGTCAGGGTATTTGG - Intergenic
1051608473 9:18939299-18939321 ATGACCATGGGTAGGGTGTTGGG - Intronic
1203467527 Un_GL000220v1:101247-101269 TTGACCTGACTCAGGGTGTTTGG + Intergenic
1185698889 X:2215482-2215504 ATTCCCAGGCTCTGGGTATTAGG - Intergenic
1185699039 X:2216465-2216487 ATTCCCAGGCTCTGGGTATTAGG - Intergenic
1190553341 X:51608246-51608268 AAAACCAGGCTGAGGGTGTGTGG + Intergenic
1192047569 X:67692277-67692299 ATCACCAGCCTGAGGGTCTTTGG - Intronic
1195319087 X:103706806-103706828 ATGGCCAGGCTCTGGGTGGGAGG + Intergenic
1198107843 X:133477903-133477925 ATTCCCAGGCTCAGGCCGTTGGG - Intergenic
1200010251 X:153114969-153114991 AAGAACAGGCTGGGGGTGTTGGG + Intergenic
1200029349 X:153284953-153284975 AAGAACAGGCTGGGGGTGTTGGG - Intergenic
1200070774 X:153527953-153527975 GGGACCAGCCTCAGGGTGTGTGG + Intronic
1200953932 Y:8927087-8927109 ATGACCAGGATCAAGGTCTCTGG + Intergenic