ID: 900542797

View in Genome Browser
Species Human (GRCh38)
Location 1:3212502-3212524
Sequence CAGAACATGGGGACGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900542797_900542811 29 Left 900542797 1:3212502-3212524 CCTGCCTCCGTCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 21
4: 327
Right 900542811 1:3212554-3212576 CTGCACCCCAGAGTCTTTGAAGG 0: 1
1: 1
2: 0
3: 18
4: 234
900542797_900542807 2 Left 900542797 1:3212502-3212524 CCTGCCTCCGTCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 21
4: 327
Right 900542807 1:3212527-3212549 CGCCTCTCAGAGGTCCTGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 166
900542797_900542805 -8 Left 900542797 1:3212502-3212524 CCTGCCTCCGTCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 21
4: 327
Right 900542805 1:3212517-3212539 ATGTTCTGGGCGCCTCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
900542797_900542806 -2 Left 900542797 1:3212502-3212524 CCTGCCTCCGTCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 21
4: 327
Right 900542806 1:3212523-3212545 TGGGCGCCTCTCAGAGGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900542797 Original CRISPR CAGAACATGGGGACGGAGGC AGG (reversed) Intronic
900130112 1:1083802-1083824 CTGCACAGGGGGACGGAGGCCGG + Intronic
900412777 1:2520471-2520493 CAGCACATGGGGCGGGGGGCGGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901232127 1:7647158-7647180 CGGAACAGAGGGAGGGAGGCTGG - Intronic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
902546799 1:17195334-17195356 CAGAGCATGGGGACAGCGACAGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
903366330 1:22807549-22807571 CAGACCATGGGGGTAGAGGCTGG - Intronic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904027630 1:27514354-27514376 CAGAACATGTGGAAGGAGCTAGG - Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904086849 1:27915383-27915405 CAGCAAATGGGGTCTGAGGCAGG + Intergenic
904849644 1:33447669-33447691 CAGAACCTGGGGCCGGTGACAGG + Intergenic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916358745 1:163943447-163943469 CAGCACTTTGGGAGGGAGGCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916723498 1:167503022-167503044 AAGAACATGGGAAGTGAGGCAGG + Intronic
917336797 1:173931918-173931940 CTGAACAGGGGGGTGGAGGCAGG + Exonic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
919164135 1:193870764-193870786 GAGAACATGTGGACAGAGGAAGG - Intergenic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920504032 1:206504113-206504135 GGGAACTTGGGGAGGGAGGCTGG + Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
921127360 1:212189478-212189500 CAGGACATGTGGACAGAGGTTGG + Intergenic
922890366 1:229057508-229057530 CAGCAGGTGAGGACGGAGGCTGG - Intergenic
1063996859 10:11627709-11627731 CAGCACTTTGGGACCGAGGCGGG - Intergenic
1065047196 10:21754905-21754927 CAGACCGTGGAGACGGTGGCTGG + Intergenic
1066497394 10:35955400-35955422 CAGAACATGGGGTGGGGAGCAGG + Intergenic
1067033733 10:42898260-42898282 CAGAACCGTGGGACGGAGGGCGG + Intergenic
1067441534 10:46311572-46311594 CAGGAGCTGGGGGCGGAGGCGGG - Exonic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1067843445 10:49700202-49700224 CAGAACATGGGAATGGGGCCTGG - Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1069999824 10:72368024-72368046 CAGAACACGGGGACGGGGAAGGG + Exonic
1071305045 10:84292306-84292328 CAGAAGATGAGGACTTAGGCTGG + Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1073439818 10:103545802-103545824 GAGAAAGTGGGGACTGAGGCAGG - Intronic
1075416538 10:122268497-122268519 AAGAACATGGGGGCGGAGAGGGG - Intergenic
1076572037 10:131439375-131439397 CAGACCCTGGGGCCGGATGCTGG - Intergenic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1079243496 11:18737156-18737178 CAGAACTTGGCGAGGGTGGCAGG + Intronic
1081671604 11:44945637-44945659 CAGGACTTGGGGAGGGATGCAGG + Intronic
1082778901 11:57270987-57271009 AGGAACATGGGGAGGGAGGGAGG - Intergenic
1082828833 11:57600351-57600373 CAGGACCTGGGTAAGGAGGCTGG - Exonic
1083008514 11:59371933-59371955 TAGATCATAGGGACAGAGGCTGG - Intergenic
1084126264 11:67101046-67101068 CAGCACAAAGGGACTGAGGCAGG - Intergenic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085151993 11:74259600-74259622 TAGAGCTTGGGGACGCAGGCAGG - Intronic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1088990635 11:114950428-114950450 CAGATCATGGGGTCAGAGCCTGG - Intergenic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1089072405 11:115710742-115710764 GAGAAGATGGGGTCGGAGGGGGG + Intergenic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090590589 11:128262704-128262726 CAGGACATAGGGAGGGGGGCTGG + Intergenic
1091218570 11:133918033-133918055 CCGGACATGGGGACGGGGGGTGG + Intronic
1091319454 11:134639690-134639712 GAGACCATGGGGACAGGGGCTGG - Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092020794 12:5200726-5200748 CAGACCACGGGGTCGGGGGCGGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096240506 12:49957393-49957415 GAGAGCATGGGGGCGGAGGGGGG - Exonic
1096474090 12:51897335-51897357 CAGAGCCTGGGCACGGATGCTGG + Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096867029 12:54570743-54570765 CAGAACTGGGGGACGGGGGAGGG - Intronic
1097262057 12:57725758-57725780 CCCAACATGGGGATGGGGGCGGG - Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1101738257 12:107479937-107479959 GAGAACATGGGATCTGAGGCTGG - Intronic
1101797671 12:107990739-107990761 CAGGACATGGGGACTGAGTGAGG + Intergenic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1102922041 12:116798820-116798842 CAGCACTTGGAGGCGGAGGCAGG - Intronic
1102962299 12:117100495-117100517 CAGCACATGGCCACAGAGGCTGG + Intergenic
1103395063 12:120600937-120600959 CATAACATGGTGGCAGAGGCGGG - Intergenic
1103465692 12:121140258-121140280 CAGAACCTGGGGAGAGAGGAGGG + Intronic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103862747 12:124027452-124027474 CAGAAGATGGGAACAGATGCAGG - Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105590152 13:21785261-21785283 AGGAATATGGGGACAGAGGCAGG + Intergenic
1105836423 13:24216135-24216157 CAGAGGTTGGGGACGCAGGCAGG + Intronic
1105916613 13:24922859-24922881 CAGGACCTCGGGACGGGGGCGGG - Exonic
1106148370 13:27073101-27073123 CACCACATGGAGACTGAGGCTGG + Intronic
1107943319 13:45394245-45394267 CAGAAGGTGGGGGCGGGGGCGGG - Exonic
1111330297 13:86757400-86757422 CAGAATGTGGGGACTGAGTCAGG + Intergenic
1112766148 13:102746237-102746259 CAGCACCTGGGGTCTGAGGCGGG - Exonic
1113717027 13:112517642-112517664 CAGCACTTTGGGAGGGAGGCAGG + Intronic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1119435107 14:74593332-74593354 AAGAACACGGGGTCGGGGGCAGG + Intronic
1121052402 14:90828141-90828163 CAGCCCATGGGGACTGGGGCCGG + Intergenic
1121293298 14:92794809-92794831 CAGCACAGAGGGAGGGAGGCTGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122276305 14:100592496-100592518 CAGAGCGTGGAGCCGGAGGCTGG + Intergenic
1122411163 14:101526876-101526898 CAGGACTTGGGGACAGAGGGAGG + Intergenic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126233584 15:46355162-46355184 CAGAACATTGAGACGGAGCATGG + Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128028807 15:64461248-64461270 CAGAGCATAGGGTCGGAAGCAGG + Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129393201 15:75230900-75230922 GAGCACCTGGGGACAGAGGCAGG - Intergenic
1131827794 15:96334017-96334039 GGGAACCTGGGGACTGAGGCTGG + Intronic
1132224794 15:100132090-100132112 CGGAGCATGTGGACGGAGACTGG - Exonic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1133224906 16:4336441-4336463 CAGAACATGGCCTTGGAGGCCGG - Intronic
1134244464 16:12529670-12529692 CAGCAAATGGGGGCGGCGGCGGG - Intronic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135213724 16:20546253-20546275 CAGAAAAAAGGGACGGAGGGAGG - Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135940873 16:26820495-26820517 CAGCACATTGGGAGGCAGGCAGG + Intergenic
1136403434 16:30030535-30030557 CAGGACTTGGGCAGGGAGGCAGG + Exonic
1136720567 16:32316595-32316617 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136838947 16:33522877-33522899 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136843959 16:33561049-33561071 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1137489644 16:48920835-48920857 CACCACATGGGGACTGAAGCTGG + Intergenic
1137819637 16:51431603-51431625 GAAAACATGGAGACGGTGGCTGG + Intergenic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141394452 16:83692279-83692301 AAGAGCATGGGGAGGGAGTCTGG + Intronic
1141934430 16:87227843-87227865 CAGGAAATGGGGCCGAAGGCTGG + Intronic
1142154161 16:88525695-88525717 GAGAAAATGGTGACGGAGGAAGG - Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1203005865 16_KI270728v1_random:201175-201197 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1203149110 16_KI270728v1_random:1823164-1823186 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1203154124 16_KI270728v1_random:1861348-1861370 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1145711849 17:26985026-26985048 GAGAACATGGGGCGGGTGGCTGG + Intergenic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148851867 17:50559483-50559505 CAGAACTCGGGGAGGTAGGCGGG + Intergenic
1150746770 17:67823137-67823159 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
1152212634 17:79010436-79010458 CAGAACTTTGGGATGGAGGAGGG - Intergenic
1152301376 17:79496957-79496979 CAGAACAGGGGTCCCGAGGCAGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152904216 17:82961537-82961559 GAAAGGATGGGGACGGAGGCCGG - Intronic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153459371 18:5316543-5316565 AAGGACATGTGGACGGTGGCTGG - Intergenic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155280673 18:24236371-24236393 GAGGAAATGGGGACAGAGGCTGG + Intronic
1157559783 18:48638080-48638102 CATAACATGGGGTCCCAGGCAGG - Intronic
1158664587 18:59420954-59420976 AAGAACATGGGGATGCTGGCTGG + Intergenic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1160495436 18:79371618-79371640 CAGAACAGAGGCACGGACGCTGG - Intronic
1160812579 19:1019373-1019395 CTGAAACTGTGGACGGAGGCTGG - Intronic
1161494097 19:4578236-4578258 AAGGACATGGGGCCGGTGGCTGG + Intergenic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163041569 19:14606857-14606879 CATACCATGGGGACGGGGACGGG + Intronic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1164574488 19:29397773-29397795 GAGAACAGAGGGACCGAGGCAGG - Intergenic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1165915985 19:39260545-39260567 CAGAACTTTGGGGCCGAGGCAGG - Intergenic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1167120341 19:47512975-47512997 CAGAGCCTGGGGACGGTGGTGGG - Intronic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
924961325 2:37182-37204 CAGCACTTTGAGACGGAGGCGGG + Intergenic
925048792 2:795529-795551 GGGAAGACGGGGACGGAGGCAGG + Intergenic
926052707 2:9755012-9755034 CAGAACATGGAAACGGAGCAAGG + Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
927085333 2:19669639-19669661 CAGAACACGGGAACTGAGCCTGG - Intergenic
929501579 2:42494615-42494637 CAGAACGTGGGGGCCGGGGCCGG - Exonic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
934236584 2:90238197-90238219 CAGCACCTGGAGACGGGGGCTGG + Intergenic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
934665041 2:96163978-96164000 CAGCAGCTGGGGGCGGAGGCTGG - Intergenic
937167532 2:119835427-119835449 CAGCACTTCGGGACCGAGGCGGG - Intronic
940293535 2:152099404-152099426 CAGGACTTGGGGACGGAAGCTGG + Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942985939 2:182142350-182142372 GAAACCATGGGGACGGACGCAGG + Exonic
944143917 2:196485669-196485691 CATAACAAGGGGACCGAGGAAGG + Intronic
944509876 2:200453983-200454005 GGGAGCATGGGGAGGGAGGCAGG - Intronic
944668976 2:201979715-201979737 CAGCACTTTGGGACCGAGGCAGG - Intergenic
945221644 2:207489909-207489931 CAGAACTTGGGGACAGGGACGGG - Intergenic
946096058 2:217274820-217274842 AGGATCATGGGGCCGGAGGCTGG + Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946124998 2:217554908-217554930 AAGAACATAGGGACAGAGGTGGG + Intronic
946174956 2:217916907-217916929 CAGAGAATGGGCAGGGAGGCCGG + Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947590685 2:231383386-231383408 TAGGCCAGGGGGACGGAGGCAGG - Intergenic
947758765 2:232588204-232588226 GAGAGCATGGGGTGGGAGGCTGG - Intergenic
947774705 2:232697994-232698016 CGGAACCTTGGGACCGAGGCTGG + Intronic
948560321 2:238847648-238847670 CAGAAGATGAGGACGCAGCCAGG - Intergenic
948911889 2:241009035-241009057 CAGGACATGGGGATGGAGCTTGG + Intronic
1168925080 20:1572522-1572544 CAAAACAGGAGGACGGAGGACGG + Intronic
1168928957 20:1605550-1605572 CAAAACAGGAGGACGGAGGACGG + Intronic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169316846 20:4599137-4599159 GAGAACATGTGGACACAGGCAGG - Intergenic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1171283908 20:23922417-23922439 AAGAACAGGGGGACTTAGGCAGG - Intergenic
1172794818 20:37529349-37529371 CAGAAGCTGCGAACGGAGGCTGG + Intergenic
1172933350 20:38601393-38601415 CAGGACCTGGGCACGGGGGCGGG - Intergenic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1174304905 20:49608251-49608273 CAGACCATGGGGTCAGATGCAGG - Intergenic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1175870182 20:62205671-62205693 CACAAGATGGGAAGGGAGGCTGG - Intergenic
1177812497 21:25939232-25939254 CAGAACATGGGAAGGAAGCCAGG + Intronic
1179080336 21:38164963-38164985 CCAAACATGGGGAGGGAGGGAGG + Intronic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1180242060 21:46515782-46515804 CAGCACTTTGGGAGGGAGGCCGG - Intronic
1180308508 22:11149624-11149646 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180546985 22:16511437-16511459 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180970459 22:19812251-19812273 GAGAACATGGGGCCTCAGGCAGG + Intronic
1182871982 22:33655692-33655714 CAGGACCTGGGGATGGAGACTGG - Intronic
1183777976 22:39980312-39980334 CAGAACCTGGGAACCTAGGCAGG + Intergenic
1183988769 22:41584234-41584256 CAGAACCTGGGGCCTGAGGGAGG - Intronic
1184013012 22:41763551-41763573 AAGAAAATCGGGACTGAGGCTGG + Intronic
1184020428 22:41817483-41817505 CAGCACTTAGGGACCGAGGCAGG + Intronic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184756310 22:46517850-46517872 CAGAATATGGGGACACAGGGTGG - Intronic
1185224066 22:49643188-49643210 CAGAACCTGGGAACTGGGGCAGG - Intronic
949546839 3:5080053-5080075 AACAAAATGGGGATGGAGGCTGG - Intergenic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
951543867 3:23806719-23806741 CGAAACAGGGGGACGGAGGCGGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
953172414 3:40519335-40519357 TAGGACAGGGGGACTGAGGCAGG - Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
954111640 3:48436871-48436893 CAGAACATGGGGGTGGGGGACGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
955074512 3:55601027-55601049 CACACCATGCGGACGGGGGCTGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
958882331 3:99686954-99686976 CAGCACTTTGGGAGGGAGGCAGG - Intronic
960212276 3:114984436-114984458 CAGAAAATGGTGACGGAGCAGGG - Intronic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961350777 3:126300573-126300595 CAGAGCATGGGGACGGGGAAAGG - Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG + Intronic
964231533 3:154475937-154475959 CAGAATATGGGCACAGAGGCAGG + Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964677972 3:159304898-159304920 CAGAAGCTGGGAACAGAGGCAGG - Intronic
967267170 3:187701042-187701064 CAGAACATGGACACAAAGGCTGG - Intronic
967269931 3:187725052-187725074 AAGCACATGGGCACGGAGGTGGG + Exonic
968491001 4:890448-890470 CAGCACATTGGGATGGAGTCTGG - Intronic
968520747 4:1033714-1033736 CAGACAATGAGGATGGAGGCTGG - Intergenic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
968917120 4:3501395-3501417 CTGCACCTGGGGACGGAGCCTGG + Intronic
969538427 4:7770750-7770772 CAGAACCAGAGGACGGGGGCGGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
971282466 4:25252120-25252142 AATAACATGGGGGCGGGGGCGGG - Intronic
971286258 4:25292797-25292819 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
973954486 4:56049330-56049352 CAGACAATGGGGACAGGGGCGGG + Intergenic
973966222 4:56164642-56164664 CAGAGGTTGGGGACGGAGGATGG + Intergenic
976273404 4:83252220-83252242 GGGAGCAGGGGGACGGAGGCTGG + Intergenic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985606416 5:860507-860529 CAGCACATGGGGACTGAGACTGG - Intronic
985647895 5:1093707-1093729 CTGAACACGGGGAGGGAGGTCGG - Intronic
985671452 5:1208971-1208993 CAGAGCAGGGGCACCGAGGCCGG - Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985898170 5:2762967-2762989 CAGCACACGTGGACGGCGGCGGG + Intergenic
986089475 5:4489697-4489719 CAGAACTTGGGGAGCGAGGAGGG + Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
989164170 5:38418379-38418401 CAGAACATCAGGAGGGAGGTGGG + Intronic
990074080 5:51820960-51820982 CAGAAAGTGGGGAGGGATGCAGG - Intergenic
990931299 5:61095151-61095173 GAGAACATGGGCAGGGTGGCTGG + Intronic
994001660 5:94788677-94788699 CTAAACATGGGGAGGGAGGGAGG - Intronic
995439039 5:112169709-112169731 CTAAAGATGGGGACGGAGGGTGG + Intronic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
997000380 5:129752523-129752545 GAGAACATGTGGACGCAGGGAGG + Intronic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
998159943 5:139807783-139807805 AAGAGCCTGGGGAGGGAGGCGGG - Intronic
1000342713 5:160289797-160289819 CAGCACCTGGGGACGGGGGTTGG - Intronic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002186233 5:177456080-177456102 CCGAACAAGGGGATGGAGACCGG - Exonic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003844602 6:10160058-10160080 CAGAACATAGCAACAGAGGCTGG + Intronic
1006267447 6:32937060-32937082 CTGAAAATGGGGACTGAGTCTGG - Intronic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008694541 6:54019180-54019202 CAAAACATGGAAACAGAGGCCGG - Intronic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1013585595 6:111575712-111575734 CAGCAGCTGGGGACGGAGGCTGG + Exonic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1017954885 6:159169481-159169503 CAGAACAGACGGACGGCGGCGGG + Exonic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024274691 7:47668177-47668199 CTGAACCTGGGGACCGAGGAAGG + Intergenic
1024604924 7:51015144-51015166 CGGGACATGGGGGCGGGGGCCGG + Intergenic
1025624265 7:63205456-63205478 CTGAACATGGGGTTGGAGCCTGG + Intergenic
1027426038 7:78062293-78062315 CAGAACATGGGGAGGCATGTGGG + Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029350331 7:100008943-100008965 CAAAACCTGGGGACAGAGGCTGG + Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1031445150 7:121844822-121844844 CAGCACTTTGGGACTGAGGCGGG - Intergenic
1035031118 7:155861343-155861365 CACGAAATGGGGAGGGAGGCAGG + Intergenic
1035173513 7:157033929-157033951 CAGGACGTGGGGTGGGAGGCAGG + Intergenic
1035835627 8:2748717-2748739 CAGAGGATGGGAACGGTGGCAGG + Intergenic
1035975033 8:4300724-4300746 CAGAACACGTGGACGCAGGAAGG - Intronic
1036396637 8:8376632-8376654 CAGGACCTTGGGATGGAGGCTGG + Exonic
1036476359 8:9096875-9096897 CAGAAAGTGGGAACAGAGGCCGG - Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1038249565 8:25890485-25890507 CAGAACATGGGTTTGGAGTCAGG + Intronic
1040513630 8:48117050-48117072 CAGACCATAGGGACTGAGGTGGG + Intergenic
1041703712 8:60821837-60821859 CAGCACGTGGGAGCGGAGGCAGG + Exonic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1043450076 8:80357512-80357534 GAGAACATGGGGACGAGGGAGGG - Intergenic
1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG + Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1047270114 8:123349788-123349810 CAGAACTTGGGGGCTGAGGTGGG + Intronic
1048274610 8:133056918-133056940 CAGAACCTGGGGATGGTGGAAGG - Intronic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049466340 8:142752748-142752770 CAGGCCATGGTGGCGGAGGCGGG - Intergenic
1053164471 9:35834957-35834979 CAGACAATGGGGTGGGAGGCAGG - Intronic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1057479837 9:95436151-95436173 CAGCACTTTGGGACCGAGGCAGG - Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1059326808 9:113508648-113508670 CAGAACTCAGGGGCGGAGGCTGG - Intronic
1059409820 9:114124838-114124860 CAGACCATGGGCAAGGAAGCAGG + Intergenic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1061840572 9:133356530-133356552 CAGAACCTGGAGCCGGGGGCGGG - Exonic
1062436107 9:136547182-136547204 CAGAGCATGGTGGCAGAGGCAGG + Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1200203872 X:154301887-154301909 AAGAAAATGGGGACTTAGGCCGG - Intronic