ID: 900546440

View in Genome Browser
Species Human (GRCh38)
Location 1:3231825-3231847
Sequence GTGGAGAAGCTGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 413}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900546440_900546449 13 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546449 1:3231861-3231883 AGAGAGTAAAGCTGGACCCTGGG 0: 1
1: 1
2: 3
3: 15
4: 207
900546440_900546448 12 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546448 1:3231860-3231882 AAGAGAGTAAAGCTGGACCCTGG 0: 1
1: 0
2: 2
3: 28
4: 238
900546440_900546451 15 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546451 1:3231863-3231885 AGAGTAAAGCTGGACCCTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 192
900546440_900546452 16 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546452 1:3231864-3231886 GAGTAAAGCTGGACCCTGGGGGG 0: 1
1: 0
2: 6
3: 132
4: 3800
900546440_900546450 14 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546450 1:3231862-3231884 GAGAGTAAAGCTGGACCCTGGGG 0: 1
1: 0
2: 1
3: 26
4: 188
900546440_900546444 5 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546444 1:3231853-3231875 CCGCCCCAAGAGAGTAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 75
900546440_900546453 22 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546453 1:3231870-3231892 AGCTGGACCCTGGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 43
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900546440 Original CRISPR GTGGAGAAGCTGAACCAGGA AGG (reversed) Intronic