ID: 900540371

View in Genome Browser
Species Human (GRCh38)
Location 1:3199732-3199754
Sequence CCTTGGGGCTCGAGTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900540371_900540386 29 Left 900540371 1:3199732-3199754 CCAGCTGCACTCGAGCCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 900540386 1:3199784-3199806 GGCCCTTGATGCCTCCCACATGG 0: 1
1: 0
2: 1
3: 20
4: 145
900540371_900540379 -7 Left 900540371 1:3199732-3199754 CCAGCTGCACTCGAGCCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 900540379 1:3199748-3199770 CCCAAGGGGCCCTCCGGGACAGG 0: 1
1: 0
2: 2
3: 17
4: 144
900540371_900540384 8 Left 900540371 1:3199732-3199754 CCAGCTGCACTCGAGCCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 900540384 1:3199763-3199785 GGGACAGGACGCCACTCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900540371 Original CRISPR CCTTGGGGCTCGAGTGCAGC TGG (reversed) Intronic
900540371 1:3199732-3199754 CCTTGGGGCTCGAGTGCAGCTGG - Intronic
900762681 1:4483471-4483493 CCTTGGGCCTGGAGACCAGCAGG + Intergenic
900959838 1:5911887-5911909 CCTGGGGCCTGGAGTACAGCGGG - Intronic
910363766 1:86441782-86441804 TCTTGTGGCTCAAGTGCAGATGG + Intronic
913689135 1:121261680-121261702 CCTTGGAGCTGGAGACCAGCTGG - Intronic
914148463 1:145018601-145018623 CCTTGGAGCTGGAGACCAGCTGG + Intronic
914947731 1:152081029-152081051 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
917788852 1:178486901-178486923 CCTTGGGGCTGGAGGGCCGCTGG + Intergenic
919882664 1:201911135-201911157 CCTTGGCACTTGAGTGCATCTGG - Intronic
920476458 1:206280155-206280177 CCTTGGAGCTGGAGACCAGCTGG - Intronic
922937063 1:229431206-229431228 GCTTGGGGCGGGAGTGGAGCAGG - Intergenic
923106315 1:230856641-230856663 CCTTGGGTGTCCAGAGCAGCTGG + Intronic
924458655 1:244238656-244238678 CTTTGGGGAGCAAGTGCAGCAGG + Intergenic
1065634762 10:27719871-27719893 CCTTGGGCCTCGAGAGTAGCTGG - Intronic
1066026572 10:31364270-31364292 CCCTGAGGCTAGAGTCCAGCTGG - Intronic
1066291205 10:34015997-34016019 GCTTGGAGCTCCATTGCAGCAGG + Intergenic
1067741402 10:48898361-48898383 CCCTGGGCCTCCAGGGCAGCTGG + Intronic
1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG + Intergenic
1071661167 10:87504702-87504724 ACTTGTGGCTCGGGTGGAGCCGG - Intergenic
1071896296 10:90071079-90071101 CATTCAGGCTGGAGTGCAGCTGG + Intergenic
1073272838 10:102280796-102280818 CCATGTGGCAGGAGTGCAGCTGG + Intronic
1076368534 10:129937050-129937072 CCTTGGGGCCCGAATGAAGCTGG - Intronic
1077056169 11:594344-594366 TCTAGTGGCTCGAGGGCAGCTGG + Intronic
1077089782 11:773189-773211 GCTTGGGGCTCAAGGCCAGCAGG - Intronic
1077318023 11:1927925-1927947 CCTTGGGGCACATGTGCACCGGG - Intronic
1077516877 11:3007405-3007427 CCTTGGGGCTTGAGTGTAAATGG - Intronic
1085273755 11:75285316-75285338 CCTTGGGGGCAGAGTCCAGCTGG + Intronic
1085307223 11:75493661-75493683 GCTTGGGGGAGGAGTGCAGCAGG + Intronic
1090806036 11:130202928-130202950 CCCAGGGGCTGGAGTGCAGTTGG - Intronic
1092278377 12:7080604-7080626 CCTGGGGCATCGGGTGCAGCAGG - Exonic
1095860939 12:46917357-46917379 CCTTGGGGCAGGGCTGCAGCTGG + Intergenic
1095942510 12:47736273-47736295 CCATGGGGCTGAAGTGCAGAGGG + Intronic
1095976337 12:47943111-47943133 CCTGGGGGCTGGACAGCAGCAGG - Intergenic
1096106626 12:48999794-48999816 CCATGGGGCTGGGGTGCAGGAGG + Intergenic
1096700977 12:53382520-53382542 CACTGGGGCCCAAGTGCAGCAGG + Exonic
1097850342 12:64404808-64404830 ACTCGGGGCTCGGGGGCAGCGGG + Intronic
1098092276 12:66916282-66916304 CCCTGAGGCTGGAGTACAGCAGG + Intergenic
1100816493 12:98391823-98391845 CTTTTGAGCTCGAGTGCAACAGG + Intergenic
1103796506 12:123506638-123506660 CCGTGAGGCTCGATGGCAGCAGG - Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1109521160 13:63512057-63512079 CCTTGGGGCTCCAGGGTTGCTGG + Intergenic
1110626933 13:77662847-77662869 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1113789066 13:113017745-113017767 CCATGGGGCTGGGGTCCAGCTGG + Intronic
1114530355 14:23391583-23391605 CCATGGGCCTCAAGTGCAGAGGG + Intronic
1115474263 14:33799102-33799124 CCCTCAGGCTGGAGTGCAGCAGG - Intronic
1116057179 14:39877929-39877951 CCTTGAGGCTCCAGAACAGCAGG + Intergenic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1122321224 14:100856956-100856978 CATTTGGGCTCAAATGCAGCAGG + Intergenic
1122357774 14:101134297-101134319 CCTTGGGGCTGCACTGCAGACGG - Intergenic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1127784861 15:62346751-62346773 GCTAGGGGCTCAAGTGCAGGAGG + Intergenic
1129661325 15:77554628-77554650 CCTTGGGGAGCGAGCGCAGAAGG + Intergenic
1132459108 16:41548-41570 CCCTGGGGCTCTAGTGCCGCAGG - Intergenic
1132674284 16:1115220-1115242 CCTTGGAGCTCTAGTGCATCTGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1135639082 16:24104726-24104748 CCCTGGGGCAGGAGTGCACCCGG + Intronic
1138120881 16:54400277-54400299 CTTTGGAGCGGGAGTGCAGCAGG + Intergenic
1140953959 16:79845300-79845322 CCATGGGGCATCAGTGCAGCAGG + Intergenic
1141075959 16:81006892-81006914 CCTTGGGGCCCGCGGGCGGCGGG - Exonic
1141702240 16:85647912-85647934 ACATGGGGCTGCAGTGCAGCAGG - Intronic
1141971817 16:87489665-87489687 CCTTGGGACTGGGGTGTAGCGGG + Intronic
1142880366 17:2878770-2878792 CCGTGGGGCTCCTGGGCAGCAGG - Intronic
1145107211 17:20128504-20128526 GCTTGGGGCAAGAGTGCAGCGGG + Intronic
1145982151 17:29019293-29019315 ACATGGGGCTTCAGTGCAGCTGG + Intronic
1146824209 17:36009256-36009278 CGCTGGGGCCCTAGTGCAGCTGG + Intergenic
1147447612 17:40484313-40484335 CCTTGGGGCTGGAGGGCATCGGG + Intronic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1152242561 17:79168002-79168024 CCCTGGGGCTGGGGTCCAGCCGG - Intronic
1152583376 17:81178754-81178776 CCTCGGGCCTCCAGTGCAGCGGG - Intergenic
1152692682 17:81727281-81727303 CCTTGGGCCTCAAGGGCACCAGG + Intergenic
1160811396 19:1014511-1014533 CCTTGGGTGTCGGCTGCAGCTGG - Intronic
1160940531 19:1618574-1618596 CCCTGGGGCTGGACTGCACCTGG - Intronic
1160967569 19:1753379-1753401 GCTTGGTGCTCGAGTGGGGCCGG + Exonic
1161121443 19:2529042-2529064 CCCTGAGGCTGGGGTGCAGCAGG + Intronic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1161470177 19:4453352-4453374 CCTTGGGGCTCAAGGGCTGTTGG - Intronic
1163554596 19:17984863-17984885 ACCTGGGGCTCGAGTGAAGAAGG - Intronic
1163659214 19:18566917-18566939 CCTTGGGGCTGGAGGCCGGCTGG + Intronic
1167464954 19:49645794-49645816 CCTTGGGGCTGGCATGCAGGAGG + Intronic
1167494440 19:49809377-49809399 CCGTGGGGCTCCCGTGCGGCAGG + Exonic
1168235537 19:55060852-55060874 CCTTGGGAATCTCGTGCAGCGGG - Intronic
1168337720 19:55605753-55605775 CCCGGGGGCCCGGGTGCAGCGGG + Intronic
927697439 2:25247741-25247763 CCTTGGGGCTCCAGGACGGCCGG - Exonic
932063493 2:68529685-68529707 CCCTGAGGCTAGAGTCCAGCTGG - Intronic
934063754 2:88320680-88320702 GCTTGGGGAAAGAGTGCAGCTGG - Intergenic
936239417 2:110773972-110773994 CCCTGGGATTCCAGTGCAGCTGG + Intronic
942315895 2:174696320-174696342 CCTTGGGGCCATAGTTCAGCAGG + Intergenic
946007536 2:216538450-216538472 GCTCCGGGCTCCAGTGCAGCAGG - Intronic
948117872 2:235507000-235507022 CCCTGGAGCTCGTGGGCAGCTGG + Intronic
948638987 2:239361177-239361199 CCTTGGGCCAGGGGTGCAGCAGG - Intronic
948759164 2:240179801-240179823 CCCCTGGGCTGGAGTGCAGCAGG - Intergenic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1171032717 20:21691689-21691711 TCATGGGGCAGGAGTGCAGCTGG + Intergenic
1171484312 20:25476496-25476518 CCTTTCGGCGCGAGCGCAGCGGG - Exonic
1171520893 20:25773218-25773240 CCTTGGGGCTAATGTTCAGCTGG - Intronic
1171556031 20:26083273-26083295 CCTTGGGGCTAGTGTTCAGCTGG + Intergenic
1175257806 20:57657537-57657559 CGTCGGGGCTTGAGAGCAGCAGG + Intronic
1176051380 20:63121217-63121239 CGTGTGGGCTCCAGTGCAGCTGG - Intergenic
1177133860 21:17290059-17290081 CCTTGCCCCTCCAGTGCAGCAGG + Intergenic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1178974300 21:37208509-37208531 CCCGGGGGCTCCAGTGCATCTGG + Intergenic
1179427293 21:41291763-41291785 CCTAGAGACTGGAGTGCAGCAGG - Intergenic
1180014634 21:45074372-45074394 CGTTGGGGCTGGAGCGCGGCCGG - Intronic
1181022252 22:20109634-20109656 CTGTGGGGCTCAAGGGCAGCAGG + Intronic
1182691926 22:32170307-32170329 GTTTGGGGTTCGAGTGCAGGAGG + Intergenic
1184950685 22:47840600-47840622 CTTTCAGGCTGGAGTGCAGCAGG + Intergenic
1185109230 22:48891603-48891625 CCTTGGGGCTGGAGTGTTGGTGG + Intergenic
950423835 3:12914251-12914273 CATTGGGCCTCAAGGGCAGCTGG - Intronic
950681172 3:14586077-14586099 CCCTGGGGCAAGAGTGCACCTGG - Intergenic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
953022993 3:39127724-39127746 CCCTGGGGCTTGAGGGCTGCGGG - Intronic
954194097 3:48985935-48985957 CCTTAGGGCTCCCGTGAAGCTGG - Exonic
956408409 3:68952650-68952672 CCTTGGGTATCCAGTGCAGTGGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
959327596 3:104956966-104956988 CCTTGGGGCTCGACAGTTGCTGG - Intergenic
961148048 3:124611785-124611807 TCTTGTGGCTGGAGCGCAGCTGG - Intronic
965401718 3:168220456-168220478 CCTTGGGGCTTTAATTCAGCAGG + Intergenic
968468655 4:766043-766065 TCTTGGGTCTGTAGTGCAGCAGG - Exonic
972817317 4:42657731-42657753 CCATGGGGCTTGGGTGCATCTGG + Intergenic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
988737088 5:34033360-34033382 CCTGGGGCCTCGAGGGGAGCGGG - Exonic
997722263 5:136088637-136088659 CCTTGAGGCTTGAGTCAAGCTGG + Intergenic
998233953 5:140381601-140381623 CCGAGGGGCTACAGTGCAGCTGG + Intergenic
999199346 5:149804912-149804934 CCTCAGGGGCCGAGTGCAGCTGG - Intronic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1002887251 6:1308756-1308778 ACTTGGGGCTCGAGGTCAGGTGG - Intergenic
1003171717 6:3725835-3725857 CCATGGGGCTCGGGAGCATCTGG - Intronic
1005243054 6:23853969-23853991 CCCTGAGGCTAGAGTCCAGCTGG + Intergenic
1009398789 6:63230557-63230579 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1011254094 6:85403433-85403455 CCATGGGGGTCTAGTGAAGCAGG - Intergenic
1014867507 6:126550508-126550530 CCTAGGGGTTTGAGAGCAGCAGG - Intergenic
1015510746 6:134035883-134035905 CCTTGGTGCTCTTGTGCTGCAGG - Intronic
1019652094 7:2165502-2165524 CCTGGTGGCTGGAGTGCGGCAGG - Intronic
1022495452 7:30850301-30850323 CCTTGGGGCTCCTGGGCTGCAGG + Intronic
1023616486 7:42025263-42025285 CCCAGGGGCTCGGGGGCAGCAGG - Exonic
1023739025 7:43261500-43261522 CCTTGGGGGTTAAATGCAGCTGG + Intronic
1029055236 7:97733626-97733648 CCTCGGGGCCGGAGTACAGCGGG + Intronic
1034530468 7:151693262-151693284 CCTTGGGCCTCCTGTGCTGCGGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1038373174 8:27012592-27012614 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1038477366 8:27877683-27877705 GCTTGGGGCTGGATTCCAGCTGG - Intronic
1047248984 8:123167366-123167388 CCTTGGGGCCCCAGGGCTGCTGG - Intergenic
1048180701 8:132191976-132191998 ACTTGGACCTCAAGTGCAGCAGG - Intronic
1051539834 9:18203210-18203232 TCCTAGGGCTAGAGTGCAGCTGG - Intergenic
1052413167 9:28147743-28147765 CCCTGAGGCTAGAGTCCAGCTGG + Intronic
1060399840 9:123342056-123342078 CCTGGGGGCTTGGCTGCAGCAGG - Intergenic
1060773310 9:126348314-126348336 CCTTGGGGCCAGGGTGCGGCAGG - Intronic
1061789007 9:133048803-133048825 CCTTGGGGCCCGAGGGCAGCTGG - Intronic
1062079912 9:134618372-134618394 CCTGTGGGCTCCAGTGCAGATGG - Intergenic
1203632474 Un_KI270750v1:81781-81803 CCTTGGGGCTGATGTTCAGCTGG - Intergenic
1187142896 X:16611238-16611260 CCTAGGAGCTCGAGACCAGCCGG + Intronic
1189709599 X:43795813-43795835 CCTTGGAGACCGAGTGAAGCTGG - Exonic
1195989341 X:110667215-110667237 CCTTCAGGCTGGAGTGCAGTGGG + Intergenic