ID: 900546440

View in Genome Browser
Species Human (GRCh38)
Location 1:3231825-3231847
Sequence GTGGAGAAGCTGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 413}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900546440_900546444 5 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546444 1:3231853-3231875 CCGCCCCAAGAGAGTAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 75
900546440_900546450 14 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546450 1:3231862-3231884 GAGAGTAAAGCTGGACCCTGGGG 0: 1
1: 0
2: 1
3: 26
4: 188
900546440_900546448 12 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546448 1:3231860-3231882 AAGAGAGTAAAGCTGGACCCTGG 0: 1
1: 0
2: 2
3: 28
4: 238
900546440_900546452 16 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546452 1:3231864-3231886 GAGTAAAGCTGGACCCTGGGGGG 0: 1
1: 0
2: 6
3: 132
4: 3800
900546440_900546449 13 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546449 1:3231861-3231883 AGAGAGTAAAGCTGGACCCTGGG 0: 1
1: 1
2: 3
3: 15
4: 207
900546440_900546453 22 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546453 1:3231870-3231892 AGCTGGACCCTGGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 43
4: 580
900546440_900546451 15 Left 900546440 1:3231825-3231847 CCTTCCTGGTTCAGCTTCTCCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 900546451 1:3231863-3231885 AGAGTAAAGCTGGACCCTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900546440 Original CRISPR GTGGAGAAGCTGAACCAGGA AGG (reversed) Intronic
900169263 1:1258414-1258436 GTGGAGGAGCTAGACCAGGGTGG - Intronic
900477404 1:2882416-2882438 ATGGAGAAGCTGGACCATGCAGG - Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900643390 1:3697876-3697898 GTGGAGAAGGCGGTCCAGGACGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900828490 1:4946080-4946102 GTGGAGGAACTGAACAAGCAAGG + Intergenic
902105516 1:14032671-14032693 TTGGAAGAGCTGAGCCAGGATGG - Intergenic
902955915 1:19924007-19924029 GTGGAAACTCTGAAACAGGACGG - Intergenic
904432140 1:30471206-30471228 GTGGAGAGGATGAGCCAGAAAGG - Intergenic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906193287 1:43912913-43912935 GAGGAGAAGCTGGACCATGCCGG + Intronic
906251627 1:44315031-44315053 GGAGAGAAGCTGGACCAGAATGG - Intronic
912215595 1:107607536-107607558 GTGGAAAAGGTGAACCATGTAGG - Intronic
912261754 1:108117933-108117955 TTGGAGAAACTGGACTAGGAAGG + Intergenic
915089625 1:153415529-153415551 GTGGAAAGCCTGAACCAGGTAGG - Intergenic
915095877 1:153461599-153461621 GTGGAAAGGCTGACCCAGGTAGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
917707111 1:177645815-177645837 GAAGAGAAACTGAAACAGGAAGG + Intergenic
917853772 1:179085795-179085817 GTGGAGAACCTGTATCGGGACGG + Exonic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921538643 1:216384843-216384865 GTGAAGAAACTGAACCTAGAAGG + Intronic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
923089511 1:230729126-230729148 GTGGAGAAACTGCACCAGGCAGG - Intergenic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924599676 1:245477609-245477631 GTGGGGGAGCTGAACCAAGCAGG + Intronic
1063295675 10:4803247-4803269 GTGGAGGAGGAGCACCAGGAAGG + Intronic
1063494499 10:6494406-6494428 ATGAAGAAGGTGAACCATGAAGG - Intronic
1064292319 10:14047244-14047266 GTGGAAAAGAAGAACCAAGAAGG + Intronic
1064388603 10:14921738-14921760 GAGGAGAAGCTGGGCCAAGATGG - Intronic
1064535043 10:16349818-16349840 GAGGCGAAGTAGAACCAGGAAGG + Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1066095242 10:32066129-32066151 CTCGAGAAGTTGAACCAGGGAGG - Intergenic
1067217604 10:44316029-44316051 GTGGCCATGCTGAAGCAGGAAGG + Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1070625419 10:78047632-78047654 GTAGGGAAGCTGAACCTGGAGGG + Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072698428 10:97621652-97621674 GTGGATCACCTGAACCAGAATGG + Intronic
1073064773 10:100751460-100751482 GTAGAGGAGCTGGACAAGGAGGG + Intronic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1073477349 10:103762959-103762981 CTGGAGAAGCTGACCCAGACAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1075725137 10:124607121-124607143 GCGGAGAGGGTGAAGCAGGAGGG - Intronic
1076813072 10:132899167-132899189 CTGGAGCTGCTGGACCAGGAGGG + Intronic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1077890195 11:6412941-6412963 GCGGAGAAACTGACCCACGAAGG - Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1080044322 11:27792911-27792933 GGAGAGAAGCTGAACAGGGAAGG + Intergenic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080902588 11:36510059-36510081 GCGGGGAGGCCGAACCAGGAGGG + Exonic
1081506621 11:43723747-43723769 GTGGTGTAGCTGAACCAGACAGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1083728268 11:64639781-64639803 GTGGAGAAGCTGGTGCAGAAAGG + Intronic
1083882496 11:65555445-65555467 GTGGAGACACTGAGCTAGGAAGG - Intronic
1084174151 11:67415107-67415129 GTGGAGACCCTGGCCCAGGAGGG + Intronic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1086427813 11:86704093-86704115 GTGGAGAAGATGATCCAAGTGGG - Intergenic
1086994083 11:93336686-93336708 CTGGAGAAGCTAAAACAGAAAGG - Intronic
1088483962 11:110323476-110323498 CTGGAGAAGTTGAACCAGAGAGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1088902267 11:114127214-114127236 TGAGAGAAGCTGCACCAGGAGGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090827714 11:130399568-130399590 GTAGAGAAGCTGGGCCATGAGGG + Intergenic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1091651423 12:2313153-2313175 GTGGAGAAGCCCAAGCTGGATGG - Intronic
1092211009 12:6646594-6646616 GTGGAGAAGATGAACCCGTGGGG + Intronic
1093367371 12:18320526-18320548 GTGGTGAAGCTGAAAAATGAAGG + Intronic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094476621 12:30845532-30845554 GTGGATAAGCTGAAGCTGCATGG + Intergenic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1101001565 12:100362696-100362718 TTGGAGAAGCTGTACCTGGATGG - Intronic
1101671126 12:106874491-106874513 GTGAAGGACCTGCACCAGGATGG + Intronic
1101720425 12:107345994-107346016 GTGAGGAAGCAGACCCAGGAAGG + Intronic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1102670486 12:114614838-114614860 TTGGAGATGCTGAGCCAGGCTGG - Intergenic
1103975291 12:124698642-124698664 GTGGAGTAGCTGCTCCTGGAAGG - Intergenic
1104953663 12:132453647-132453669 CTGGAGAGGCTGGCCCAGGAAGG - Intergenic
1105554748 13:21436017-21436039 GTGTGCAAGCTGCACCAGGAAGG + Intronic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1107402670 13:40084661-40084683 TTGGAGTGGCTGAATCAGGATGG - Intergenic
1108008067 13:45972832-45972854 GGGCAGAAGCTGAAGCAGCAAGG - Intronic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1111355128 13:87089572-87089594 GAGGAGATGTTGAAACAGGATGG - Intergenic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1113545114 13:111142763-111142785 GAGGAGATGGTGAAGCAGGAGGG - Intronic
1113746834 13:112751043-112751065 GTGGAGGAGCTGAACCTTGGCGG + Intronic
1114306892 14:21431486-21431508 TTGGATCAGATGAACCAGGATGG - Exonic
1114546869 14:23509407-23509429 GAAGAGAAAGTGAACCAGGATGG + Intronic
1117366964 14:55038661-55038683 TTGGAGAAACTGAACTAGGTGGG - Intronic
1117836923 14:59817375-59817397 TTGAAGAAGCTGATCCAGGTTGG - Intronic
1118066013 14:62190737-62190759 GCTGAGAAGCTGAACTGGGAAGG - Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119657452 14:76427269-76427291 GTCAATAAGCTGAGCCAGGAAGG + Intronic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1120848454 14:89147220-89147242 GTGGAGAAGTTGAACACAGAGGG + Intronic
1120851896 14:89179340-89179362 GTGGAGAAGCTGCACGCGGCAGG + Intronic
1121332353 14:93057692-93057714 GAGGAGAGGCAGAACCAGCAGGG + Intronic
1121370702 14:93355687-93355709 GAGATGAAGCTGAACCTGGATGG - Intronic
1121487622 14:94330870-94330892 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121487630 14:94330924-94330946 GCACAGAAGCTGAGCCAGGAGGG + Intergenic
1121586716 14:95067879-95067901 GGGCAGAAGCTCACCCAGGAGGG - Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122893528 14:104744033-104744055 GTGCCGAAGATGGACCAGGAAGG + Intronic
1125528360 15:40394053-40394075 GTACAGAAGCCCAACCAGGATGG - Exonic
1126410122 15:48364834-48364856 CTGGAGAGGCTGAACCAGCAGGG - Intergenic
1126836523 15:52672092-52672114 TTTGAGAGGCTGAGCCAGGAGGG + Intronic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127294567 15:57598064-57598086 GTGGAGAAGATGATTCAGGGAGG - Intronic
1128075739 15:64824247-64824269 GTGGAGGAGCTGAGCCCGGGCGG - Exonic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128654432 15:69450181-69450203 TTTGAGAGGCTGAAACAGGATGG + Intergenic
1128935568 15:71743355-71743377 GTGGAAAAGCTAAACCCGCATGG + Intronic
1130018449 15:80205705-80205727 GTGGAAAAGTTGGACTAGGAAGG - Intergenic
1130298606 15:82664068-82664090 GTGGGGAGCCTGAGCCAGGAGGG + Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131233775 15:90679195-90679217 TTGGGGCAGCTGAACAAGGAAGG - Intergenic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1134027206 16:10963584-10963606 GTGGAGGGACTGAAGCAGGAGGG - Intronic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1137741058 16:50774645-50774667 GTGGAGATGCTGGACGGGGATGG + Intronic
1139041233 16:63001424-63001446 GGGGAGAAGCTGAAACAGTTTGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139466892 16:67159040-67159062 ATGGGGAAGGTGAACCAGGCTGG + Intronic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1141244569 16:82293982-82294004 GTGGAGAACCGGGACCAGAAAGG - Intergenic
1141455211 16:84136672-84136694 GTTGAGAAGCTGGGCCATGATGG - Intronic
1142150385 16:88510036-88510058 GCTGAGAAGCTGCACCAGGTGGG - Intronic
1142717365 17:1754562-1754584 GTGGAGAGGCTGGTCCAGGCAGG - Exonic
1142763013 17:2052263-2052285 GACGAGGAGCTGGACCAGGATGG + Intergenic
1142801597 17:2349663-2349685 GCGGAGGAGCTGAAGCAAGATGG + Intronic
1143703533 17:8680309-8680331 GTGGTGCAGCTGAACAAGGATGG + Intergenic
1144022348 17:11248607-11248629 GTGGAAACAGTGAACCAGGAGGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144535812 17:16090120-16090142 CTGAAGAAACTGAACCAGGCTGG - Intronic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146458002 17:33022044-33022066 GAGCAGAAGCTGGCCCAGGATGG + Intronic
1147368350 17:39974332-39974354 GTGGAGAAGCTGAGCCGAGTAGG + Exonic
1147488437 17:40841116-40841138 GTTGAGAAGCTGTTCCAGGAAGG + Intergenic
1147951394 17:44109899-44109921 GTGGGGAGGCTGTGCCAGGAAGG + Intronic
1148208659 17:45795055-45795077 CTGGAGGAGCTGACCCAGCAGGG + Intronic
1149108367 17:52996689-52996711 GAGGAGAAGGTGAAGCATGATGG + Intergenic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150810365 17:68351645-68351667 GTGGACACGCTGGACAAGGAGGG - Exonic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1151384799 17:73748499-73748521 CTGGAGAAGCTGCTCCAAGATGG + Intergenic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1152031006 17:77843097-77843119 GTCGAGAGGCTGAACCAATAGGG - Intergenic
1152054966 17:78017405-78017427 GTGGCGGAGCTGAACAAGGAGGG + Intronic
1152408112 17:80108784-80108806 GTGCAGGAGCTGCACCAGGGCGG + Intergenic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1155362534 18:25016691-25016713 GTGGAGAAGGGCAGCCAGGAGGG + Intergenic
1155576605 18:27254683-27254705 CTGGAGAAGCTGCACCTGGGCGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157619931 18:49011196-49011218 TTGGAGGGGCTTAACCAGGAGGG + Intergenic
1158538214 18:58327491-58327513 AGGGAGAGGCTGAGCCAGGAAGG + Intronic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159049334 18:63404048-63404070 GTGAGGAAGCTGAAACAGAAGGG - Intronic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1161111966 19:2475705-2475727 GTGGAGGGGCTGCACCGGGAAGG - Intergenic
1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG + Intronic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162026988 19:7900047-7900069 TTGGAGGAGCTGCACCTGGAGGG + Exonic
1162195456 19:8981099-8981121 TGGGAGAAGATGACCCAGGAAGG + Exonic
1162224690 19:9210861-9210883 GTGGCGAAGGAGAACCAGGGTGG + Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163025796 19:14511151-14511173 CTAGGGAAGCTGAGCCAGGAGGG + Intergenic
1163050499 19:14679747-14679769 GTGGAAAGGCTGAAGCAGAAGGG - Intronic
1163569686 19:18073545-18073567 GTGGAGCAGCTGGGCCAGGATGG - Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1164915216 19:32046627-32046649 CTGGAGGAGGTGAACCAAGAGGG - Intergenic
1165090026 19:33381410-33381432 CAGGAGAAGCTGTCCCAGGAGGG + Exonic
1165116760 19:33533387-33533409 GTGGAGAAGCTGCTCCAGGACGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140570 19:40803093-40803115 GTGAAGATGCTGAGCCAGGGAGG - Intronic
1167174187 19:47853972-47853994 GTGGGGAAACTGATCCTGGAGGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925892086 2:8442659-8442681 GTAGAGAAGCTAAACCCAGAAGG + Intergenic
926860481 2:17303669-17303691 GTATGGAAGCTGAACCTGGAAGG - Intergenic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927155386 2:20218221-20218243 GGGGCTCAGCTGAACCAGGAAGG + Intronic
927680000 2:25132831-25132853 GCTGAAAGGCTGAACCAGGAGGG + Intronic
928537091 2:32251397-32251419 GTGGAGCAGCTGACCCTGAATGG - Exonic
928916095 2:36472538-36472560 GTGCAGAAGCTTAAGCAGGAGGG - Intronic
928950959 2:36812547-36812569 GGGGAGAAGATGACCCAGGGAGG - Intronic
929002610 2:37362947-37362969 CTGGAGAAATTGAACCAGGGAGG + Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
931625311 2:64251797-64251819 GCTGAGAAGCTGAGCCAGGCTGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932347242 2:71003761-71003783 TGGGGGAAGCTGCACCAGGAGGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
932699319 2:73982538-73982560 GTGGAGGAGCTCATCCAGGGTGG - Intergenic
932812309 2:74835158-74835180 GAGGAGAAGCTGACCCGGGAAGG + Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934755973 2:96825078-96825100 GTGCAGAAGGTGAACAACGAGGG + Exonic
935675649 2:105592991-105593013 ATGGAGAAGCCGTGCCAGGAAGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936128243 2:109810585-109810607 GGGGAGAATCTGGACCATGATGG + Intronic
936216454 2:110560900-110560922 GGGGAGAATCTGGACCATGATGG - Intronic
936425595 2:112415471-112415493 GGGGAGAATCTGGACCATGATGG - Intronic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937424530 2:121787719-121787741 GTGTGGGAGCTGAACCAAGAAGG - Intergenic
937528688 2:122802268-122802290 TTGGAGTAGCTGGACCAGGAGGG + Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
943755760 2:191555304-191555326 TGGGAGAGGCTGAACTAGGATGG + Intergenic
944855545 2:203763805-203763827 GTGGAGAAAATGAGCCATGAAGG + Intergenic
945114296 2:206396076-206396098 GTGGTGAATCTGAAACATGAAGG + Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
947211445 2:227712159-227712181 TTTGGGAAGCTGAAGCAGGAGGG + Intronic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948259565 2:236592777-236592799 GTGGAGAAGGTGAACCCATAAGG - Intergenic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
1169425820 20:5496734-5496756 GTGGAGAAGTTTTACCAGGTTGG - Intergenic
1169864664 20:10187032-10187054 GTGGAAATGTTGAACCAGGCTGG + Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1171094269 20:22316535-22316557 GGGGACAAGCTGAGCCAGGCAGG - Intergenic
1172879691 20:38191562-38191584 TTGGAGCTGCTGAACCAGTAAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173753218 20:45492950-45492972 GGGGAGATGCAGAACCAGGGAGG + Intergenic
1174100743 20:48124506-48124528 GTGGAGCTGCTGACCCAGGGAGG - Intergenic
1174153680 20:48503324-48503346 GTGGAGATGCAGACCCAGGCAGG - Intergenic
1174153817 20:48504109-48504131 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154016 20:48505186-48505208 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154387 20:48507148-48507170 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154536 20:48507933-48507955 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154645 20:48508521-48508543 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154733 20:48509010-48509032 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174154919 20:48509990-48510012 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155045 20:48510675-48510697 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155323 20:48512147-48512169 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155433 20:48512734-48512756 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155451 20:48512832-48512854 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155560 20:48513420-48513442 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155747 20:48514400-48514422 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155855 20:48514983-48515005 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155863 20:48515032-48515054 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174155976 20:48515620-48515642 GTGGAGCTGCCGAACCAGGGAGG - Intergenic
1174340537 20:49892453-49892475 GAGGAGAAGCTGAGCCTGGCTGG - Intergenic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175683140 20:61005948-61005970 GGGGAGAAGCAGAACCATTAGGG + Intergenic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1177656009 21:24018797-24018819 GTGGAGAAACTGAACTAGGGTGG - Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1180045756 21:45304372-45304394 GTGGGCAAGCTCAGCCAGGAGGG - Intergenic
1180300411 22:11032394-11032416 GGGCAGATGCTGAACCGGGAAGG - Intergenic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1182109025 22:27709908-27709930 AAGGAGACGGTGAACCAGGAAGG - Intergenic
1182126125 22:27817036-27817058 TTTGAGCAGCTGAAACAGGACGG + Intergenic
1182462539 22:30492577-30492599 CTTGAGAAGCTGGACCAGAAAGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183934846 22:41256190-41256212 CTGGAGAAGCTGGACCTGAATGG - Exonic
1184251781 22:43264688-43264710 GTGAAGAAGCTGGAACAGCAGGG - Intronic
1184344855 22:43907133-43907155 GTGGGGAAACTGAAGCAGCAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185235068 22:49707558-49707580 CTGGAGAAGCTGGCCCAGCAGGG - Intergenic
1185268792 22:49918881-49918903 GTGGACAAGTTTAACCAGGTGGG + Exonic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949947543 3:9202457-9202479 GTGCAGGAGCTGCCCCAGGAGGG - Intronic
950090369 3:10290504-10290526 GGGAGGAAGCTGAACCAGCAAGG + Intronic
950312446 3:11970307-11970329 ATGGAGAAGCTGAGCCCAGAGGG + Intergenic
950580851 3:13861226-13861248 GTGGAGGATCTGATCCTGGAGGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
954648777 3:52147087-52147109 GGGGAGAACCTGAACCGGGTGGG + Exonic
955796071 3:62638509-62638531 ATAGAGAAGCTGAATCAGAAAGG + Intronic
956536573 3:70283363-70283385 TTGGAGAACCTGAAACTGGATGG + Intergenic
957307174 3:78472701-78472723 TTGGGGGAGCTGAACCAAGATGG + Intergenic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
961109172 3:124269016-124269038 GTGGAGGAGCTGGACCGGGAGGG + Exonic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
963042588 3:141080542-141080564 GTGGAGAGGCTGCAGCATGATGG - Intronic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969157551 4:5224573-5224595 GTAAAGAAGTGGAACCAGGAAGG - Intronic
970013728 4:11489325-11489347 GGTGAGAAGCTCAACCAGCAGGG + Intergenic
971303516 4:25461348-25461370 GAGGAGCATCTGGACCAGGAGGG + Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972766210 4:42153687-42153709 ATACAGAAGCTGAACCAGCAAGG - Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
976342491 4:83960758-83960780 GTGGAGAACCTGAAAGAGCAGGG - Intergenic
979620319 4:122791334-122791356 GAGGAAAAGCTGACCCAGGGAGG - Intergenic
980870015 4:138600514-138600536 GTTGGGAGGCTGAGCCAGGAAGG + Intergenic
985311072 4:188600007-188600029 GTGAAGAAGCTGAAGAAGAAAGG - Intergenic
985878837 5:2621907-2621929 GAGCAGTAGCTGAACCTGGACGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986124370 5:4871755-4871777 GTGGAGAAGCTTTCACAGGAAGG + Intergenic
986199388 5:5567807-5567829 GTGGAGCAGCTGAGCCGGGCTGG - Intergenic
989791985 5:45415685-45415707 GACAAGAAGCTGAACCAGGCTGG - Intronic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990406680 5:55498016-55498038 GAAGATAAGCAGAACCAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992023930 5:72652433-72652455 GTGGAGAAGTGGGACAAGGATGG + Intergenic
992195626 5:74336272-74336294 GTGGAAGAGGTGACCCAGGAGGG - Intergenic
992258912 5:74950577-74950599 CTGGAAAAGTTAAACCAGGATGG - Intergenic
993108809 5:83630706-83630728 CTGGAGAAGCTCAACCTTGATGG + Intergenic
993277280 5:85876872-85876894 CTGGAGAATCTGAACCTGGGAGG - Intergenic
993750716 5:91663510-91663532 GGGGAGAAGCTGAAACCAGAAGG - Intergenic
994379916 5:99058625-99058647 GTGAAGGAGCTGAACAAGGAAGG + Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
994977579 5:106829672-106829694 CTGGAGAAGCTGACCAATGACGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997547139 5:134718126-134718148 GTGGAGAAGCTGAGCAGAGATGG + Exonic
998174767 5:139894974-139894996 AGGCAGAAGCTGCACCAGGAGGG + Intronic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
999609695 5:153355355-153355377 GTGGGGAAGATGTAACAGGAGGG - Intergenic
1001651184 5:173317521-173317543 GTGGGGGAGGTGAACCAGGGAGG - Exonic
1002054356 5:176590180-176590202 GGGGAGAAGCGGTAGCAGGAGGG + Intronic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006073813 6:31516395-31516417 GGGCAGAAGCTGCAGCAGGAAGG - Intergenic
1006467780 6:34206323-34206345 GGGGAGAATCTGGACCATGATGG + Intergenic
1006922907 6:37638164-37638186 GTGGGGGAGCTGAATCTGGAGGG - Intronic
1007506283 6:42337702-42337724 GGGGAGGAGCTTAAGCAGGAGGG + Intronic
1007602484 6:43091266-43091288 GTTGGGAGGCTGAGCCAGGAGGG - Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009450942 6:63799978-63800000 GTCGAGAAGCTGAGCCTGGGCGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013656532 6:112252772-112252794 GGGGAGAAGCCAGACCAGGAGGG - Intronic
1014747865 6:125221005-125221027 GTGGAGAGGCCAAAGCAGGAAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015869429 6:137760960-137760982 CTGGTGAATCTGAAACAGGAAGG + Intergenic
1016026883 6:139296644-139296666 CTGAAGAAGCTTAACCAGAAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016635294 6:146282252-146282274 GTGGAGAAGGTGGACAATGAAGG - Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG + Intergenic
1018576332 6:165263797-165263819 GAGGCCAAGCTGAACCAGGCAGG + Intergenic
1018890031 6:167976703-167976725 GAGCAGGACCTGAACCAGGAAGG - Intergenic
1019500150 7:1360651-1360673 GTGGGGAGGCTGCAGCAGGAAGG + Intergenic
1019524860 7:1476358-1476380 GCGGAGACGCGGAGCCAGGACGG - Exonic
1020167107 7:5816197-5816219 GTGGAGACGTGGAAACAGGATGG + Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020825163 7:13017862-13017884 GTGGGTAAGCTGGAACAGGAAGG - Intergenic
1021775929 7:24055580-24055602 GTGGAGAAGTACGACCAGGAAGG + Intergenic
1022113276 7:27244079-27244101 GTGGAGAAGTGGGACTAGGAAGG - Intronic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023793571 7:43772465-43772487 GGGGGGAAGCTGCTCCAGGATGG - Intronic
1024308556 7:47948263-47948285 GTGGAGGCCCTGTACCAGGAGGG - Intronic
1024375622 7:48635187-48635209 GTGGAGAAGTTCAACCATAAGGG - Intronic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1024991936 7:55241740-55241762 CTGGAAAAGCTGAGCCATGAGGG - Intronic
1025849052 7:65230712-65230734 GTGGATCACCTGAACCAGGTTGG - Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1027814394 7:82950603-82950625 GTGGAGAAGCAGTTCCAGAAGGG + Exonic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1029675242 7:102064180-102064202 TGGAAGAAGCTAAACCAGGACGG - Intronic
1029845335 7:103406476-103406498 GAGGGCAAGCTGAACCAGGGTGG - Intronic
1030122311 7:106121898-106121920 GTGTAGAAGCTGAACAGGCAAGG + Intergenic
1030667383 7:112294279-112294301 GTGTTGAAGCTGGCCCAGGATGG + Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032401897 7:131629588-131629610 GTGGAGGGTGTGAACCAGGAGGG + Intergenic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1032631934 7:133662988-133663010 GTGGAGAAAGTGAAACAGAAAGG + Intronic
1032848523 7:135772476-135772498 GTGGAGAAGTTGCATCAGCAAGG + Intergenic
1032904450 7:136348264-136348286 GTGCAGATGCTGAACCAGTGAGG - Intergenic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1034737881 7:153445957-153445979 GTGGAGAAGATAAAGCAGAAAGG + Intergenic
1035454854 7:159001410-159001432 CTAGAGAACCTGAGCCAGGAAGG - Intergenic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1038405949 8:27323102-27323124 AAAGAGAACCTGAACCAGGATGG + Intronic
1042959466 8:74288192-74288214 GTGGAAAAGCAGCCCCAGGAGGG + Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049231128 8:141482457-141482479 GTGAGGGAGCTTAACCAGGAAGG - Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049586518 8:143434954-143434976 GTGGAGGAGCCGTGCCAGGAGGG - Intergenic
1050264675 9:3877827-3877849 GTTGAGTAACTGAACCTGGAAGG - Intronic
1050310341 9:4346606-4346628 CTAGAGAAGCTGACCAAGGATGG - Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1051951650 9:22641928-22641950 GTGAAGCAGGGGAACCAGGACGG + Intergenic
1053423731 9:37997598-37997620 GTGTAGAAGCTGGCACAGGAGGG + Intronic
1056938727 9:90937300-90937322 GTGGGGAAGGTGGACCTGGATGG + Intergenic
1056938773 9:90937453-90937475 GTGGGGAAGGTGGACCTGGATGG + Intergenic
1056966312 9:91165496-91165518 GTGGAGGAACTGTCCCAGGATGG + Intergenic
1057198734 9:93129379-93129401 GTGGAGCAGATGCCCCAGGATGG + Intronic
1058151997 9:101473587-101473609 GTAGAGAAACTGGACAAGGAAGG + Exonic
1058774954 9:108273879-108273901 AGGGAGGGGCTGAACCAGGATGG - Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1061451567 9:130669873-130669895 GGGGTGAGGCTGAGCCAGGAAGG + Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1061610157 9:131740403-131740425 GTGGAAAATCTGACCCAGGAGGG - Intergenic
1061900519 9:133669799-133669821 GTGGGGAGACTGAACCAGAACGG + Intronic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186849780 X:13569376-13569398 GTTGAGAAGTCGAAGCAGGATGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1190756148 X:53403772-53403794 AAGGAGAAGATGAACCAGGTTGG - Exonic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1193300860 X:79886862-79886884 GTGGAGGAACTCAGCCAGGAGGG - Intergenic
1194045039 X:88992020-88992042 GTGGAGAAGGTGAACCCGCTGGG - Intergenic
1194341922 X:92716072-92716094 CTGGAGAAGCTCAAACTGGACGG + Intergenic
1194804240 X:98307504-98307526 CTGGAGAACCTGACCCAAGATGG + Intergenic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1198897439 X:141471334-141471356 AGGGAGTAGCTGCACCAGGAAGG - Intergenic
1199514984 X:148665965-148665987 GTGGGGAGGGTGAAGCAGGATGG + Intronic
1200103294 X:153699128-153699150 GAACAGAAGCTGATCCAGGAAGG + Intergenic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic