ID: 900544026

View in Genome Browser
Species Human (GRCh38)
Location 1:3218514-3218536
Sequence CCGCCCGCACAGGTGGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900544018_900544026 20 Left 900544018 1:3218471-3218493 CCCACTCCAAGGCACACATACGC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG 0: 1
1: 0
2: 1
3: 5
4: 84
900544017_900544026 23 Left 900544017 1:3218468-3218490 CCACCCACTCCAAGGCACACATA 0: 1
1: 0
2: 0
3: 37
4: 322
Right 900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG 0: 1
1: 0
2: 1
3: 5
4: 84
900544016_900544026 24 Left 900544016 1:3218467-3218489 CCCACCCACTCCAAGGCACACAT 0: 1
1: 0
2: 1
3: 18
4: 295
Right 900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG 0: 1
1: 0
2: 1
3: 5
4: 84
900544020_900544026 14 Left 900544020 1:3218477-3218499 CCAAGGCACACATACGCACACGT 0: 1
1: 0
2: 1
3: 33
4: 299
Right 900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG 0: 1
1: 0
2: 1
3: 5
4: 84
900544019_900544026 19 Left 900544019 1:3218472-3218494 CCACTCCAAGGCACACATACGCA 0: 1
1: 0
2: 1
3: 13
4: 233
Right 900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900544026 Original CRISPR CCGCCCGCACAGGTGGGCAT CGG Intronic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
902691004 1:18110080-18110102 CAGCCCGCAGAGGCGGGCAAAGG - Intronic
903789202 1:25881196-25881218 CCGCACACACAGGTGGCCACAGG + Intergenic
904033596 1:27547775-27547797 CCGGCAGCTCAGGTGGGCCTGGG + Exonic
905216307 1:36410582-36410604 CCTGCAGCACAGGTGGGCATGGG + Intergenic
906507986 1:46394228-46394250 CCTCCCGCGCAGGCGGGCGTGGG + Intergenic
907304253 1:53505048-53505070 CAGCCCCCACAGGTGGGCCCTGG + Intergenic
908196172 1:61747790-61747812 CCACTCTCACACGTGGGCATGGG + Intronic
913564949 1:120063901-120063923 CTCCCTGCACAGGTGGGCACTGG - Intronic
913633181 1:120729654-120729676 CTCCCTGCACAGGTGGGCACTGG + Intergenic
914285536 1:146223259-146223281 CTCCCTGCACAGGTGGGCACTGG - Intronic
914546567 1:148674012-148674034 CTCCCTGCACAGGTGGGCACTGG - Intronic
914619998 1:149396656-149396678 CTCCCTGCACAGGTGGGCACTGG + Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
1073424345 10:103447211-103447233 CCGCCTGCACAAGTGGGCCCAGG - Exonic
1083258243 11:61509521-61509543 CCGCCCGCGCTGCTGCGCATGGG + Exonic
1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG + Intergenic
1084237889 11:67799893-67799915 CCGCCCTCACAGTTGTGCCTGGG - Intergenic
1089662373 11:119993922-119993944 CTGCCCCCACAGGGGGGCAGTGG - Intergenic
1090471905 11:126988546-126988568 TCGAGGGCACAGGTGGGCATAGG + Intronic
1091994418 12:4982053-4982075 CAGCTCCCTCAGGTGGGCATGGG - Intergenic
1094703726 12:32895811-32895833 ACGCCCGCACTGGTGGGGGTAGG + Intronic
1096116748 12:49059706-49059728 CCCCCCGCACGGGGGGGCTTAGG + Intronic
1097158360 12:57028676-57028698 CCTCCCACACAGGAGGGCAGAGG + Exonic
1107145803 13:37059548-37059570 CGACCCGCACAGGTGGGCGGTGG - Exonic
1107808769 13:44179325-44179347 CCCCTGGCAGAGGTGGGCATTGG - Intergenic
1113848539 13:113405308-113405330 CCTCCCGCGGAGGTGGACATGGG - Intergenic
1113906544 13:113821966-113821988 CCGCCAGCAAAGGTGAGCACGGG + Exonic
1121547620 14:94773277-94773299 CCGCACGCACAGCTCAGCATGGG + Intergenic
1123707287 15:22959532-22959554 CCGCCTGCTCAGGAGGCCATGGG + Intronic
1124347078 15:28930147-28930169 CCGCCAGTATAGGTGGGAATGGG + Intronic
1127797860 15:62453997-62454019 ACTCCCGCACAGGTGGCCAGGGG - Intronic
1128155024 15:65386540-65386562 CAGCCCCCACAGGTGAGCAGGGG - Exonic
1130098243 15:80872027-80872049 CCTCCCACACAGGTGTGCTTGGG - Intronic
1130650935 15:85761718-85761740 CCTCTCGCACAGGCGGGCACAGG + Intronic
1131540463 15:93271012-93271034 CTCCCAGCACAGGTGGGCACTGG - Intergenic
1138625768 16:58250153-58250175 CCGCCCGGAGAGGAGGGCCTAGG - Intronic
1138650341 16:58457033-58457055 CCACCCACAGAGCTGGGCATGGG - Intergenic
1140477610 16:75246824-75246846 CCTCCCGCACTGCTGGGCCTAGG + Intronic
1146912582 17:36658102-36658124 CCGCCCTCCCAGGCGGGCCTCGG - Intergenic
1147845719 17:43402721-43402743 CCGCCCCCAGGGCTGGGCATGGG - Intergenic
1150323550 17:64237128-64237150 CCCCCTGAACAAGTGGGCATTGG + Intronic
1152154234 17:78622533-78622555 CGGCCCTGACAGCTGGGCATGGG - Intergenic
1152546045 17:81000531-81000553 CACCCCGCACCGGTGGGCATGGG + Intronic
1158478717 18:57802831-57802853 GAGCCCGCACAGGTGGGATTTGG - Intronic
1160881898 19:1324825-1324847 CCCCCCGCACACGCGGGCACAGG - Intergenic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG + Exonic
1166733439 19:45071196-45071218 CTGCCCGCAGATGTGGACATAGG + Intergenic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
935056236 2:99570070-99570092 CAGCCCTCAGAGGGGGGCATGGG - Intronic
937221332 2:120344643-120344665 CCGGCCGCCCAGCTGGGCAAGGG + Intergenic
938073505 2:128320170-128320192 CCGCCCGCTCAGCTGGGTTTGGG - Intergenic
947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG + Intergenic
1169080368 20:2794629-2794651 CTTCCCACACAGGTGCGCATGGG - Exonic
1171891922 20:30724856-30724878 CCGCCAGCTCAGGCCGGCATCGG - Intergenic
1173609211 20:44354507-44354529 CAGCCCCTACAGATGGGCATGGG - Intergenic
1178948070 21:36964681-36964703 CGGCCTGCACAGGTAGGCAAGGG + Intronic
1181630599 22:24149187-24149209 CCGGGCTCACAGGTGGGTATAGG - Intronic
1182585738 22:31343473-31343495 CCGCCTGAGCAGGTGGGCAGGGG + Intronic
1183743176 22:39679434-39679456 TCGCCTGCCCAGGTGGGCAGGGG + Exonic
957646756 3:82939915-82939937 CCGCCCGCCCAGGTGGGCAGTGG + Intergenic
966901817 3:184492206-184492228 GCGCCTGGACAGGTTGGCATTGG + Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
977577168 4:98687444-98687466 CCGCTAGCACAGGTGGGTGTGGG - Intergenic
1002181988 5:177435426-177435448 CCTCCCTCACAGATGGGCACAGG - Intronic
1002186925 5:177458887-177458909 CCGCCCTCTCAAGTGGGAATCGG - Intronic
1002718338 5:181242995-181243017 CGGCCCTCAGAGGTAGGCATAGG - Intronic
1004204041 6:13574821-13574843 CCACCCGAGCAGGTGGGCATGGG + Intronic
1005112201 6:22294509-22294531 CCGCCGGGACAGATGGGCAAGGG + Exonic
1012997984 6:105992647-105992669 CCGCGCGCAGAGCTGGGCCTGGG + Intergenic
1013836703 6:114342821-114342843 GCGCCCGCACAGCTTGGCACCGG - Exonic
1016690709 6:146934550-146934572 CCCCCCACACAGCTGGTCATGGG - Intergenic
1018811570 6:167301878-167301900 ACGCCTGCACAGGAGGCCATAGG - Intronic
1020248276 7:6447579-6447601 CTGCCCGAAGAGGTGGGCAGTGG - Intronic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035548690 8:503383-503405 ACGCGTGCAGAGGTGGGCATTGG - Intronic
1035616877 8:1008793-1008815 GCGCCCCCACTGGTGTGCATGGG + Intergenic
1035731142 8:1854218-1854240 CCGCCCTCTGAGGTGAGCATGGG - Intronic
1043969675 8:86515002-86515024 CCCCCCGCTCAACTGGGCATTGG - Intronic
1047760016 8:127947546-127947568 CTCCCCTCCCAGGTGGGCATAGG + Intergenic
1056464317 9:86838938-86838960 CCGCACGCACACGTAGGCACAGG - Intergenic
1057216006 9:93229152-93229174 CCTCCTGCACAGGAGGGCCTGGG + Intronic
1060411422 9:123402942-123402964 CCTCCGGCACAGGTGGGCAAAGG + Intronic
1203785004 EBV:122695-122717 GAGGCCGCACATGTGGGCATTGG + Intergenic
1189260333 X:39674090-39674112 CCTCCTGCCCAGGTGGGCAAGGG - Intergenic
1190051010 X:47148544-47148566 CTGCCCACAGAGGTGGGAATTGG - Intronic
1192169362 X:68844697-68844719 CCTCCCGTACAGCTGGACATTGG + Intergenic
1193372108 X:80711284-80711306 CCTTCTGCAGAGGTGGGCATGGG + Intronic
1195115639 X:101695787-101695809 GCTCCCTCATAGGTGGGCATCGG - Intergenic
1195573337 X:106421320-106421342 CAGCCCTCACAGGTGGGTTTGGG - Intergenic