ID: 900540302

View in Genome Browser
Species Human (GRCh38)
Location 1:3199389-3199411
Sequence TCCGGAGCCCCTTGCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900540293_900540302 23 Left 900540293 1:3199343-3199365 CCAGGCTGGAAATACGTGAACAT 0: 1
1: 0
2: 0
3: 10
4: 77
Right 900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900540302 Original CRISPR TCCGGAGCCCCTTGCCAGTG GGG Intronic
900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG + Intronic
901003572 1:6160923-6160945 TCCACAGCCCCTTCCCAGGGAGG + Intronic
902391039 1:16106667-16106689 TCCGTGGACCCTTGCCAGTGGGG - Intergenic
903424690 1:23245093-23245115 GCCTGAGCCCCTTGACAATGCGG - Intergenic
903662089 1:24984461-24984483 TCTGGAAGCCCTTGACAGTGGGG + Intergenic
903879197 1:26497229-26497251 TCCAGAGCTCCTTGCCAGGTTGG + Intergenic
904389733 1:30174369-30174391 TCCAGAGCACCTAGCCAGTGGGG - Intergenic
906774606 1:48518118-48518140 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
909598991 1:77441649-77441671 CCCGGAAGCCCTTGCCACTGAGG - Intronic
912727066 1:112067936-112067958 ACCTGAGCCCCATGCCAGTATGG - Intergenic
917799595 1:178558872-178558894 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
924295460 1:242582634-242582656 TCCTGAACCCCTTGCCAGGCTGG + Intergenic
1065490831 10:26280038-26280060 GCCAGAGCACCTGGCCAGTGAGG - Intronic
1066802836 10:39209265-39209287 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1068166578 10:53339554-53339576 TCTGCAGACCCTTGCCAGCGGGG - Intergenic
1077531012 11:3094738-3094760 TCAGGAGCCCAATGCCAGAGCGG - Intronic
1078533754 11:12156867-12156889 TCCTGAGCACCCTGCGAGTGTGG + Intronic
1082301417 11:50510516-50510538 TCTGCAGACCCTTGCCAGTGGGG + Intergenic
1085278357 11:75314252-75314274 TCCCAGGCCCCTTGCCATTGTGG - Intronic
1087783328 11:102325325-102325347 TCCTGAGCAGCTTGCAAGTGCGG + Exonic
1094266351 12:28564785-28564807 GCCTGAGCCCCTTGGCAATGCGG + Intronic
1097724069 12:63054098-63054120 TCCTGAACTCCTTGCCACTGAGG - Intergenic
1101984210 12:109432925-109432947 GCTGGAGGCCCGTGCCAGTGCGG - Exonic
1103145225 12:118589803-118589825 TGCAGAGCTCCTTGCCAGGGTGG + Intergenic
1103566723 12:121819834-121819856 TCCAGAGCCCCCTGCCAAGGAGG + Exonic
1112216013 13:97432973-97432995 TCGCGAGCCCCTTGCCACCGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114474015 14:22981727-22981749 ACGGGAGCCCCTTGCCAGCGGGG - Exonic
1115924235 14:38412949-38412971 GCCTGAGCCCCTAGCCAGAGGGG + Intergenic
1117072274 14:52068273-52068295 TCCAGACTCCCTGGCCAGTGGGG - Intronic
1119668385 14:76500288-76500310 TCCGGCTCCCCTTGCCTGTGGGG + Intronic
1122122189 14:99560575-99560597 TGCGCAGCCCCTTCCCTGTGAGG - Intronic
1122801281 14:104230854-104230876 GCCAGAGCCCCGGGCCAGTGTGG + Intergenic
1124046520 15:26155722-26155744 TAGGGAGGCCCTTCCCAGTGAGG + Intergenic
1125759353 15:42086236-42086258 TCCGGAGCAGCTTGCCAGGGAGG + Exonic
1125765264 15:42131273-42131295 TGGGGAGCCTCTTGTCAGTGTGG + Intergenic
1128133592 15:65246611-65246633 CCCTGAGCCCCTACCCAGTGAGG - Intronic
1137581452 16:49635968-49635990 TCTGCAGCCCCTGGCCATTGGGG + Exonic
1142183134 16:88681381-88681403 TCCGGAGCCCCGTGCCGGTCTGG + Exonic
1144605912 17:16665734-16665756 TCTGCAGCCTCTTCCCAGTGAGG - Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1147855484 17:43476527-43476549 GCCTGAGCCCCTTGGCAATGCGG - Intergenic
1148333555 17:46826347-46826369 TGCCTAGGCCCTTGCCAGTGAGG - Intronic
1149558379 17:57590695-57590717 ACTGGAGCCCCTTGGAAGTGTGG + Intronic
1151318637 17:73339080-73339102 ACCAGACCCCCTTGGCAGTGAGG - Intronic
1152592790 17:81222125-81222147 CCCAGAGCCGCTTGCAAGTGTGG - Intronic
1154470242 18:14693498-14693520 TCAGGAGACCCTACCCAGTGAGG + Intergenic
1158652588 18:59301061-59301083 TCCTAAGGCCCTTCCCAGTGAGG - Intronic
1162042451 19:7979021-7979043 TACTGAGCCCCTGGCCAGTGTGG - Intronic
1162764919 19:12913251-12913273 TCCTGGGCCCCCTGCCAGCGTGG - Intronic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1163201438 19:15772269-15772291 CCAGGAACCCATTGCCAGTGAGG + Intergenic
1165218638 19:34296392-34296414 GCCTGAGTCCCTTGGCAGTGCGG + Intronic
1165866042 19:38939683-38939705 TCTGTGGACCCTTGCCAGTGGGG - Intronic
1166380201 19:42351597-42351619 GCCCCAGCCCCTTGCCGGTGGGG - Intronic
1167359629 19:49023333-49023355 TCCGCAGCCCCTGACCAGAGAGG + Intronic
1167361502 19:49032752-49032774 TCCGCAGCCCCTGACCAGAGAGG - Intronic
1167362152 19:49036033-49036055 TCCGCAGCCCCTGACCAGAGAGG + Intronic
1167363932 19:49044825-49044847 TCCGCAGCCCCTGACCAGAGAGG - Intronic
1167364566 19:49048102-49048124 TCCGCAGCCCCTGACCAGAGAGG + Intronic
1167365851 19:49054738-49054760 TCCGCAGCCCCTGACCAGAGAGG + Intronic
1167863549 19:52305630-52305652 TGTGGCACCCCTTGCCAGTGGGG - Intronic
925013325 2:502899-502921 GCAGGAGGCCCTTGCCACTGTGG + Intergenic
927041421 2:19234451-19234473 TGCCAAGCCCCTTGCCAGGGAGG + Intergenic
927118154 2:19925156-19925178 TCTGTGGACCCTTGCCAGTGGGG + Intronic
927209568 2:20630734-20630756 TCTGAAGCCCCTGTCCAGTGAGG - Intronic
927981449 2:27377466-27377488 TGTGGAGCCCCTGGCCAGCGGGG + Exonic
928093821 2:28392366-28392388 CCCCGAGCCCCTTCCCAGGGCGG + Intergenic
928116842 2:28551242-28551264 TCAGGGGCCCCCTACCAGTGTGG - Intronic
930183380 2:48386542-48386564 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
935025783 2:99275773-99275795 TCTGTGGACCCTTGCCAGTGGGG - Intronic
942673811 2:178405524-178405546 TCCTGAGCCTCTTGACACTGTGG + Intergenic
946083381 2:217147035-217147057 TCCAGAGCCCAGAGCCAGTGTGG - Intergenic
946206663 2:218113841-218113863 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
948003434 2:234587842-234587864 TCCAGAGCCTCTTGAAAGTGTGG - Intergenic
948217439 2:236242291-236242313 TCAGGAGCCACTTTCCAGAGAGG + Intronic
1169001063 20:2168405-2168427 TCTGCATCACCTTGCCAGTGGGG + Intronic
1172469428 20:35180524-35180546 TCCAGAGCTCCCTGCCAGGGAGG + Intergenic
1172829842 20:37824310-37824332 TGAGGAGACCCTTGACAGTGAGG + Intronic
1174487431 20:50870293-50870315 GCCGCAGCCCCTCGCCAGTCTGG - Intronic
1175199637 20:57268211-57268233 TCTTGAGCCCCATGCCAGGGAGG + Intergenic
1176173816 20:63708314-63708336 TCCGGAGCCCCTTCCCCGCGGGG - Intronic
1176804253 21:13464368-13464390 TCAGGAGACCCTACCCAGTGAGG - Intergenic
1179054857 21:37921906-37921928 TCCGGATCCCCCTTCCAGTAAGG - Intergenic
1179409101 21:41148448-41148470 TCCAGACCCCCTTGCTTGTGTGG - Intergenic
1182520282 22:30881110-30881132 TGCAGAGCCCCTGGGCAGTGTGG - Intronic
1183091691 22:35526559-35526581 TACGGAGGCCTTTTCCAGTGCGG - Intergenic
1184292088 22:43502782-43502804 TTAGGAGCCCCTAGCCCGTGAGG - Intronic
1184774774 22:46617686-46617708 TCTGGGGCCACTTGCCAGCGTGG - Intronic
953434018 3:42864520-42864542 TCCGCAGCCACTCGCCACTGAGG + Exonic
956142064 3:66156069-66156091 TCTGGAGCCCCTGAACAGTGAGG - Intronic
958594238 3:96201346-96201368 TCAGGAGGCCCTGCCCAGTGAGG - Intergenic
959198080 3:103211043-103211065 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
969486046 4:7472999-7473021 TATGGAGCCCCTGGCCTGTGGGG + Intronic
969858922 4:10020861-10020883 CCCGGAGCCCCCTGCCTGTGTGG + Intronic
971229836 4:24792367-24792389 TCCTGCGCACCCTGCCAGTGAGG + Intronic
974473869 4:62354951-62354973 TCCTGAACCCCTTGCCTGTCAGG - Intergenic
977125704 4:93164901-93164923 TCTGCAGCCCCTTTCCAGAGAGG + Intronic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
980297528 4:130941884-130941906 TCTGTAGACTCTTGCCAGTGGGG + Intergenic
981603971 4:146522658-146522680 TCCGGATCCCCTTCCCTCTGCGG + Intergenic
986998809 5:13638031-13638053 GCCTGAGCCCCTTGGCAATGCGG + Intergenic
989758801 5:44987691-44987713 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
991604668 5:68388724-68388746 TCTGGAGCCCATTGCAACTGTGG + Intergenic
992407328 5:76472163-76472185 TCAGGAGCCCTGTGCCAGCGAGG + Intronic
992715848 5:79510759-79510781 CCCTGAGCCCCTTGGCAATGCGG - Intronic
993246565 5:85459597-85459619 TCAGGAGGCCCTGCCCAGTGAGG + Intergenic
995592436 5:113713373-113713395 TCTGTTGACCCTTGCCAGTGGGG + Intergenic
995947705 5:117669695-117669717 TCTGGAGCCCCTTGCTATTAAGG - Intergenic
1000052489 5:157575177-157575199 TCCCGAGCGCCCTGCCCGTGTGG - Intronic
1001710844 5:173776724-173776746 TAGGGAGCCCCTTGCCCCTGGGG + Intergenic
1002387088 5:178876233-178876255 TCGGGAGGCCCTGTCCAGTGAGG + Intronic
1002460750 5:179372463-179372485 CCTTGAGCCCCTTGCCAGTGTGG + Intergenic
1005375213 6:25174896-25174918 TCCTAAGCCCCTCGGCAGTGTGG - Intergenic
1006473062 6:34238728-34238750 GCCCGAGGCCCTTTCCAGTGAGG - Intronic
1009250450 6:61292110-61292132 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1009946579 6:70347687-70347709 TCAGGAGGCCCTGCCCAGTGAGG + Intergenic
1013832752 6:114293960-114293982 TCTGGAGTGCCTTGCAAGTGAGG + Intronic
1015181262 6:130365364-130365386 TCCGGAACCCCTTGCCGGGCCGG + Intronic
1015786354 6:136923506-136923528 CCCGGAGCCCCTGCCCCGTGGGG - Intronic
1018838515 6:167502635-167502657 TCCGGTGCTGCTTCCCAGTGTGG - Intergenic
1023760877 7:43464027-43464049 TCCAGATCCCCATGCCAGGGTGG - Intronic
1024748216 7:52431493-52431515 TCCGCAGGCCCTGGGCAGTGAGG - Intergenic
1029377368 7:100187599-100187621 GCCTGAGCCCCTTGGCATTGTGG + Intronic
1030820196 7:114085020-114085042 TCCGGAGCCCCAGCCCAGAGGGG - Intergenic
1033299833 7:140176378-140176400 TCCGCAGCCCCTCGCCAGCCCGG - Intronic
1037581196 8:20246937-20246959 TCCAGAGCCTCTTTCCAGAGAGG + Exonic
1039701202 8:39963550-39963572 TCGGAAGCCCCTTTCCAGAGAGG + Intronic
1040381569 8:46877983-46878005 TCTGTGGACCCTTGCCAGTGAGG + Intergenic
1040878389 8:52176542-52176564 TCCGGAGCACATTCACAGTGTGG + Intronic
1048493683 8:134917761-134917783 TCCGGACCCATATGCCAGTGAGG - Intergenic
1049483477 8:142839232-142839254 TCAGGAGCCCCTTCCAAGGGTGG + Intronic
1053164075 9:35832484-35832506 TCTGTAGCCCCTGGCCACTGTGG + Intronic
1054324386 9:63705822-63705844 TCCGGAGAGCATTGCCAGGGCGG + Intergenic
1056708742 9:88972995-88973017 TCCTCAGCCCCCTGCCGGTGGGG + Intergenic
1057835742 9:98443737-98443759 CTCTGAGCCCCTTGACAGTGGGG - Intronic
1059176415 9:112173638-112173660 GCCTGAGCCCCTTGGCAATGCGG + Intronic
1061602748 9:131682474-131682496 TCTGTGGACCCTTGCCAGTGGGG + Intronic
1062402619 9:136379099-136379121 TCAGGAGGCCCGTGCCAGGGAGG - Exonic
1062589673 9:137267902-137267924 TCCCAAGCCCCTCGCCAGTTAGG - Intronic
1190581702 X:51896841-51896863 TCAGGAGGACCTTGCCAGTCTGG - Exonic
1193048748 X:77079303-77079325 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
1194536071 X:95107123-95107145 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1196495247 X:116317335-116317357 TCCAGACCCCATTGCCACTGTGG - Intergenic
1197365630 X:125562104-125562126 TCGGGAGTCCCTGCCCAGTGAGG - Intergenic
1199596438 X:149509753-149509775 TCCTCAGCCCAATGCCAGTGAGG + Intronic
1200547325 Y:4533436-4533458 TCTGGAGGTCCTGGCCAGTGAGG - Intergenic
1201370195 Y:13254661-13254683 TCTGTGGACCCTTGCCAGTGGGG + Intronic