ID: 900543059

View in Genome Browser
Species Human (GRCh38)
Location 1:3213669-3213691
Sequence CTGGAATCCTGGGGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 316}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900543059_900543075 29 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543075 1:3213721-3213743 TCTCCCCAGGCAAGGAAGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 171
900543059_900543064 -9 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543064 1:3213683-3213705 GGATTCCAGGAGACTCTGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 247
900543059_900543067 0 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543067 1:3213692-3213714 GAGACTCTGCCTGGCCCAGGAGG 0: 1
1: 0
2: 4
3: 38
4: 385
900543059_900543066 -3 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543066 1:3213689-3213711 CAGGAGACTCTGCCTGGCCCAGG 0: 1
1: 0
2: 3
3: 56
4: 398
900543059_900543072 21 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543072 1:3213713-3213735 GGTTCTGCTCTCCCCAGGCAAGG 0: 1
1: 0
2: 2
3: 19
4: 214
900543059_900543074 28 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543074 1:3213720-3213742 CTCTCCCCAGGCAAGGAAGCGGG 0: 1
1: 0
2: 5
3: 35
4: 342
900543059_900543071 16 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543071 1:3213708-3213730 CAGGAGGTTCTGCTCTCCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 241
900543059_900543073 27 Left 900543059 1:3213669-3213691 CCAGCATTTCCCCAGGATTCCAG 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900543073 1:3213719-3213741 GCTCTCCCCAGGCAAGGAAGCGG 0: 1
1: 0
2: 2
3: 27
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900543059 Original CRISPR CTGGAATCCTGGGGAAATGC TGG (reversed) Intronic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
900768178 1:4519483-4519505 CTGGGATGCTGTGGAAATTCAGG + Intergenic
900933966 1:5753812-5753834 CTGGGATCTGGAGGAAATGCTGG + Intergenic
901814744 1:11787722-11787744 CTGGAGGCCTGGGGAGATGGGGG + Exonic
902558478 1:17260988-17261010 CTGGGATCCTGGCCAAAGGCAGG - Intronic
902563644 1:17295492-17295514 CTGGAAGCTTGGGGAAGAGCAGG + Intergenic
902879319 1:19360509-19360531 CTGGGACACTGGGGAGATGCAGG + Intronic
903060659 1:20666400-20666422 CTGGTATCCTGGGGCAGTGGGGG + Intronic
903162098 1:21496446-21496468 GTGGAATCCTGAGGCAGTGCAGG + Intergenic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
903844729 1:26272077-26272099 CAGGAATCCTTGGGACATGGTGG + Intronic
904649607 1:31994896-31994918 CTTGAATCCTGTGGAAATGAAGG - Intergenic
904835211 1:33331308-33331330 GTGCAGTCCTGGGGAAATGGAGG + Intronic
904967958 1:34394130-34394152 ATGTAATCCTGGGGAGATGAAGG - Intergenic
905629275 1:39509941-39509963 CCGGACACCTGGGGAAATGTGGG + Intronic
905668483 1:39776252-39776274 CCGGACACCTGGGGAAATGTGGG - Intronic
906669485 1:47644124-47644146 CTGGAGTGCTGAGGAGATGCTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908429455 1:64041825-64041847 CTGGAAACCAGGGGATATGATGG - Intronic
913009473 1:114669617-114669639 CCGGCAGCCTGGGGAAACGCGGG - Intronic
913969239 1:143402045-143402067 CTGGAGTCTTGGGGAGATCCTGG + Intergenic
914063616 1:144227644-144227666 CTGGAGTCTTGGGGAGATCCTGG + Intergenic
914115534 1:144738710-144738732 CTGGAGTCTTGGGGAGATCCTGG - Intergenic
915067679 1:153240094-153240116 CTGGCATCCTGAGGAAAAGCTGG - Intergenic
915105675 1:153533899-153533921 CTGGGATCCCGTGGAAGTGCCGG + Intergenic
915223413 1:154393042-154393064 CTGGAATCCTTGTGCATTGCTGG - Intergenic
916850185 1:168695655-168695677 CTGGAACCCTGGGGAGCTACTGG - Exonic
917924363 1:179776619-179776641 CTGGCATCCTATGGAAATGAAGG - Intronic
919054042 1:192546773-192546795 GTGGAGTCATGGGGAAATGCGGG - Intergenic
920208053 1:204307485-204307507 CTGGAAGGCTGGGGGAATTCTGG - Intronic
920717580 1:208355203-208355225 CTGGTATCCTGTGGACATCCAGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
923787884 1:237085679-237085701 CTGGAATCCTGGGAACTTGAGGG + Intronic
924658945 1:245998542-245998564 CTGGAATCCTCGTGCATTGCTGG + Intronic
924692570 1:246365564-246365586 AGGGAATTCTGGGGAAATGATGG + Intronic
1063154678 10:3368386-3368408 AGGGAAGCCTGGGGAAATGGCGG + Intergenic
1063366538 10:5494194-5494216 CTGGCATCCTGGGCAATTCCTGG + Intergenic
1063371857 10:5527398-5527420 CTGGATTCCTGAGGGGATGCTGG + Intergenic
1063811431 10:9713380-9713402 CTGGTATCCAGGGCAAAGGCAGG + Intergenic
1064352891 10:14592919-14592941 CTGGAAGCCTGGGGGAAAGTAGG - Intronic
1065771955 10:29086067-29086089 CTGGACCCATGGGGAAATGTAGG - Intergenic
1065889534 10:30109396-30109418 TTGGAAGTCTGGGGAAATGGTGG - Intronic
1066250754 10:33630570-33630592 CTGGAACCCTGAGAAAATGAGGG + Intergenic
1066331506 10:34428145-34428167 CTTGAAGATTGGGGAAATGCTGG - Intronic
1068957425 10:62830830-62830852 CAGGAGTCCTGTGGAGATGCAGG - Intronic
1069921381 10:71817866-71817888 CTGCTGTCCTGGGGAAATGTGGG - Intronic
1070392760 10:75985570-75985592 CTGGGATCTTGTGGAACTGCTGG - Intronic
1071261933 10:83927892-83927914 TTGGAATCCTTGGGCACTGCTGG + Intergenic
1074459709 10:113625895-113625917 CTGGAAGCCTGGGGAAAGCTGGG + Intronic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1080397433 11:31903008-31903030 CTGGAGCCTTGTGGAAATGCAGG - Intronic
1081193822 11:40136753-40136775 GAGGAATCCTGGGGAAAAGTGGG + Intronic
1083488508 11:62998358-62998380 CTGGGAACCTGGGAAAATGGAGG - Intronic
1084481404 11:69422834-69422856 CTTGACTGGTGGGGAAATGCGGG - Intergenic
1084769607 11:71334259-71334281 GTGGGGTGCTGGGGAAATGCAGG - Intergenic
1088205429 11:107387096-107387118 CTGGAGTTCTGGGTAGATGCTGG - Intronic
1088743567 11:112786262-112786284 CATGATTCCTAGGGAAATGCAGG + Intergenic
1089296618 11:117472797-117472819 CTGGATTCCTCTGGAGATGCAGG - Intronic
1089665257 11:120014037-120014059 CTGGAAACCTGGGGCACAGCTGG - Intergenic
1090063615 11:123484922-123484944 TTGGAACCCTGGGGAGATGTGGG + Intergenic
1090239713 11:125173551-125173573 CTCGAATCTTTGGCAAATGCTGG + Intronic
1090642526 11:128741508-128741530 CTGGAGTCCTCTGGAAAGGCGGG - Intronic
1091901124 12:4144993-4145015 CTGAAATCATGGAGAAATGATGG - Intergenic
1092744648 12:11661913-11661935 ATGGAATCCAGGGGGAATGTTGG + Intronic
1092847715 12:12599673-12599695 ATGGAATCCAGGAGAGATGCAGG - Intergenic
1094051105 12:26221566-26221588 CTGGAAGCCAGGGTAAATGAAGG + Intronic
1095614203 12:44169305-44169327 CTGGAATCCTTGTGCATTGCTGG - Intronic
1097092558 12:56518849-56518871 ATGGAATTCTGTGGAAATGATGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097362454 12:58672757-58672779 CTGCAAGCCTGGGGAAAGGAAGG - Intronic
1098385360 12:69912917-69912939 CTGGAATCTTTGGGAACTGTTGG - Intronic
1100191116 12:92192792-92192814 CTGGGATCCTGAAGGAATGCTGG + Intergenic
1100192735 12:92209922-92209944 CTGGAGTCCTGCGGACAAGCTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101427075 12:104597016-104597038 CTGGAATGCAGGGGAGATGCTGG - Intronic
1102728945 12:115090985-115091007 CTGGAATGCTTGAGGAATGCAGG + Intergenic
1102982122 12:117250256-117250278 CTGGAATTCTGGGGAAAGGAGGG - Intronic
1104383254 12:128326608-128326630 CTGTAATCCTGGGGCTTTGCAGG - Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105350359 13:19609473-19609495 CTGGAATCCTTGTGCACTGCTGG - Intergenic
1105864655 13:24448499-24448521 CTGGAATCCTGGTGCACTGGTGG + Intronic
1106460673 13:29964897-29964919 CTGGAACCCTTGGGGAAAGCAGG - Intergenic
1106609439 13:31264307-31264329 CTGGAGTCACGGGGAAGTGCTGG - Intronic
1107022205 13:35763920-35763942 CAGGCATCCTTGGGAACTGCAGG + Intergenic
1108083615 13:46762277-46762299 CTGGGAACCTGGGGGACTGCAGG - Intergenic
1108786578 13:53910119-53910141 CTGGAATCCTTCTGAAATGGGGG + Intergenic
1111912812 13:94330627-94330649 CTGGGATCTTGTTGAAATGCAGG - Intronic
1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG + Intergenic
1113786632 13:113005346-113005368 GGGGAAGCCTGGGGAGATGCTGG + Intronic
1117616341 14:57537226-57537248 ATAGAATCCTAGGAAAATGCTGG - Intergenic
1119588556 14:75862442-75862464 CTGGAACCCTTGTGCAATGCTGG - Intronic
1119986920 14:79148656-79148678 CTTGGATCCTGGGGAAATTAAGG + Intronic
1121020275 14:90575634-90575656 CTGGGCTCCTGGGGACAGGCTGG + Intronic
1122177907 14:99934705-99934727 CTGGAAACCTGGAGCCATGCAGG - Intronic
1122374317 14:101248248-101248270 CTGGAATCCTGGAGGAACCCTGG + Intergenic
1122546924 14:102528138-102528160 CTGCCATCCTGGGGTAAGGCAGG + Intergenic
1125172670 15:36783957-36783979 CTGGAAACCTGTGGAAAGTCAGG - Intronic
1125246580 15:37647612-37647634 CTGGACTTTTGGGGTAATGCTGG + Intergenic
1126335531 15:47582946-47582968 CTGGAATCCTGTGGGAGTGGAGG - Intronic
1128428137 15:67564344-67564366 TTGGAATCATGTGGAAATGATGG + Intronic
1128613814 15:69094193-69094215 CTGGTATCCTCTGGAAATGGTGG + Intergenic
1128772557 15:70292873-70292895 ATGGGACCCTGGGGAAGTGCTGG + Intergenic
1129122999 15:73414324-73414346 CTGGGACCCTGGGGAAAAGGAGG - Intergenic
1131418242 15:92279287-92279309 CTTGGATCCTGTGGAAATGAAGG + Intergenic
1131450774 15:92537867-92537889 CTGCAGTCATGGGGAACTGCAGG + Intergenic
1131798738 15:96047552-96047574 CTGGAATCCGTGGGCAATTCTGG + Intergenic
1131839952 15:96426516-96426538 ACGTAATCCTGTGGAAATGCAGG + Intergenic
1132006507 15:98232549-98232571 CTGGCCTGCTGGGGACATGCTGG - Intergenic
1132102737 15:99036621-99036643 CAGGAATCCTGGGGAAAGAGAGG + Intergenic
1132399475 15:101496600-101496622 CTGGAACCCCGGGGAAGTGAAGG - Intronic
1132664309 16:1074565-1074587 CCTGGATGCTGGGGAAATGCTGG + Intergenic
1132959076 16:2612290-2612312 CTGGAGGGCTGGGGAAAGGCAGG + Intergenic
1132972136 16:2694265-2694287 CTGGAGGGCTGGGGAAAGGCAGG + Intronic
1133171084 16:3982966-3982988 CTGGAAATCTGGGGACAAGCTGG + Intronic
1133377782 16:5303511-5303533 CTGAAACCCTGGAGAAAAGCTGG + Intergenic
1135230178 16:20698990-20699012 TTGGTATCCTGGTAAAATGCAGG + Intronic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1135519316 16:23161809-23161831 TTGGAAGGCTGGGGAAATGAAGG - Intergenic
1136251796 16:29010105-29010127 CTTAAATCCTGGAGAGATGCCGG + Intergenic
1139258751 16:65571122-65571144 CTGGAATCCTCATGCAATGCTGG + Intergenic
1141311312 16:82915886-82915908 CTGGAATCCTGGCTAACTACAGG + Intronic
1142234887 16:88917382-88917404 CTGGGATGCTGGGGACAGGCAGG + Intronic
1144722193 17:17478955-17478977 CTGTAATCCTAGGGCAGTGCTGG + Intronic
1144739173 17:17571661-17571683 CTGGACTCCTGGGGAGCTGGGGG - Intronic
1151074492 17:71255538-71255560 CTGACATTCTGGGGAAATGCTGG - Intergenic
1151223554 17:72631796-72631818 CTGGAAGCCTGGGGCTTTGCCGG - Intergenic
1151375372 17:73684918-73684940 CTGGAATATTGGGGGAAGGCTGG - Intergenic
1151585848 17:75007991-75008013 CTGGAACTGGGGGGAAATGCAGG + Intergenic
1151615629 17:75208571-75208593 CTGGGGTCCAGGGGAGATGCTGG + Exonic
1151827141 17:76529864-76529886 GTGGAGTCCTCGGGAACTGCTGG - Intronic
1152459620 17:80434557-80434579 CTGGAACCCTTGGGCATTGCTGG - Intronic
1153052935 18:917340-917362 CAGGGAGCCTGGGGAAATGGCGG - Intergenic
1154388763 18:13918744-13918766 GTGGGGTCCTGGGGCAATGCTGG - Intergenic
1154952487 18:21223821-21223843 CAGGAATACTTGGGAAATGTGGG + Intergenic
1156569370 18:38235560-38235582 TTGGACTACCGGGGAAATGCAGG - Intergenic
1157714083 18:49870820-49870842 CTGGAATCCTTGTGCACTGCTGG + Intronic
1158932720 18:62336736-62336758 CTGGAATCCAAGGGCAAGGCCGG - Intronic
1162101046 19:8338951-8338973 CAGGAATGATGGGGAATTGCGGG + Intronic
1163505238 19:17701875-17701897 CTGGAGCTCTGGGGAGATGCAGG + Intergenic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1164371340 19:27646930-27646952 AGGGACTCCTGGGCAAATGCAGG - Intergenic
1165022778 19:32937370-32937392 CTGGGATCCTGGGGGAAGGGAGG - Intronic
1165311491 19:35031304-35031326 CTGGGATGCTGGGGACATGGGGG + Intronic
1165444160 19:35847844-35847866 ATGGAATCCTAGGAAAATTCTGG - Intronic
1166794851 19:45420036-45420058 CTGGACTCCTGGGGATCTGAGGG - Intronic
1167304055 19:48696716-48696738 CGGGAATCCCGGGGAGGTGCAGG + Intronic
925793869 2:7521888-7521910 CTGTAATCCTTGGAATATGCAGG - Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
926784996 2:16509735-16509757 CAGGCTTCCTTGGGAAATGCTGG + Intergenic
927272912 2:21232525-21232547 CTGGGATCCTGGGGTTATGAAGG - Intergenic
929585605 2:43112325-43112347 CTGGTTTCCTGGGGAAGTGACGG - Intergenic
930052095 2:47224424-47224446 CTGGTATTCTGAGGAAATGGAGG + Intergenic
931208034 2:60166430-60166452 CTGGGATCCTGGGGAGCTGTGGG + Intergenic
932195508 2:69779826-69779848 CAGGAATAATGAGGAAATGCGGG - Intronic
932357209 2:71076641-71076663 CAGGAAGGCTGGGGAGATGCTGG + Exonic
932493781 2:72136795-72136817 CTGGAATCCTAAGGACATGAGGG - Intronic
933456709 2:82527213-82527235 CTGATATGCTGGGGATATGCTGG - Intergenic
933994273 2:87656320-87656342 CTAGAATCCTGTGCAACTGCTGG - Intergenic
934173930 2:89562946-89562968 CTGGAGTCTTGGGGAGATCCTGG + Intergenic
934284245 2:91637295-91637317 CTGGAGTCTTGGGGAGATCCTGG + Intergenic
934738582 2:96702963-96702985 ATGTAATCCTGGGGAAATGGCGG - Intergenic
934766319 2:96882099-96882121 CAAGAGTCCTGGGGAAATGCAGG - Intronic
935563403 2:104581759-104581781 CTGGAAGCCTGGGGTAAGTCAGG + Intergenic
935690318 2:105725537-105725559 TTGGAATTCTGTGGGAATGCTGG - Intergenic
936299589 2:111294593-111294615 CTAGAATCCTGTGTAACTGCTGG + Intergenic
936795592 2:116199410-116199432 CTGGAAGTCTTAGGAAATGCAGG - Intergenic
936976966 2:118230212-118230234 CTGGAATCATGCTAAAATGCAGG - Intergenic
939165133 2:138633013-138633035 TTGGAATCCTTGTGCAATGCTGG + Intergenic
939254261 2:139722145-139722167 CTGGAAGCCTGGAAAAATGGTGG - Intergenic
941030420 2:160505101-160505123 CTGGATCCCTGGGGAAATTCAGG + Intergenic
941323680 2:164086619-164086641 CAGGAATCCTTGGGCATTGCTGG + Intergenic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
944135566 2:196395757-196395779 CTGGAATCCTTGTGCATTGCTGG + Intronic
945781399 2:214177417-214177439 CTGGAATACTAGAGAATTGCTGG - Intronic
946151172 2:217772300-217772322 CTGGCATCCTGTGGAATTGCTGG + Intergenic
948916966 2:241039334-241039356 CTGGAGTCATGGGGGAATGGTGG - Intronic
1169902326 20:10566174-10566196 CTCAAATCCTGGGGGAATGAAGG - Intronic
1170473163 20:16688454-16688476 CTGGACTCTTGGGGAAATGGTGG - Intergenic
1170907896 20:20532495-20532517 CTGAAAACCTGGGGGAATGGTGG + Intronic
1171403021 20:24891817-24891839 TCGGGATCCTGGGGAAAGGCAGG - Intergenic
1171412229 20:24955337-24955359 CTGAGAGCCTGGGGAAATGCAGG + Intronic
1171516832 20:25745164-25745186 CTGGCTTCCTGGAGAATTGCTGG - Intergenic
1172968016 20:38852572-38852594 TTAGCACCCTGGGGAAATGCTGG - Intronic
1173086543 20:39924818-39924840 CTGGAATCCTGGAGAAAGTTTGG + Intergenic
1173785461 20:45789902-45789924 CTGGAATCCTGGATAACTGCAGG - Exonic
1174060980 20:47832959-47832981 CTGGAGTCTTGGGGAGGTGCCGG - Intergenic
1174070839 20:47897926-47897948 CTGGAGACCTGGGGAGAGGCCGG + Intergenic
1174070917 20:47898411-47898433 CTGGAGTCTTGGGGAGGTGCCGG + Intergenic
1174100311 20:48122065-48122087 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174100477 20:48122981-48123003 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1175738252 20:61402168-61402190 TTGGTATCCTGGGGAAGTCCTGG - Intronic
1175775452 20:61650465-61650487 CTGGAAGCGTGGGTAAATGCTGG + Intronic
1175818387 20:61895630-61895652 CTGGAATCCAGAGGAAGTGGGGG - Intronic
1176361508 21:6000523-6000545 CTGGAATTCCAGGGAAAGGCTGG + Intergenic
1177761982 21:25412392-25412414 CTGATATCCTAGGGAAATGGAGG + Intergenic
1178603790 21:34017472-34017494 CTGGAATGCTGATGCAATGCTGG + Intergenic
1179762010 21:43538027-43538049 CTGGAATTCCAGGGAAAGGCTGG - Intronic
1179770542 21:43612167-43612189 TTTAAATCCTTGGGAAATGCTGG - Intronic
1180184641 21:46133417-46133439 CTGGGATGCTGGGGAGAGGCCGG - Intergenic
1180626097 22:17194442-17194464 CTGCAGGCCTGGGGGAATGCGGG - Intronic
1181045322 22:20211567-20211589 CAGGATGCCTGGGGAAGTGCAGG - Intergenic
1181560171 22:23695412-23695434 CTGGCTTCCTGAGGAATTGCTGG - Intronic
1181666331 22:24400681-24400703 CTGGAATCCTTGGACACTGCTGG - Intronic
1182148462 22:28012047-28012069 CGGGGATCCCTGGGAAATGCAGG + Intronic
1184036143 22:41919263-41919285 CTGTAACCCTGCCGAAATGCTGG - Intergenic
1184210881 22:43034967-43034989 CTGGAATTGTGGGGGAATGTTGG + Intergenic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1185131225 22:49040199-49040221 CAGGAATCCTGGCCAAGTGCTGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950045233 3:9945082-9945104 CTAGAATCCTGGGAAATTGAGGG + Intronic
950331354 3:12158620-12158642 CTGGACTCCTGGTGTACTGCTGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953891804 3:46756534-46756556 CTGGAATTTTGGGGAATTTCGGG + Exonic
954755199 3:52835437-52835459 CTGGAATCCAGGGGAAGGGATGG - Exonic
955449338 3:59050172-59050194 CGGGACTCCTGGAGAAATGGTGG + Intergenic
956253974 3:67264152-67264174 CTGGACCCATGGTGAAATGCAGG - Intergenic
958037778 3:88190372-88190394 CTGGATCCGTGGTGAAATGCAGG - Intergenic
958880753 3:99666090-99666112 CTGGAATCCTGATGAAATCTTGG + Intronic
961024008 3:123536300-123536322 CTTCAATACTGTGGAAATGCAGG + Intronic
961103545 3:124221979-124222001 CCTGAACACTGGGGAAATGCTGG - Intronic
961488253 3:127232562-127232584 CTGCATCACTGGGGAAATGCAGG - Intergenic
962607421 3:137044384-137044406 CTGGAACCCTGGGGACTTCCTGG - Intergenic
963676162 3:148314818-148314840 CTGTAATCCTGGGCAAGTCCTGG + Intergenic
964542193 3:157791873-157791895 CTGGACATCAGGGGAAATGCAGG + Intergenic
965385689 3:168043691-168043713 TTGAAATCCAGGGGAAATGGAGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965616248 3:170595755-170595777 TTGGAATCCTTGGGCATTGCTGG - Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969060232 4:4428221-4428243 TAGGAACCCTGGGGCAATGCTGG + Intronic
973844157 4:54893832-54893854 CTGGGATGCTGGGGGAATGATGG - Intergenic
976401801 4:84615416-84615438 CTGGAATCCTAGGAAACAGCAGG - Intronic
977914730 4:102578664-102578686 CTGTAATCCGGAGAAAATGCAGG + Intronic
977934824 4:102789610-102789632 CTGGAAACCTGGTACAATGCTGG - Intergenic
978642797 4:110891332-110891354 CTGGAAGACTGGGGAAATGATGG + Intergenic
979059165 4:116033543-116033565 CTGGAACTCTGAGGTAATGCTGG + Intergenic
979231967 4:118356214-118356236 CTGGAAACCTAGGGAAGTGAAGG + Intergenic
981106701 4:140889879-140889901 GGGGAATCTTGGGGCAATGCAGG - Intronic
981131198 4:141160335-141160357 CTGCATTACTGGGGAAATGCTGG + Intronic
984688336 4:182696904-182696926 CTGGAACCAGGGGGAAATCCAGG - Intronic
987540849 5:19253147-19253169 ATGGATTCCTGGGGAAATAGAGG - Intergenic
989063294 5:37432168-37432190 CTGGAATCCTTGTGCAATGTTGG - Intronic
990013730 5:51031862-51031884 CTGGTCTCTTGGGGAAGTGCAGG + Intergenic
990153234 5:52844489-52844511 TTGGAAGCCTGTGGAAATGTGGG + Intronic
990830845 5:59955509-59955531 CTGGAATCCTGAGTAGATTCAGG - Intronic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
995341793 5:111069383-111069405 CTGGAAGCCTAGGAAAATGAAGG + Intergenic
996929990 5:128874780-128874802 TTGGAATCCTTGGGCATTGCTGG + Intronic
997792837 5:136777738-136777760 TTGGAATCCTGGGGATTTTCAGG - Intergenic
998557349 5:143138371-143138393 AGGGAATGATGGGGAAATGCAGG + Intronic
1000102338 5:158028179-158028201 ATGGCCTCCTGGGAAAATGCTGG + Intergenic
1001353675 5:171000342-171000364 CTCGAATCCTTGTGCAATGCTGG - Intronic
1002334876 5:178470700-178470722 CAGGAATACTGGGGAAATTTCGG - Intronic
1002453495 5:179332607-179332629 CTGGGCTTCTGGGGCAATGCAGG - Intronic
1002788292 6:420321-420343 CTGGAATCCTTGTGCATTGCTGG - Intergenic
1003333176 6:5146501-5146523 CTGGAATGCTTGTGAAACGCAGG + Intronic
1003652720 6:7976126-7976148 TAGGATTCTTGGGGAAATGCAGG + Intronic
1004373044 6:15068955-15068977 CTGAAAACCTCAGGAAATGCTGG + Intergenic
1005216381 6:23533111-23533133 CTGGAGTCCTGGTCAAATGCAGG + Intergenic
1006175231 6:32117397-32117419 CAGCAAGCCTGGGGAAATGGAGG + Exonic
1006278300 6:33023826-33023848 CTGGAATCCTGGTGCACTGTTGG - Intergenic
1006298350 6:33179914-33179936 CTGGAAGCCATGGGAAATGCTGG - Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1011270837 6:85578444-85578466 GGGGTATCCTGGGGAACTGCTGG + Intronic
1011401447 6:86966473-86966495 CTGGAATCTTGGGCAATTGTGGG + Intronic
1012665614 6:101964685-101964707 CTGGCATCCCAGGGAAATTCTGG + Intronic
1014827729 6:126065483-126065505 CTTTAATTCTGGGGAACTGCTGG + Intergenic
1015449067 6:133343121-133343143 CAGATATCCTGGGGAAATGGAGG + Intronic
1015701993 6:136046627-136046649 CTGATACCCTGGGGAATTGCAGG - Intronic
1016447058 6:144144921-144144943 CTGGAACCCTTGGGCATTGCAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017009757 6:150055307-150055329 CTGGAAACCTGGGGAGGAGCCGG - Intergenic
1017143107 6:151209686-151209708 CTGGGCTCCTTGGGAAATGGAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018212367 6:161494867-161494889 CTAGAAGACTGGGGAAAGGCTGG - Intronic
1019135261 6:169903882-169903904 CTGGAATCCTGGTGAACAGCTGG - Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1022154693 7:27647775-27647797 CTAGAATTCTGGGAAAAAGCAGG + Intronic
1025142622 7:56478639-56478661 CTGGCTTCCTGGGGAATTGCTGG - Intergenic
1025233801 7:57220166-57220188 CTGGAGACCTGGGGAGAGGCTGG + Intergenic
1025610779 7:63073935-63073957 CTGACTTCCTGGGGAATTGCTGG + Intergenic
1025708682 7:63889240-63889262 CTGGCTTCCTGGGGAATTGCTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025848837 7:65225650-65225672 CTGGAAACTTGGGGAAAGGGCGG - Intergenic
1027138872 7:75642817-75642839 CTCCCATCCTAGGGAAATGCAGG - Intronic
1027248296 7:76382002-76382024 CTGGAACCCTGGTGCACTGCTGG + Intergenic
1028048492 7:86152902-86152924 TTGGAATTCTGGGTTAATGCTGG + Intergenic
1028506883 7:91580561-91580583 CTGGAAGCCTGGGAAGAAGCTGG + Intergenic
1031400699 7:121323462-121323484 AAGGATTGCTGGGGAAATGCTGG + Intergenic
1031838563 7:126708800-126708822 CTGGAATACTTGGGAAACGAAGG + Intronic
1032170151 7:129577858-129577880 CTAGAACCCTGGGAGAATGCTGG + Intergenic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1033623536 7:143085366-143085388 CTAGTAGACTGGGGAAATGCTGG + Intergenic
1034550432 7:151817102-151817124 CTGGAAGCGAGGAGAAATGCAGG - Intronic
1035546500 8:485696-485718 CTGGAAGCCTGGGGTCCTGCTGG - Intergenic
1035945044 8:3953659-3953681 CTGGGAGCCTGGGGAAGTGATGG + Intronic
1037585569 8:20273690-20273712 ATGGAATCTCAGGGAAATGCTGG - Intronic
1037623409 8:20586955-20586977 CTAGAATGCTGGGGTAATGTTGG + Intergenic
1039236098 8:35504206-35504228 CTGGATACCTGGGTAAATCCTGG + Intronic
1040908759 8:52496299-52496321 CTGAAAGGCTGGGGAAATTCTGG - Intergenic
1041266859 8:56074239-56074261 CTGAAATGGTGGGGAAACGCGGG - Intronic
1041735864 8:61109860-61109882 GTGGAGTCCTGGGGCAGTGCAGG - Intronic
1042960255 8:74295716-74295738 CTAGTATCCTGAGGAAAAGCAGG + Intronic
1043408171 8:79961226-79961248 TTGGAATTCAGGAGAAATGCAGG + Intronic
1044695473 8:94918305-94918327 CTGGAAACCCTGGGAAGTGCAGG - Intronic
1044918222 8:97138412-97138434 ATGGCATCCTGGGGCAATGGAGG + Intronic
1046573115 8:115991626-115991648 CTGGCTTCCTGAGGGAATGCAGG + Intergenic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1051823566 9:21194113-21194135 CTGCAAACGTGGGGAAATACAGG + Intergenic
1051918501 9:22235944-22235966 CTGTCCTCCTGGGGAGATGCAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057212780 9:93209794-93209816 CTGGGATCCTGGGGGAAGGGCGG - Intronic
1059755357 9:117288542-117288564 TTTTAATCCTGGGGAAATCCTGG + Intronic
1059880250 9:118680349-118680371 CTGGAATAGTGAGGAAAAGCAGG + Intergenic
1060532706 9:124357485-124357507 CGGTAGTTCTGGGGAAATGCTGG + Intronic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061386862 9:130295586-130295608 GTGGATTCCTGGAGACATGCGGG + Intronic
1061854758 9:133435896-133435918 CTGGAACCCTGGCGCAATGCTGG - Intronic
1062486247 9:136777782-136777804 CTGGAGACCTGGGGAGAGGCTGG - Intergenic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1062514270 9:136924613-136924635 CTGGAGTCCTGGGCTAAAGCTGG - Intronic
1185508014 X:643631-643653 CTGGTGTCCTGGGGAGAGGCTGG + Intronic
1185508061 X:643769-643791 CTGGTGTCCTGGGGAGAGGCTGG + Intronic
1185646047 X:1616506-1616528 CTGGAACCCGGCGGAAGTGCTGG + Intronic
1186385318 X:9105058-9105080 ATGGAATCGTGGGTCAATGCTGG + Intronic
1187118606 X:16380972-16380994 CTGGCTTCCAGGGGAATTGCTGG + Intergenic
1187548814 X:20280808-20280830 CTAGAATCCTGGAGAGATGAGGG + Intergenic
1187982254 X:24770204-24770226 ATTGAATCCTGGGGATATGAAGG + Intronic
1189779834 X:44503651-44503673 CTAGAACCATGGTGAAATGCAGG + Intergenic
1189944771 X:46166913-46166935 CTTTAATGCTGGAGAAATGCTGG - Intergenic
1190260015 X:48791713-48791735 CTGGTAGCCTGTGGAAAAGCTGG + Intronic
1194560912 X:95418781-95418803 CTGGAATTATGCTGAAATGCTGG - Intergenic
1194668871 X:96706234-96706256 CTGGACCCCAGGTGAAATGCAGG - Intronic
1195383904 X:104295848-104295870 CAAGAATGCTGGGGAAAGGCAGG + Intergenic
1199603766 X:149560202-149560224 TTGGAATCTTTTGGAAATGCGGG + Intergenic
1199646623 X:149919272-149919294 TTGGAATCTTTTGGAAATGCGGG - Intergenic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic