ID: 900544666

View in Genome Browser
Species Human (GRCh38)
Location 1:3222036-3222058
Sequence CGGGGCCTGCAGACCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 224}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900544666_900544676 11 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544676 1:3222070-3222092 AGTGAGGTGAGGGAGGCCCAAGG 0: 1
1: 0
2: 3
3: 54
4: 466
900544666_900544682 22 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544682 1:3222081-3222103 GGAGGCCCAAGGGGAAGGAGGGG 0: 1
1: 1
2: 10
3: 130
4: 992
900544666_900544670 -5 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544670 1:3222054-3222076 CCCCGTGCTGGCAGGAAGTGAGG 0: 1
1: 0
2: 0
3: 20
4: 359
900544666_900544677 12 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544677 1:3222071-3222093 GTGAGGTGAGGGAGGCCCAAGGG 0: 1
1: 0
2: 0
3: 31
4: 307
900544666_900544673 0 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544673 1:3222059-3222081 TGCTGGCAGGAAGTGAGGTGAGG 0: 1
1: 0
2: 1
3: 49
4: 530
900544666_900544680 20 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544680 1:3222079-3222101 AGGGAGGCCCAAGGGGAAGGAGG 0: 1
1: 0
2: 6
3: 111
4: 881
900544666_900544681 21 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544681 1:3222080-3222102 GGGAGGCCCAAGGGGAAGGAGGG 0: 1
1: 0
2: 11
3: 235
4: 1932
900544666_900544675 4 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544675 1:3222063-3222085 GGCAGGAAGTGAGGTGAGGGAGG 0: 1
1: 2
2: 18
3: 179
4: 1414
900544666_900544679 17 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544679 1:3222076-3222098 GTGAGGGAGGCCCAAGGGGAAGG 0: 1
1: 0
2: 4
3: 75
4: 753
900544666_900544674 1 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544674 1:3222060-3222082 GCTGGCAGGAAGTGAGGTGAGGG 0: 1
1: 1
2: 9
3: 45
4: 469
900544666_900544678 13 Left 900544666 1:3222036-3222058 CCAGCAGAGGTCTGCAGGCCCCG 0: 1
1: 0
2: 0
3: 28
4: 224
Right 900544678 1:3222072-3222094 TGAGGTGAGGGAGGCCCAAGGGG 0: 1
1: 0
2: 1
3: 41
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900544666 Original CRISPR CGGGGCCTGCAGACCTCTGC TGG (reversed) Intronic
900138566 1:1129098-1129120 TGGGGCCTGCAGGGCTGTGCTGG + Intergenic
900208037 1:1439869-1439891 CCGGGCCTGCACCCGTCTGCCGG - Exonic
900376802 1:2358682-2358704 CGGGTCCTGCAGATCTCAGCGGG - Exonic
900544666 1:3222036-3222058 CGGGGCCTGCAGACCTCTGCTGG - Intronic
900614218 1:3557357-3557379 AGCAGCCTGCAGAGCTCTGCGGG - Intronic
900640284 1:3685134-3685156 AGGGGCCTTCTGCCCTCTGCAGG - Intronic
900697355 1:4020616-4020638 TGGGGCCAGCAGACATCAGCTGG + Intergenic
900953570 1:5873325-5873347 CGGTTCCTGCAGGCCTCTCCTGG - Exonic
901767435 1:11512098-11512120 CTGGGCCTTCAGGCCTCTGATGG + Intronic
902687100 1:18085295-18085317 CAGGGGCTGCAGTCATCTGCAGG + Intergenic
903545984 1:24123763-24123785 GGGGGCCTGCAGTGCGCTGCGGG - Intronic
904371147 1:30048236-30048258 TGGCCCCTCCAGACCTCTGCAGG + Intergenic
904379674 1:30102231-30102253 TGGGGCCGGCAGCCCTCAGCAGG - Intergenic
907890893 1:58635701-58635723 CTGGGCCTCCAGACCTGTGATGG - Intergenic
910640422 1:89455112-89455134 AGGGGCCTGCAGACCTGGGCAGG - Intergenic
910730547 1:90391409-90391431 TGTGGCCTGCAGACATCTTCAGG + Intergenic
910876714 1:91885554-91885576 CGGGTCCTTCTGACCCCTGCGGG - Intronic
916722099 1:167492282-167492304 CTGAGCCTGCTGACCTCTTCCGG - Intronic
917396672 1:174601245-174601267 CGGGGCCTCCAGGCCTGTGATGG + Intronic
918118531 1:181517348-181517370 TGGCCCCTGCTGACCTCTGCAGG - Intronic
919233531 1:194807358-194807380 CTGGGCCTCCAGGCCTCTGATGG - Intergenic
919923002 1:202177418-202177440 CAGGGCCTGCTGACCCCTGCAGG - Intergenic
921032702 1:211347623-211347645 TGGGGCATTCAGTCCTCTGCTGG + Intronic
922554697 1:226523826-226523848 GGGAGCCGCCAGACCTCTGCTGG + Intergenic
1063557933 10:7098056-7098078 TGGGGCCTGCAGACCTTGCCTGG + Intergenic
1065756947 10:28939547-28939569 CGGGGCCTTCAGACTCCAGCTGG - Intergenic
1066129843 10:32382098-32382120 TGTGGCCTACAAACCTCTGCAGG - Intergenic
1067847722 10:49736872-49736894 GGGGGACTGCAGTGCTCTGCAGG - Intronic
1069540976 10:69293653-69293675 AGCTGCCTGCAGACCTCTGAGGG - Intronic
1069930954 10:71881209-71881231 CGGGCCATGCAGAGCTCAGCAGG + Intergenic
1071514660 10:86289290-86289312 AAGGGCCTGGAGACCACTGCTGG + Intronic
1071573148 10:86708899-86708921 TGGGGCCTGCCGATCCCTGCTGG - Intronic
1072608551 10:97002240-97002262 CAGGCACTGCAGGCCTCTGCAGG + Exonic
1074693206 10:116025609-116025631 CGGGGCATGCAGCCATATGCGGG + Intergenic
1076159698 10:128234243-128234265 CCCAGCCTGGAGACCTCTGCTGG - Intergenic
1076236140 10:128864938-128864960 AGAGGCCTGCAGAATTCTGCAGG + Intergenic
1076618186 10:131770739-131770761 CTGGGCCAGGAGCCCTCTGCTGG - Intergenic
1076722023 10:132396977-132396999 CGCGTCCGGCCGACCTCTGCGGG + Intergenic
1077232052 11:1462177-1462199 GTGGGCCTGCAGCCCTCTGAGGG - Intronic
1077360390 11:2138114-2138136 CGGGGCCTGCGGGGCTCGGCGGG - Intronic
1077540507 11:3144503-3144525 CGGGACCAGCTGACCTCTGCAGG + Intronic
1077631275 11:3812657-3812679 TGGGGCCTTCAGAACTCTGAGGG - Intronic
1079079071 11:17401468-17401490 AGGGGCCTGGATACCTCTCCAGG + Intronic
1081592996 11:44438035-44438057 AGGTGCCTGTTGACCTCTGCTGG - Intergenic
1083674349 11:64317201-64317223 CGGGGCGGGCACACCTCAGCCGG - Intronic
1083751210 11:64761671-64761693 GGGAGCCTGGAGACCTCTGTAGG - Intergenic
1085176695 11:74493900-74493922 CAGGGCCTGCAGAACACAGCAGG - Intronic
1089661518 11:119989161-119989183 AGGGGCCTTCAGACCTGCGCTGG - Intergenic
1090438409 11:126706086-126706108 CGGGGGCTGCAGTCATCTGAAGG - Intronic
1098123909 12:67270002-67270024 CGGGGCCTAGAGACCGCGGCGGG - Intronic
1099694320 12:85998283-85998305 CTGGGCCTCCAGACCTGTGATGG + Intronic
1101736431 12:107466621-107466643 GGGGGTCTGCAGACTTCGGCAGG + Intronic
1101753807 12:107605577-107605599 AGGGGCCTGCTGAGCTCTACAGG - Intronic
1103005961 12:117420507-117420529 GGAGGTTTGCAGACCTCTGCGGG - Intronic
1103407774 12:120687586-120687608 CGGGGCCCGCAGCCCCCGGCCGG - Intronic
1104014661 12:124953879-124953901 CGGGGCCAGCTGACCACCGCAGG - Exonic
1104725678 12:131074351-131074373 CAGGGGCTGCTGAGCTCTGCTGG - Intronic
1104861222 12:131925127-131925149 CGGGGCCAGCAGAGCTAGGCTGG - Intergenic
1105474952 13:20721264-20721286 CGGGGTCTGCAGAGCCTTGCCGG + Intronic
1108594111 13:51935743-51935765 CGGTGCCTGAAGCCCTCTCCTGG - Intronic
1110318501 13:74135293-74135315 CGGGATCTGCAGACCCCCGCGGG + Intergenic
1110955376 13:81546788-81546810 CTAGGCCTCCAGACCTCTGATGG + Intergenic
1113282092 13:108799680-108799702 CTGGGCCCACTGACCTCTGCAGG - Intronic
1113747210 13:112753476-112753498 CTGGGCCTGCCTACCGCTGCTGG + Intronic
1113968220 13:114166819-114166841 CAGGGGCTGCAGACCCATGCGGG - Intergenic
1117238039 14:53798886-53798908 AGGTGTCTGTAGACCTCTGCTGG - Intergenic
1118257759 14:64220183-64220205 CGGGGCCTGTAGAGGTCAGCAGG + Intronic
1118784952 14:69038181-69038203 CTGGGCCTGGAGAGCTCTCCTGG - Intergenic
1120104709 14:80480549-80480571 CTGGGCCTGCAGGCCTGTGATGG + Intronic
1121105996 14:91280072-91280094 CAGGGCCTGCACACCTCTCCTGG + Intronic
1121785932 14:96661048-96661070 AGGGGCCTGGAGGCCCCTGCAGG - Intergenic
1121916443 14:97840315-97840337 CTGGGCTGGCCGACCTCTGCTGG + Intergenic
1122323444 14:100868837-100868859 CTGGGCCTGGAAACCTCTGAGGG - Intergenic
1122838603 14:104443491-104443513 GGAGGCCTGCAGAGCCCTGCTGG - Intergenic
1123435284 15:20249722-20249744 CCTGGCCTGCACCCCTCTGCAGG + Intergenic
1124655343 15:31502776-31502798 GGAGACCTGCAGACCTCAGCAGG + Intronic
1128154648 15:65385003-65385025 CGGGCCCTGCTGCCCCCTGCTGG - Exonic
1128254417 15:66186315-66186337 CGGGGCAGACAGACCACTGCTGG - Intronic
1129174962 15:73833207-73833229 AGAGGCCTTCAGACATCTGCTGG + Intergenic
1129191004 15:73937585-73937607 CGGGGCCTGAGGCCCTGTGCCGG - Intronic
1129676253 15:77633607-77633629 AGAGGCCTGCCGCCCTCTGCTGG - Intronic
1132022032 15:98371100-98371122 AGGGGCCAGCAGACTGCTGCTGG - Intergenic
1132792523 16:1699834-1699856 TGAGGCCCGCTGACCTCTGCGGG + Exonic
1132988913 16:2783155-2783177 CTGGGCCTGCAGCCTTTTGCAGG + Intergenic
1133212947 16:4273182-4273204 CGGGGTCTGCAGGCCTCTCGCGG + Intergenic
1133736205 16:8617710-8617732 CGTGGCCTCCAGAACTGTGCGGG - Intergenic
1133801577 16:9090221-9090243 CGCGGCCTGCAAACCCCTGCAGG - Intergenic
1134443098 16:14310952-14310974 AGAGGCCTGCAGACAGCTGCCGG + Intergenic
1135401760 16:22170963-22170985 CGGGTCCTGCCCACCTCTCCCGG - Intronic
1139914652 16:70420561-70420583 AAGGGCCTGCAGACGTCTGCTGG + Intronic
1139914653 16:70420566-70420588 CAAGGCCAGCAGACGTCTGCAGG - Intronic
1141666288 16:85467135-85467157 GCGAGCATGCAGACCTCTGCTGG + Intergenic
1142130517 16:88429759-88429781 GGGGGCCTGGAGACCGCTGGTGG - Exonic
1142469822 17:157107-157129 CGGGGGCTGCAGACCCGTGAAGG - Intronic
1142587170 17:980536-980558 CGGGGCCTCCAGACCAATGCTGG + Intergenic
1143474876 17:7196787-7196809 GGGGCCCTGCAGACCTCAGTGGG - Exonic
1144668636 17:17118848-17118870 CTGGGGCTGCAGACCTCCCCAGG - Intronic
1146288948 17:31594470-31594492 CTGGGCTTGCAGACCACTGTGGG + Intergenic
1146360991 17:32177783-32177805 TGGGGGCTGCAGCCATCTGCAGG - Intronic
1146742312 17:35297551-35297573 CTGGGCCTCCAGACCTGTGATGG - Intergenic
1149051454 17:52310062-52310084 CTGGGCCTCCAGACCTGTGATGG + Intergenic
1150790377 17:68197366-68197388 AGGGGCCAGAAGGCCTCTGCTGG - Intergenic
1152092849 17:78256646-78256668 CGGGGCCTGATGACCTCTCAGGG + Intergenic
1152587019 17:81193695-81193717 CAGAACCTGCAGACCTCGGCGGG + Intronic
1152616275 17:81339394-81339416 CGGGTCCTGGAGCTCTCTGCTGG + Intergenic
1152928043 17:83096835-83096857 GGGAGCCTGCAGACCTGTGCTGG - Intergenic
1153017436 18:596809-596831 CGGGGCCTGCAGACGCCGGGTGG - Intergenic
1153017455 18:596860-596882 CGGGGCCTGCAGACGCCGGGTGG - Intergenic
1153017474 18:596911-596933 CGGGGCCTGCAGACGCCGGGTGG - Intergenic
1153017493 18:596962-596984 CGGGGCCTGCAGACGCCGGGTGG - Intergenic
1154259717 18:12819973-12819995 AGGGGCCTGCAGTGCTCTGTGGG + Intronic
1157291605 18:46413454-46413476 CAGAGCCTGCAGAGCTCTGTAGG - Intronic
1160420389 18:78740013-78740035 CGAGGTCTGCAGACCTGGGCTGG - Intergenic
1160458796 18:79021814-79021836 CAGGGCCTGCAAACTGCTGCAGG + Intergenic
1160742891 19:695453-695475 CACGGCCCGAAGACCTCTGCGGG - Exonic
1160970967 19:1767608-1767630 CGGGGACGGCTGCCCTCTGCTGG + Intronic
1161572089 19:5036294-5036316 TCGGGCCTGCAGATCTCTGCTGG - Intronic
1161611253 19:5244193-5244215 CGGGGCCTGCTCGCCTGTGCGGG + Exonic
1162382442 19:10339560-10339582 CAGGGCCTGCTGGACTCTGCTGG - Exonic
1164077753 19:21835817-21835839 CCCGGCCTGCAGCCCTCTGTGGG - Intronic
1164937367 19:32224743-32224765 AGCGGCCTGCTGACCTCTGTCGG - Intergenic
1165031447 19:33000605-33000627 CCCGGCCTGCACCCCTCTGCGGG + Intronic
1165437830 19:35806401-35806423 CCGGGCCAGCTGGCCTCTGCAGG - Intronic
1167557169 19:50203681-50203703 CGGGGCCGGCAGCCCTCCGGGGG + Intronic
925613799 2:5726018-5726040 CAGGGCCCGCAGAGCTCTGCAGG - Intergenic
927150597 2:20193175-20193197 CTGGGCCTGTTCACCTCTGCAGG + Intergenic
929096095 2:38264490-38264512 CGTGGCCTGAGGAGCTCTGCAGG - Intergenic
929589055 2:43133493-43133515 CTGGGCCTGCAGGCATCTGTGGG - Intergenic
932707496 2:74038045-74038067 CTGGTCCTCCAGACATCTGCAGG - Intronic
934614565 2:95763146-95763168 AGGAGCCTGCAGACCTCTGTGGG + Intergenic
934646338 2:96061353-96061375 AGGAGACTGCAGACCTCTGTGGG - Intergenic
934736759 2:96693555-96693577 TGGGGCCTGCAGAGCTCCTCAGG - Intergenic
934839742 2:97617435-97617457 AGGAGCCTGCAGACCTCTGTGGG - Intergenic
935172994 2:100625159-100625181 GGAGGCCTGCAGAGATCTGCAGG + Intergenic
935172995 2:100625164-100625186 AGCAGCCTGCAGATCTCTGCAGG - Intergenic
936519403 2:113202185-113202207 TGGGGCCTCCAGAGCTTTGCAGG + Exonic
937062282 2:118989558-118989580 AGGGGCTGGCAGACCTCTTCAGG - Intronic
937265471 2:120612360-120612382 CGGGGCCTTCTGAGCCCTGCTGG - Intergenic
937346596 2:121129944-121129966 CGGGGCCTCCAGTCACCTGCTGG - Intergenic
938406765 2:131037125-131037147 CGGGGGCTGCAGACCTCCAGAGG - Intronic
940963687 2:159814161-159814183 CGGGGACTGCAGAGGCCTGCAGG - Intronic
942054241 2:172167810-172167832 CTGGGCCTCCAGACCTGTGATGG - Intergenic
942603974 2:177671176-177671198 CAGGGGCTACAGACCTATGCAGG - Intronic
945279773 2:208025421-208025443 CGGGGCCTTCAGTCCGCTCCTGG + Exonic
945979138 2:216295111-216295133 CGGGGCCTGCAGACCGAGGCTGG + Intronic
946414522 2:219533094-219533116 AGAGGTCTGCGGACCTCTGCAGG + Intronic
947098266 2:226591491-226591513 AGGTGGCTGGAGACCTCTGCTGG + Intergenic
1168798404 20:627693-627715 CTGGGCCTGCAGTCATCTGAAGG - Intergenic
1172098699 20:32473237-32473259 CGGTGCCTGCAGAGCCCAGCTGG - Intronic
1172274826 20:33673828-33673850 TGGGGCCTGAAGAACTCTGGGGG + Intronic
1174133925 20:48365731-48365753 CGGGAGCTGCTGACCTCTGACGG - Intergenic
1174411813 20:50341316-50341338 CTGGGCCTGCAGGCCTGGGCAGG - Intergenic
1176020108 20:62958493-62958515 TGGGGCCAGCAGGCCCCTGCAGG - Intronic
1176062605 20:63178901-63178923 CGGGCCCCGCCGCCCTCTGCGGG - Intergenic
1176522905 21:7838219-7838241 CGGGGCCTGCAAAGCAATGCTGG - Intergenic
1178656925 21:34468231-34468253 CGGGGCCTGCAAAGCAATGCTGG - Intergenic
1178916101 21:36706320-36706342 CAGGTCCTGCAGTGCTCTGCAGG + Intronic
1179600773 21:42476091-42476113 TGGAGCCTGCAGACCTGTGCAGG + Intronic
1179790014 21:43750672-43750694 CGGGGCCTCCAGAGATCAGCAGG + Intronic
1179809855 21:43864229-43864251 CGGGGCCTGAGGACCTGAGCAGG + Intergenic
1180070188 21:45432036-45432058 CAGGGCCTGCAGCCCACAGCAGG - Intronic
1180084364 21:45501356-45501378 CGTGGCCTGGAGACCTTCGCAGG - Intronic
1180592750 22:16955209-16955231 CAGGGCATTCAGACCTATGCAGG - Intergenic
1180961946 22:19766197-19766219 CGGGGCCCGCGCCCCTCTGCGGG - Intronic
1181852630 22:25761149-25761171 CTGGGGCTGCAGCCATCTGCAGG + Intronic
1183718405 22:39547944-39547966 GGGGACCCCCAGACCTCTGCAGG + Intergenic
1183733516 22:39631104-39631126 CGGGGCCAGGACACCTCTGACGG - Intronic
1184716156 22:46282903-46282925 CTGGGCCTGTTGATCTCTGCAGG + Intronic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
953406667 3:42663255-42663277 CAGGGGCTGCAGACCTCAGAGGG - Intronic
955380421 3:58433853-58433875 CGGGGCCTGCTCACGTCTGCCGG - Intronic
960949300 3:122988708-122988730 TGGGGCCTGGAAAGCTCTGCTGG + Intronic
961012731 3:123447356-123447378 CGGGGCGGGCAGGCCTCAGCTGG - Intronic
967101808 3:186221890-186221912 GGGGGCCGGCAGAGCTCAGCTGG - Intronic
967876388 3:194270971-194270993 GGCAGCCTGAAGACCTCTGCGGG - Intergenic
968688909 4:1979915-1979937 CGGGGCCTGCAGCGCCCTACGGG - Exonic
968729881 4:2264673-2264695 CAGGGGCTCCAGACCTCTCCTGG - Intergenic
969289535 4:6229878-6229900 TGTGGGCTGCACACCTCTGCAGG - Intergenic
969296496 4:6273228-6273250 TGGTGCCTGCAGCCCTCTCCAGG + Intronic
970202988 4:13627923-13627945 CAGGGACTCCAGACCCCTGCCGG - Intergenic
976748234 4:88427439-88427461 CCAGACCTGCAGACTTCTGCAGG + Intronic
978330876 4:107611675-107611697 CGGGGCCTCCAGGCCTGTGATGG - Intronic
979899454 4:126200008-126200030 CAGGGCATGCAGAGCTCTGTAGG - Intergenic
982263518 4:153517273-153517295 TGCCGCCTCCAGACCTCTGCTGG + Intronic
983923387 4:173371028-173371050 CCGGGCCTGCTGGTCTCTGCTGG - Exonic
991198671 5:63963187-63963209 CAGAGCCTGCAAACCTCTGGGGG + Intergenic
991652145 5:68865984-68866006 AGGTGTCTGTAGACCTCTGCTGG - Intergenic
992950326 5:81851802-81851824 CGCAGCCTGCAAGCCTCTGCCGG + Intergenic
992955286 5:81901792-81901814 CCCTGCCTGCAGCCCTCTGCAGG - Intergenic
993256065 5:85591500-85591522 CGGGGCCTCCAGGCCTCTGATGG + Intergenic
993309654 5:86313672-86313694 CGGGGCCTCCAGGCCTGTGATGG - Intergenic
997582700 5:135027600-135027622 CGGGGTAGGCAGACCTCGGCGGG + Intergenic
998383652 5:141743462-141743484 CGGGGCCAGCAGACACCTGCCGG - Intergenic
999091330 5:148938758-148938780 CGTGGCCTGAAGATCTCTGCAGG + Intronic
1002691640 5:181054099-181054121 CTGGGCCCGCAGACCACCGCGGG + Intronic
1004509597 6:16274558-16274580 CGGGGACTGCAGATCACTGGAGG + Intronic
1005996539 6:30934647-30934669 CTGGGCCTGCAGGCCTTGGCCGG + Intergenic
1006129907 6:31862872-31862894 CGGGGCCTCCAGACCGGGGCGGG - Exonic
1007327477 6:41073266-41073288 CGGCCCCTGCAGGCCTCGGCCGG - Intronic
1010171169 6:72977553-72977575 AGGGGCCGGAAGACCTATGCAGG + Intronic
1013142019 6:107346893-107346915 AGGAGCCTGCACACCTCTGCTGG - Intronic
1017045580 6:150344440-150344462 AAGGACATGCAGACCTCTGCTGG + Intergenic
1017817663 6:158027303-158027325 CGGATCCTTCAGACCTCAGCGGG + Intronic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1022976690 7:35565256-35565278 TGATGGCTGCAGACCTCTGCAGG - Intergenic
1025093723 7:56082238-56082260 GGGGTCCCGCAGACCTCTGCAGG + Exonic
1025216661 7:57061433-57061455 GGGGTTCTGCAGACCTCTGCAGG + Intergenic
1025627486 7:63234229-63234251 GGGGTTCTGCAGACCTCTGCAGG + Intergenic
1025654718 7:63509297-63509319 GGGGTTCTGCAGACCTCTGCAGG - Intergenic
1026159488 7:67856216-67856238 AGGGACCTTCAGACCCCTGCTGG + Intergenic
1029187960 7:98753095-98753117 CGGGGCCTACAGACAGGTGCTGG - Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1034166384 7:149028261-149028283 CGGGGGCTGCAGAGCTGTGCGGG - Intronic
1036599784 8:10249685-10249707 CATGGCCAGCAGACCTCTGTTGG + Intronic
1038494510 8:27992075-27992097 CTGGGCCCGCAGATATCTGCCGG - Intronic
1038840829 8:31183326-31183348 CAGGGCTTGCAGGCCTCTGTCGG - Intergenic
1039451909 8:37681879-37681901 AGGGCCCTGGAGACCTCTGCTGG + Intergenic
1039533953 8:38290648-38290670 CTGGGGTTGCAGATCTCTGCTGG + Exonic
1039665516 8:39522758-39522780 CTGGGCCGGCTGACCTCCGCGGG - Intergenic
1041495248 8:58478922-58478944 CGGAGGCTGCAGTCATCTGCAGG - Intergenic
1043870273 8:85424448-85424470 GGAGGCCTGCCTACCTCTGCAGG - Intronic
1048577787 8:135706512-135706534 TGGGGGGTGTAGACCTCTGCAGG + Intergenic
1049356281 8:142190118-142190140 CGGGGCCTGCAGGGCCCAGCCGG - Intergenic
1049685215 8:143936700-143936722 CGGGGCCTGCATTCCTCCACAGG + Intronic
1049724566 8:144139616-144139638 GGGGGCCTGCAGACAGCTGCAGG - Exonic
1049821096 8:144634101-144634123 CGGGAACTCCAGGCCTCTGCTGG + Intergenic
1052513467 9:29450914-29450936 GGAGGCCTGCTGGCCTCTGCAGG + Intergenic
1052880481 9:33598577-33598599 CGGGGGCTGCTGAGCACTGCTGG + Intergenic
1055834227 9:80419634-80419656 CAGGGCCTGTAGACCATTGCTGG + Intergenic
1055985732 9:82055665-82055687 CGGGGGCTGCTGAGCACTGCTGG + Intergenic
1056585607 9:87925454-87925476 CGGGGGCTGCTGAGCACTGCTGG - Intergenic
1056611272 9:88127490-88127512 CGGGGGCTGCTGAGCACTGCTGG + Intergenic
1057777321 9:98021548-98021570 CAGGGCCTGCAGAGCACTCCTGG + Intergenic
1057895111 9:98903099-98903121 CGGTGCCTGCTCACCTCTCCAGG + Intergenic
1058181678 9:101807561-101807583 CTGGGCCTGCAGGCCTGTGATGG - Intergenic
1058206460 9:102115024-102115046 CAGGGCATGCCTACCTCTGCAGG - Intergenic
1060594796 9:124841469-124841491 CTGGGCCCCCTGACCTCTGCAGG - Intergenic
1060740456 9:126094574-126094596 CTGGGCTTGGAGCCCTCTGCAGG - Intergenic
1061008815 9:127943432-127943454 TGGGGCCTGCAGAGCCCTTCCGG + Intronic
1061046505 9:128167998-128168020 GGGGGCCTGCAGTCCTAGGCAGG - Intronic
1062267130 9:135692321-135692343 AGGAGCCTTCAGACCTCTGGTGG - Intergenic
1186324035 X:8459212-8459234 CGGGGCCTCCAGGCCTGTGAAGG + Intergenic
1186426175 X:9465478-9465500 CGGGGTCCGCAAACTTCTGCGGG + Intronic
1187818222 X:23256296-23256318 CGGTGCCTGGAGACCCCTGTTGG - Intergenic
1187939235 X:24365015-24365037 CTGGGGCTGCAGACCACTTCTGG - Intergenic
1189115146 X:38334780-38334802 CTGGGGCTGCAGACCTCTACCGG + Intronic
1189293326 X:39901249-39901271 TGGGGTCTGCTGAACTCTGCTGG + Intergenic
1189986971 X:46562112-46562134 AGGGGCCTGAAGAACTCTTCTGG + Intergenic
1193503592 X:82310426-82310448 CTGGGCCTCCAGACCTGTGATGG + Intergenic
1197023135 X:121715887-121715909 AGGTGCCTGGAGACCCCTGCAGG + Intergenic
1199675642 X:150186981-150187003 CAGGTCCTGCAGAACTCTGGGGG + Intergenic
1200774639 Y:7159591-7159613 GGAGGCCTGCAGGCCTCTGTAGG - Intergenic
1201961867 Y:19689925-19689947 AGGGGTCTGTCGACCTCTGCTGG + Intergenic