ID: 900541961

View in Genome Browser
Species Human (GRCh38)
Location 1:3207389-3207411
Sequence GTGGAAACACTCTGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900541961_900541967 -7 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541967 1:3207405-3207427 TTTCCACGGACGGTTTTAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
900541961_900541968 -6 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541968 1:3207406-3207428 TTCCACGGACGGTTTTAAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
900541961_900541972 29 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541972 1:3207441-3207463 TTGTGACTAAGTCACCAGGCAGG 0: 1
1: 0
2: 0
3: 23
4: 259
900541961_900541971 25 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541971 1:3207437-3207459 ACATTTGTGACTAAGTCACCAGG 0: 1
1: 0
2: 2
3: 16
4: 101
900541961_900541970 1 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541970 1:3207413-3207435 GACGGTTTTAAAGGGGAAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 112
900541961_900541966 -8 Left 900541961 1:3207389-3207411 CCCAGAGGCCAGAGTGTTTCCAC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 900541966 1:3207404-3207426 GTTTCCACGGACGGTTTTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900541961 Original CRISPR GTGGAAACACTCTGGCCTCT GGG (reversed) Intronic
900541961 1:3207389-3207411 GTGGAAACACTCTGGCCTCTGGG - Intronic
901106247 1:6758737-6758759 GTGGGAACTCTCTGTCTTCTAGG - Intergenic
905101399 1:35525913-35525935 GGGGAAACACTCTAGCATATTGG - Intronic
905344186 1:37300375-37300397 GAGCAAACACCCTGGGCTCTGGG - Intergenic
905456486 1:38091725-38091747 TAGAAAGCACTCTGGCCTCTTGG + Intergenic
905926589 1:41754292-41754314 GAGGCAACCCTCTGGCTTCTGGG + Intronic
908318184 1:62954919-62954941 GTGGAAACACTCTTGGCTTCCGG - Intergenic
908418718 1:63938508-63938530 GTGGGCACACTCAGGCCTCAAGG - Intronic
909896202 1:81072627-81072649 GTGGAAAGCTTGTGGCCTCTAGG - Intergenic
910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG + Intergenic
911242892 1:95484239-95484261 GAAGACACACTCTGGCCTTTGGG - Intergenic
911844933 1:102740651-102740673 ATGGAAAAATTTTGGCCTCTTGG - Intergenic
912397080 1:109353850-109353872 AGGGAAACACACTGGTCTCTGGG + Intronic
912487361 1:110039720-110039742 GTGTAAAAACTCTGGCATCAGGG - Intronic
913325437 1:117624045-117624067 GTGGAAACCCTCAGGTCTCAAGG - Exonic
917127495 1:171700567-171700589 GTGGAAAAACTCTGGCTTTATGG - Exonic
917389671 1:174521757-174521779 TTGGAAACACTAGGGCCTTTTGG + Intronic
917410359 1:174754101-174754123 GAGGACATACTCTGGCCACTGGG + Intronic
917699001 1:177561261-177561283 GAGGAAACAGTCTTGCTTCTGGG - Intergenic
918366858 1:183817194-183817216 CTGGTAACATTCTTGCCTCTGGG - Intronic
918543454 1:185656857-185656879 GTTGAACCACACTGACCTCTGGG - Intergenic
920778918 1:208969090-208969112 GTGAAAATGCTCTGGCCACTTGG + Intergenic
920850772 1:209626704-209626726 GTGCACACACTCCGGCCTGTTGG - Intronic
924240092 1:242032067-242032089 TTTGAAACACTCTGTTCTCTTGG - Intergenic
924583811 1:245344574-245344596 GGGCAATCACTCTGGCTTCTGGG + Intronic
924946940 1:248852863-248852885 GTAGGGACACTCTGGCCTCATGG + Intronic
1063422583 10:5925096-5925118 GTGGAGCCACTCTGTCCTCTGGG + Intronic
1065108666 10:22417776-22417798 CTGGAAACACTGTGGCCTAGGGG - Intronic
1066129537 10:32379020-32379042 GAAGGAACACTCTGGCTTCTTGG + Intergenic
1070839876 10:79477507-79477529 GTGGAAATACTCTTCCCTCAAGG + Intergenic
1072308552 10:94132038-94132060 GTGCAAACACTCTGAGCACTCGG - Intronic
1072450949 10:95539215-95539237 GTTGAGAAACTCTGGCCTTTGGG - Intronic
1072748467 10:97958807-97958829 GTGGATTCTCTCTGGCCCCTGGG - Intronic
1076344660 10:129772254-129772276 GTGGGAAAGCTCTGCCCTCTAGG + Intergenic
1079343674 11:19633539-19633561 GTGGAAACACACTGGGCTGTTGG - Intronic
1080130776 11:28792371-28792393 GAAGAGACACTCTGGCCTTTTGG + Intergenic
1082959204 11:58902796-58902818 GGGCAAACACTCTGTCCTCAGGG + Intronic
1085453719 11:76654423-76654445 CTGGAAAGAGTCTGGCCTCTGGG - Intergenic
1085829719 11:79886495-79886517 GAGGAAAGACACTGGGCTCTGGG + Intergenic
1086451834 11:86924811-86924833 GTGGAAATAAGCTGGGCTCTTGG - Intronic
1087275274 11:96154928-96154950 GCTGTAACACTCCGGCCTCTTGG + Intronic
1088167502 11:106956342-106956364 GATGAAGCACTCTGGCCTTTTGG + Intronic
1089637240 11:119822958-119822980 CTGGAAACACTCTCTCCTCTGGG - Intergenic
1091875976 12:3933127-3933149 TTGGGGACACTCTGCCCTCTAGG - Intergenic
1092640147 12:10497770-10497792 GTGGAACCTCTGTGGCTTCTAGG - Intergenic
1093190843 12:16073429-16073451 GTAGAAACACTCTGGAATGTGGG - Intergenic
1094000803 12:25692088-25692110 GTGAAAACACACTGTCCTCAGGG - Intergenic
1097079757 12:56421415-56421437 GTGGATAAACTCTTGGCTCTGGG - Exonic
1099828996 12:87815925-87815947 GTGAAACCAATCTGGTCTCTTGG - Intergenic
1102731321 12:115113355-115113377 GTGGCAACAGTGTGGCCTCAAGG + Intergenic
1102962453 12:117101439-117101461 CTGGAAACAGGCAGGCCTCTGGG + Intergenic
1105053766 12:133079120-133079142 GAGGTTACACTCTGGCCTGTTGG + Intergenic
1107864025 13:44686189-44686211 GTGAAAACTCACTGACCTCTGGG + Intergenic
1110923598 13:81120877-81120899 GTGAAAAAGATCTGGCCTCTTGG - Intergenic
1111077820 13:83262222-83262244 GTGGAAACACTATGCACTGTTGG - Intergenic
1112326648 13:98446280-98446302 CTGGAATGACTCAGGCCTCTTGG + Intronic
1113487288 13:110663556-110663578 GAGGAGACTCTCTGGCCTCAGGG + Intronic
1113750385 13:112772991-112773013 GTGGACACACTCAGGGTTCTTGG - Intronic
1115781279 14:36771557-36771579 GTAGACAAACTGTGGCCTCTGGG - Intronic
1116034557 14:39612407-39612429 GTGCAAACATCCTGGCCTCTTGG - Intergenic
1116560804 14:46376663-46376685 GAAGAAGCACTCTGGCCTTTTGG + Intergenic
1117019425 14:51554333-51554355 GTGGAGATACTCTGGCCTCAAGG + Intronic
1118311140 14:64694033-64694055 GTGAAAAGATTCTGGCCACTGGG + Intergenic
1120212435 14:81646730-81646752 GTGGGCAAAATCTGGCCTCTGGG + Intergenic
1122692518 14:103538000-103538022 CTGAAAACTCTCTGCCCTCTAGG - Intergenic
1123040464 14:105488226-105488248 GTGGGAAGACGCTGACCTCTGGG + Exonic
1123952990 15:25302040-25302062 GTGGAATCATTGTGCCCTCTTGG + Intergenic
1125390133 15:39183827-39183849 GTGGAATCAAGATGGCCTCTTGG - Intergenic
1126094319 15:45077401-45077423 GTGGGAAGACTCTGGGGTCTTGG + Intergenic
1128920415 15:71605353-71605375 ATGTAAAGACTTTGGCCTCTAGG + Intronic
1128931956 15:71713271-71713293 GTGGCTACCCTCTGGCCTTTGGG + Intronic
1130896237 15:88172488-88172510 GAGTAAACATTCTGGCCTCTGGG - Intronic
1131059090 15:89393417-89393439 ATGGAAAGATTCTGGCCTCAAGG + Intergenic
1131302313 15:91210396-91210418 GTGGAAATTCCCTGTCCTCTAGG - Intronic
1132243052 15:100275716-100275738 GTGGAAGCACTTTGCCATCTGGG + Intronic
1142590378 17:1002445-1002467 GTACAAACACTCGGGCCTCCAGG - Exonic
1146505849 17:33404699-33404721 GTGCAAACATTCTGCTCTCTGGG - Intronic
1146528087 17:33584115-33584137 TTGCTAATACTCTGGCCTCTAGG + Intronic
1147877192 17:43629998-43630020 GTGGAAAGAATCTGGCCTTTAGG - Intergenic
1148116079 17:45175880-45175902 GGGAAAACTCTCTGGTCTCTTGG + Intergenic
1148760568 17:49997746-49997768 ATGGACCCACTCTGGCATCTTGG - Intergenic
1152420295 17:80189194-80189216 CTGGAAAGACTCCGCCCTCTGGG + Intronic
1152946496 17:83200507-83200529 GTGCCAACACCCTGGCCTCGGGG - Intergenic
1157446265 18:47748826-47748848 GAGGGAACCCTCTGGCCTCCAGG + Intergenic
1158708091 18:59812166-59812188 ATGGAAACACTCTTACCTGTGGG - Intergenic
1159155729 18:64579203-64579225 GAAGAGACACTCTGGCCTGTTGG - Intergenic
1159593834 18:70363350-70363372 GTGAAAACCCCCAGGCCTCTTGG - Intergenic
1159972205 18:74668498-74668520 GTAGAAACACTCTGAACACTGGG - Intronic
1160257894 18:77262957-77262979 GAGAAAACACTCCGGCCTCAGGG + Intronic
1162860064 19:13499747-13499769 GGGAAAACACTCCGGACTCTGGG - Intronic
1163636415 19:18438915-18438937 GTGGAAACTTTCCGGCCTCCAGG - Intergenic
1166792953 19:45408674-45408696 GTGGAGACACTGGAGCCTCTGGG + Exonic
927148528 2:20182515-20182537 GAGGCAATACTGTGGCCTCTGGG + Intergenic
929199342 2:39218759-39218781 TTTGAAACTCTCTGTCCTCTGGG + Intronic
929405642 2:41637928-41637950 GAAGAGACACTCTGGCCTTTTGG - Intergenic
934560821 2:95312434-95312456 GTGGAAAGGCCCTGCCCTCTAGG - Intronic
935155883 2:100483032-100483054 GTGTAAGCACTATGGCCTCAGGG - Intronic
935732563 2:106076358-106076380 GGTGAAACAATCTTGCCTCTTGG - Intronic
935834076 2:107031221-107031243 CTGGAAAGACTCTGGGCCCTTGG + Intergenic
936268931 2:111033553-111033575 GTAGACACACTGTGGGCTCTAGG - Intronic
939229442 2:139407682-139407704 CTGGAAAAATTCTGGCCACTTGG + Intergenic
942924204 2:181412179-181412201 GAAGACACACTCTGGCCTTTTGG - Intergenic
945706226 2:213236000-213236022 GTTGAACCACTCTGACCTATAGG + Intergenic
945919771 2:215743879-215743901 ATGCACATACTCTGGCCTCTTGG + Intergenic
948696258 2:239734538-239734560 TTGGAAACACAGTGGCCTCTGGG + Intergenic
1169245429 20:4020905-4020927 GGAGAAATACTCTGGCCTCCTGG - Intergenic
1169282696 20:4280697-4280719 CTGTGACCACTCTGGCCTCTTGG + Intergenic
1169693582 20:8361155-8361177 CTTGACACAGTCTGGCCTCTAGG + Intronic
1169726383 20:8737830-8737852 GCGGAAACTCTCTGTGCTCTGGG + Intronic
1170207546 20:13814847-13814869 GTGGAAAGAATCTGGACTTTGGG - Intronic
1170604461 20:17865315-17865337 GTGGGAACACTCTGGTCTAGAGG - Intergenic
1173638369 20:44581005-44581027 AAGGAAACACTCAGGCCACTAGG - Intronic
1173868432 20:46327634-46327656 CTGGAAACACCCTGGGCCCTGGG + Intergenic
1174109888 20:48191732-48191754 GCGGAGACAGTCTGGCCTCTAGG + Intergenic
1174305313 20:49610781-49610803 GTCCTAACACTCTGGCCTCCTGG - Intergenic
1174687243 20:52467729-52467751 GGGGACACACTGGGGCCTCTCGG - Intergenic
1181469140 22:23127311-23127333 ATAGGGACACTCTGGCCTCTTGG - Intronic
1181469357 22:23128300-23128322 ATAGGGACACTCTGGCCTCTTGG + Intronic
1182017921 22:27056319-27056341 GTGGGAAAACCCTGGCCACTGGG + Intergenic
1182202030 22:28582956-28582978 GTGAACACACTCTTTCCTCTGGG - Intronic
1182733541 22:32514097-32514119 ATGGAAAGAATGTGGCCTCTGGG - Intronic
1185071416 22:48658805-48658827 GTGGCCACAGTGTGGCCTCTTGG + Intronic
950267789 3:11588120-11588142 GTGGAAACACTCTTCCCTTTGGG - Intronic
951528196 3:23673695-23673717 ATGCAAATACTCTGCCCTCTAGG - Intergenic
951669481 3:25164116-25164138 GAGGATACAGTCTGGCCACTGGG + Intergenic
952925560 3:38316954-38316976 GATGAAGGACTCTGGCCTCTTGG + Intronic
953876840 3:46671439-46671461 GTGGAAATGCCCTGGCCCCTGGG - Intronic
955673134 3:61423407-61423429 TTTGTAACACTCTGGCCTCTAGG - Intergenic
955944135 3:64175432-64175454 GTGGAAACACTCTTCTTTCTTGG + Intronic
956521609 3:70110300-70110322 GGGGAAATACTCTGAGCTCTAGG - Intergenic
956620006 3:71212433-71212455 GTGTAAAGAATCTGGCTTCTTGG - Intronic
958564666 3:95794429-95794451 ATGGAATCCCTATGGCCTCTCGG + Intergenic
959894428 3:111590428-111590450 GTGGAAATACTCTGGGGACTTGG + Intronic
960454589 3:117854873-117854895 CTGAAAACACTGTGACCTCTTGG - Intergenic
962184738 3:133246301-133246323 GTGGAAATAGTCTGGCATGTGGG + Intronic
962375453 3:134855318-134855340 GTCCAAAGCCTCTGGCCTCTGGG - Intronic
969373134 4:6746806-6746828 GTGCACACACTCGGGACTCTTGG - Intergenic
969830178 4:9789627-9789649 GTGGAAACCCCTGGGCCTCTAGG + Intronic
970288053 4:14539997-14540019 GAAGAGACACTCTGGCCTTTTGG - Intergenic
972324985 4:38006899-38006921 ATGGGAACACTCTGGTTTCTTGG - Intronic
972723144 4:41720955-41720977 ATGGAACCAGTCTGGACTCTTGG - Intergenic
974135771 4:57815513-57815535 GTGCAAACATTGTGGCCTCCTGG - Intergenic
974768778 4:66383612-66383634 GAAGAGACACTCTGGCCTTTTGG - Intergenic
975516342 4:75252555-75252577 GTAGAAACACTCTGTCTTCCAGG - Intergenic
977236074 4:94508630-94508652 TTGGAAACAATCTGGCATCCAGG + Intronic
977630922 4:99241912-99241934 GTGGAAACTCTCTGGCACATTGG - Intergenic
978656956 4:111075626-111075648 GTAGAGATACTCTGGCCTTTTGG - Intergenic
980993678 4:139760769-139760791 CTGGATACACTCCAGCCTCTTGG - Intronic
983012552 4:162565005-162565027 GTGGAAACATTTTGCCCTGTTGG - Intergenic
986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG + Intergenic
987900018 5:23999215-23999237 CAGGAAATACTCTGGCCTCAGGG - Intronic
990619986 5:57549487-57549509 GAAGAAGCACTCTGGCCTTTTGG + Intergenic
992097561 5:73377087-73377109 GTTGAAACCCTGGGGCCTCTGGG - Intergenic
993624189 5:90204534-90204556 CTGGAAAAACTATGGCCTATAGG + Intergenic
993808025 5:92436887-92436909 GAAGAAGCACTCTGGCCTTTTGG - Intergenic
994148480 5:96421147-96421169 GTTGAAAGTCTCTTGCCTCTGGG + Intronic
998822151 5:146066892-146066914 GTGGTCAGACTCTGGCATCTTGG + Intronic
1001344170 5:170875815-170875837 GAAGAAGCACTCTGGCCTTTTGG + Intronic
1004407867 6:15351426-15351448 ATGGAAAGACACTGGCCTCATGG + Intronic
1007686248 6:43668939-43668961 GTTGGAACACTCTGTCCTGTTGG + Intronic
1008114083 6:47527376-47527398 TTGGAATCACTTTGGTCTCTTGG - Intronic
1009558235 6:65202907-65202929 GTGGAAGCTCTCAGGCCTCATGG - Intronic
1012608007 6:101182166-101182188 GTGGACACAATATGTCCTCTGGG + Intergenic
1014442268 6:121487409-121487431 ATGGAAAAACTCTGGCCTACAGG + Intergenic
1014605691 6:123471588-123471610 GTGGAAACATTTTGGCCTGGAGG - Intronic
1014866764 6:126541732-126541754 CTGCAAACTCACTGGCCTCTTGG - Intergenic
1015599027 6:134894486-134894508 GTGGGTCCACTCTGGCCTCTGGG + Intergenic
1015794828 6:137001249-137001271 GTGGGTGTACTCTGGCCTCTTGG - Exonic
1015878254 6:137845716-137845738 GTGGGAACACTCTGGCCAGAGGG + Intergenic
1016640886 6:146348182-146348204 GTGAAAACACTTTGGCTTCCTGG - Intronic
1017057664 6:150452720-150452742 GTGGAAACAGCCTGGCCTAGAGG - Intergenic
1017984171 6:159428009-159428031 GTAGAAACACCAGGGCCTCTTGG - Intergenic
1018077603 6:160230769-160230791 GTGCCAGCAATCTGGCCTCTGGG + Intronic
1022300155 7:29095335-29095357 GTAGAAACACTCTGGGCTGGGGG - Intronic
1024638649 7:51311292-51311314 GGAGAAACCCTGTGGCCTCTTGG - Intronic
1024694941 7:51846265-51846287 GTGGAAAGACTATGGGCTTTGGG - Intergenic
1028459301 7:91072595-91072617 GTAGAGGCACTCTGGCCTTTTGG - Intronic
1029956800 7:104648960-104648982 ATGGACACATCCTGGCCTCTAGG + Intronic
1030310169 7:108060829-108060851 GTGGAGATACTCTGTCCTCGAGG + Intronic
1030701447 7:112646162-112646184 GAAGAAGCACTCTGGCCTTTTGG + Intergenic
1032564810 7:132930544-132930566 GTGGAAACACTCTGCATTCGAGG - Intronic
1032776940 7:135122964-135122986 GAGGAGGCACTCTGGCCTTTTGG - Intronic
1032920039 7:136534857-136534879 GAGGAAGCACTCTGGCCTTTTGG - Intergenic
1038415697 8:27393717-27393739 GTGGGAACACTCTGCACTTTCGG - Intronic
1038436604 8:27540885-27540907 GTGAAAACCCTCTGCCCTATGGG - Intronic
1039372505 8:37001007-37001029 CTGGAAACAGTCTGGACTCATGG + Intergenic
1040546536 8:48402350-48402372 GAGGAAACACCACGGCCTCTCGG - Intergenic
1040808651 8:51424793-51424815 ATGGTTACACTCTGGCCTATTGG - Intronic
1042328987 8:67557905-67557927 ATCTAAACACTCTTGCCTCTAGG - Intronic
1042630075 8:70806336-70806358 GAAGAGACACTCTGGCCTTTTGG - Intergenic
1045106979 8:98902041-98902063 CTGGAAACACTCTATTCTCTTGG + Intronic
1045487038 8:102639946-102639968 GTGGGAGCACTCAGCCCTCTAGG + Intergenic
1047677944 8:127223468-127223490 GTGGGCAAACTCTGGCTTCTTGG - Intergenic
1049780309 8:144425817-144425839 GGGGTAGCACTCTGGGCTCTAGG - Intronic
1050244767 9:3677223-3677245 GAGGAAGCACTGTGGCTTCTTGG - Intergenic
1052371553 9:27671023-27671045 CTGGATTCACACTGGCCTCTTGG + Intergenic
1052378988 9:27749790-27749812 GTGGGCACACTATGGCCTGTGGG - Intergenic
1054933636 9:70663731-70663753 ATGGATACACCCTGGCTTCTTGG + Intronic
1055456445 9:76476738-76476760 TCGGAAACACACTGGCCTTTTGG + Intronic
1056583253 9:87909942-87909964 ATGTAGACACTCTGGCCTGTGGG + Intergenic
1057159548 9:92878145-92878167 ATGTAGACACTCTGGCCTGTGGG + Intergenic
1062064952 9:134521772-134521794 TTGGAAGTCCTCTGGCCTCTGGG - Intergenic
1062143460 9:134973347-134973369 ATGGAAACAATTTGTCCTCTTGG - Intergenic
1062389125 9:136327218-136327240 GTGCAGCCACACTGGCCTCTGGG - Intergenic
1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1187237554 X:17482458-17482480 GTGCAGACACTCTGGCCTCGAGG + Intronic
1188247836 X:27855925-27855947 GTGCCAACACAATGGCCTCTGGG - Intergenic
1192210415 X:69124132-69124154 GTGGAAACTTTCTGGCTTGTAGG - Intergenic
1192481968 X:71493429-71493451 GAGAAAACAATCTGGCCTTTTGG - Intronic
1192589842 X:72350834-72350856 CTGGAATCATTCTGGCCTCGGGG - Intronic
1194058086 X:89163058-89163080 GTAGAAGCACTCTGGCCTTTTGG + Intergenic