ID: 900547147

View in Genome Browser
Species Human (GRCh38)
Location 1:3235534-3235556
Sequence CCCCGCTGCCTGGCAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 424}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900547141_900547147 0 Left 900547141 1:3235511-3235533 CCTGCAGAGATCCTTCCCGCTCG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 424
900547139_900547147 21 Left 900547139 1:3235490-3235512 CCCTGTGCTCGGGGACAGGGGCC 0: 1
1: 0
2: 0
3: 17
4: 201
Right 900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 424
900547140_900547147 20 Left 900547140 1:3235491-3235513 CCTGTGCTCGGGGACAGGGGCCT 0: 1
1: 0
2: 4
3: 12
4: 197
Right 900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 424
900547138_900547147 22 Left 900547138 1:3235489-3235511 CCCCTGTGCTCGGGGACAGGGGC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900547147 Original CRISPR CCCCGCTGCCTGGCAGAGAA AGG Intronic
900220317 1:1505229-1505251 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
900409516 1:2506422-2506444 CCCCTCTGCCTGGCTGAGCTGGG - Intergenic
900431645 1:2605667-2605689 CCCCGCAGCCTGGCTGAGGCAGG + Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900563261 1:3319193-3319215 CCCTGCTGCCCGGCAGGGATGGG + Intronic
900608693 1:3535402-3535424 CCCTGCTGCCTGTCAGATGAGGG - Intronic
900879919 1:5373398-5373420 CCCTGATGACTGGCAGAGAGAGG - Intergenic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901459579 1:9383450-9383472 GCCCGATGCCTGTGAGAGAAGGG - Intergenic
903170247 1:21548085-21548107 GCCGGGAGCCTGGCAGAGAAGGG + Intronic
905746350 1:40421877-40421899 CTCCCCATCCTGGCAGAGAAAGG + Intronic
905835612 1:41117780-41117802 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
906139736 1:43526894-43526916 CTCCACAGCCTTGCAGAGAAAGG - Intronic
906534835 1:46545692-46545714 CCCCGATGCCTGGCAGGGCCAGG - Intronic
906678562 1:47709909-47709931 CCCCGCTGAAGGGCAGCGAAGGG - Intergenic
907313476 1:53553091-53553113 CCCACCTGGCTGGCTGAGAATGG + Intronic
907489615 1:54800703-54800725 GCTCGCTGCCTGGCCGAGCAGGG - Exonic
907535526 1:55151967-55151989 CCTTGCTGCCTGGCAGGAAAGGG + Intronic
909455305 1:75843098-75843120 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
909788480 1:79643545-79643567 CCCCCCAGAATGGCAGAGAAGGG + Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
916429302 1:164712050-164712072 CCCATCTGCCTTGCAGGGAAGGG + Intronic
920275282 1:204799908-204799930 GCCCAATGCCTGGCAGAGTAAGG + Intergenic
920505190 1:206510725-206510747 CCCCTATGCCAGGCAAAGAAGGG - Intronic
921048645 1:211495143-211495165 CCCAGCTAGCTGGCAGGGAAGGG - Intergenic
922890737 1:229059960-229059982 CCCTGCTGCCCGGCAGTGAGGGG + Intergenic
924415883 1:243856092-243856114 CCCAACTGCTTGGAAGAGAATGG - Intergenic
1063365439 10:5487597-5487619 CCGCGCTGCCTGGGAGGTAAGGG - Intergenic
1064018832 10:11793354-11793376 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1064044327 10:11998464-11998486 CCCTGGAGCCTGGCAGAGCAAGG - Intronic
1067673384 10:48346857-48346879 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1068987118 10:63117666-63117688 CCCCACTACCTGGTAGAGAGAGG - Intergenic
1071592092 10:86884156-86884178 CCCAGCAGGCTGGCAGGGAATGG - Intronic
1072633326 10:97161983-97162005 CCCAGGTGCCTGGCATAGAGTGG + Intronic
1074849309 10:117426242-117426264 CCCAGTTCCATGGCAGAGAAGGG + Intergenic
1075086664 10:119418419-119418441 CCCCTCTGGCTGGATGAGAAAGG - Intronic
1076356167 10:129855276-129855298 CACCACTGCCTGGCAGTGGATGG + Intronic
1076419657 10:130321958-130321980 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1076517671 10:131057295-131057317 CCCCGATGCCTGGGAGAGGCAGG - Intergenic
1076628747 10:131839884-131839906 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1076736089 10:132459644-132459666 GCCTGCAGCCCGGCAGAGAAAGG - Intergenic
1077006744 11:361653-361675 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1077265022 11:1644373-1644395 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1077388307 11:2286155-2286177 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1077836758 11:5933075-5933097 CCCCCGTTCCTGCCAGAGAATGG - Intronic
1078341639 11:10501456-10501478 CCGCGCTCCCTGTAAGAGAAGGG - Exonic
1083147873 11:60772362-60772384 CCCAGGTGCTGGGCAGAGAATGG + Intronic
1083298694 11:61728866-61728888 CCCGGCTGCATGGCTGGGAAAGG - Intronic
1083349444 11:62017012-62017034 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1083755844 11:64791285-64791307 TCCTGCTTCCTGGCTGAGAATGG + Intronic
1083876436 11:65526442-65526464 CCCTGCTGCCTGGCTGGGGAGGG + Intronic
1083976899 11:66129673-66129695 CCCTGCTGCCTGGCAGTGCTGGG - Intronic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1085143537 11:74171469-74171491 CCCCGCTGCCGGGTAGAGGTGGG - Exonic
1085295862 11:75431339-75431361 GCTCACTGCCTGGCACAGAAAGG - Intergenic
1086458537 11:86983111-86983133 CCCAGCTGCCCAGCAGAGAGTGG + Intergenic
1088628086 11:111747270-111747292 CACTGCTGCCTGGCACACAAGGG + Intronic
1089557077 11:119320689-119320711 CCCCACCCCCTGGCAGGGAAGGG - Intronic
1089672727 11:120067652-120067674 CCCCACTGCCTGTCAGAGGGAGG + Intergenic
1090350436 11:126104540-126104562 CCCCTCAGCCTGACAGAGCAGGG - Intergenic
1090405630 11:126474452-126474474 CCCTGCTCCCTGCCAGGGAAGGG - Intronic
1090406642 11:126479719-126479741 CCCCGGGGCCGGCCAGAGAAAGG + Intronic
1090869596 11:130731417-130731439 CCCTGCAGGCTGGCAAAGAATGG - Intergenic
1092224952 12:6742237-6742259 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1092449055 12:8585065-8585087 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1093285578 12:17256523-17256545 CCCTCCTGGCTAGCAGAGAATGG + Intergenic
1093588276 12:20868852-20868874 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1096667383 12:53174979-53175001 CCCCGCTGGCTCTCAGGGAAGGG + Intronic
1097089981 12:56497292-56497314 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1097090526 12:56500978-56501000 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1098935341 12:76472640-76472662 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1101390300 12:104293933-104293955 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1102042799 12:109811333-109811355 CCCCACTGACTGGCAGACAGTGG + Intronic
1102254556 12:111407987-111408009 ACCTGCTGCCTGGCAAAGAGAGG + Intronic
1102390267 12:112543865-112543887 TCCTGCTGCCCCGCAGAGAATGG + Intergenic
1103163980 12:118754419-118754441 CCCCGCTGCATGTCAATGAAAGG - Intergenic
1103357993 12:120336021-120336043 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1103485470 12:121279840-121279862 CTCAGCTTCCTGGCAGAGGAAGG - Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104878223 12:132051528-132051550 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1105041438 12:132964499-132964521 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1105856370 13:24376100-24376122 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1105886959 13:24650497-24650519 CCCAGCTGGCTGGAGGAGAAGGG - Intergenic
1106035542 13:26041351-26041373 CCCTGCGGCCTGCCAGAGAAGGG - Intergenic
1113389002 13:109877916-109877938 CCACCCTGCCTGCCAGGGAATGG - Intergenic
1113775420 13:112942318-112942340 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1113856748 13:113450636-113450658 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1113880347 13:113622057-113622079 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1114658150 14:24328525-24328547 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1115176060 14:30562864-30562886 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1117252808 14:53953123-53953145 CCCGGCTGCCGGGCCAAGAAGGG + Intronic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1117632558 14:57708877-57708899 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1118348091 14:64954341-64954363 CCCCAGTACCTGGCATAGAAGGG + Intronic
1119025302 14:71147927-71147949 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1119615881 14:76099008-76099030 CCCCGCTGCCTGGAGGAACAGGG + Intergenic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121580348 14:95025315-95025337 CCTCGAAGCCTGGCAAAGAAAGG + Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1126066628 15:44830684-44830706 CCCCGCTGCTTAGGAGAGGAAGG - Intergenic
1126093254 15:45070185-45070207 CCCCGCTGCTTAGGAGAGGAAGG + Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127650509 15:61002044-61002066 CTCAACAGCCTGGCAGAGAAAGG - Intronic
1127752183 15:62056856-62056878 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1127877555 15:63123700-63123722 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1128344641 15:66845657-66845679 CCACGCTGCCTGGGACAGCACGG - Intergenic
1129574909 15:76732891-76732913 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1129603473 15:77013506-77013528 CCCAGGTGCCAGGGAGAGAAAGG - Intronic
1129923285 15:79339182-79339204 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1131268350 15:90932022-90932044 CCCAGGCTCCTGGCAGAGAAGGG + Intronic
1131371477 15:91885514-91885536 CCCCGCTGCCCAGCAGCAAAGGG - Intronic
1132515454 16:363838-363860 CCGCGGTGTCGGGCAGAGAATGG - Intergenic
1132656843 16:1044999-1045021 CCCAGCTGCCTGGCAGGGCAGGG - Intergenic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1132832534 16:1935828-1935850 CCTCTCTGCGTGGCAGAGGATGG - Intergenic
1132855281 16:2042202-2042224 GCCCGCAGCCAGGCAGGGAACGG - Intronic
1132966792 16:2660529-2660551 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1132967924 16:2669796-2669818 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1133010301 16:2906816-2906838 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1133108180 16:3527818-3527840 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1133157286 16:3884029-3884051 CCCAGCTGCCTGGGAGACCAAGG + Intergenic
1133331857 16:4979828-4979850 CCTCCCTGGATGGCAGAGAAGGG - Intronic
1134400503 16:13905416-13905438 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1134778194 16:16871295-16871317 CCCTCTTGCTTGGCAGAGAAAGG + Intergenic
1134860319 16:17554903-17554925 CCCGTGTGCCTGGCAGAGATTGG + Intergenic
1135415354 16:22264636-22264658 CCCTTCTGCTTGGCAGAGAAGGG + Intronic
1136065025 16:27753062-27753084 CCTCGCAGCCAGGCAGAGCATGG + Intronic
1136191207 16:28615814-28615836 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1136319219 16:29471706-29471728 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1136352685 16:29721347-29721369 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1136433790 16:30211050-30211072 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1137038845 16:35591446-35591468 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1140734963 16:77890367-77890389 CTCCTCTGCCTGGCAGCAAAGGG - Intronic
1141598946 16:85113802-85113824 CCCCACAGCTTGGCACAGAAAGG - Intergenic
1142042263 16:87901970-87901992 CCGAGCTGCATGGCAGACAAAGG + Exonic
1142088953 16:88199931-88199953 CGGCCCTGCCTGGTAGAGAAGGG - Intergenic
1142144636 16:88487755-88487777 GCCTGCTGCCTGCCAGAAAAAGG - Intronic
1142157532 16:88539445-88539467 ACCCTGTGCCTGGCAGAGGAAGG - Intergenic
1142274622 16:89111288-89111310 CGCAGCTGCCTGGCAGAGAAAGG - Intronic
1142587450 17:982489-982511 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1143464495 17:7126979-7127001 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1144687006 17:17232675-17232697 CCCTGATGCCTCTCAGAGAAAGG - Intronic
1145036036 17:19541294-19541316 CCCTGCTCCCTAGGAGAGAATGG - Intronic
1145209363 17:21002013-21002035 TACCGCTGCCTGGCAGCCAAGGG - Exonic
1145223436 17:21107704-21107726 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1145732034 17:27198137-27198159 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1146103837 17:30012489-30012511 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1146356072 17:32135328-32135350 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1147930356 17:43976890-43976912 CACCAGTGCCTGGCACAGAAGGG + Intronic
1148623001 17:49048729-49048751 CCCCGCTTCCTGTCAGATCAGGG + Intronic
1148907003 17:50918354-50918376 GCCCGCTGCCTGGGAGGGGAGGG - Intergenic
1149551756 17:57545802-57545824 CCCAAGTGCCTGGCAGAGAAGGG + Intronic
1150182592 17:63140595-63140617 CCCCTCTGCCTAGAAGGGAATGG + Intronic
1150819468 17:68423654-68423676 CCCAGCTTCCTGGCACTGAATGG + Intronic
1150975248 17:70078712-70078734 GCCCCCAGCCTGGCAGAAAAAGG + Intronic
1151384633 17:73747612-73747634 CCACGCAGCCAGGCAGAAAAAGG - Intergenic
1151624195 17:75266517-75266539 CACCACGGCCAGGCAGAGAAGGG - Exonic
1152543114 17:80986999-80987021 CAGCGAGGCCTGGCAGAGAATGG + Intergenic
1152597600 17:81245622-81245644 CCCCGCAGCCTGGCGGAGCTGGG + Exonic
1152687478 17:81701725-81701747 CCCCCCTCACTCGCAGAGAAGGG - Exonic
1152874307 17:82777559-82777581 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1153489223 18:5630347-5630369 CCCGGCTGCCAAGAAGAGAAAGG + Intronic
1155224621 18:23718603-23718625 CCCCGCAGCCCTGCAGAGCAGGG - Intronic
1156853307 18:41753630-41753652 TTCTGCTTCCTGGCAGAGAAAGG + Intergenic
1157138925 18:45086151-45086173 CCCTCCAACCTGGCAGAGAATGG + Intergenic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1157727762 18:49978093-49978115 TCCTGCCGCCTAGCAGAGAAAGG + Intronic
1158507485 18:58059496-58059518 CCATGCTGCCTGGCTAAGAAGGG + Intronic
1158861646 18:61598330-61598352 TCCCTGTGCTTGGCAGAGAAAGG - Intergenic
1159530348 18:69647869-69647891 CCCTGCCGGCGGGCAGAGAAAGG - Intronic
1160419584 18:78735028-78735050 CCCAGGTGCCCGGCAGAGCATGG - Intergenic
1160632651 18:80257590-80257612 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1160976301 19:1794402-1794424 CCCCACATCCTGGCAGAGCAGGG + Intronic
1161169562 19:2806032-2806054 CCCCCCTGCCTTGCAGTGATCGG - Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161894049 19:7066926-7066948 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1162312048 19:9913658-9913680 CCCCGCGGCGGGCCAGAGAAGGG - Intronic
1162362617 19:10229044-10229066 CCTGGCTGCTTGGTAGAGAATGG - Intronic
1162729983 19:12712621-12712643 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1163456261 19:17407512-17407534 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1163471327 19:17498820-17498842 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1164083467 19:21880523-21880545 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1164084621 19:21889793-21889815 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1164261572 19:23572406-23572428 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1164656865 19:29928181-29928203 CCCGGCTGCCTGGCTGGGAGCGG + Intronic
1164955168 19:32376879-32376901 CTCTGCTGCCAGGCAGGGAAGGG - Intronic
1165460338 19:35940366-35940388 CCCCACTGCCCGGCAGCGCAGGG - Exonic
1165671202 19:37680802-37680824 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1166449321 19:42884659-42884681 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1166908907 19:46136985-46137007 ACCAACTGACTGGCAGAGAAAGG + Intergenic
1167289672 19:48617467-48617489 CCCCGCAGCCTTCCAGTGAAGGG + Intronic
1167370066 19:49075434-49075456 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1167400751 19:49266940-49266962 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1167719575 19:51169084-51169106 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1167970271 19:53184896-53184918 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1167971366 19:53189480-53189502 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1167990959 19:53360285-53360307 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1168131472 19:54322653-54322675 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1168215087 19:54919410-54919432 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168603426 19:57738911-57738933 CTTGGCTGCCAGGCAGAGAAGGG + Intronic
1168680298 19:58310523-58310545 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
924985046 2:263526-263548 CCCCCCAACCTGGAAGAGAAGGG - Intronic
925333615 2:3077285-3077307 GCCCGCGGCCTGTCACAGAAAGG - Intergenic
925845784 2:8031969-8031991 CCGTGCTGCCCTGCAGAGAATGG - Intergenic
925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG + Intergenic
926308559 2:11657977-11657999 GCTCCCTGCCTGGGAGAGAATGG + Intergenic
927718000 2:25364838-25364860 CCCAGCTGCCTGGGAAAGACTGG - Intergenic
927859205 2:26549984-26550006 TCCCAGTGCCTGGCACAGAATGG - Intronic
928282718 2:29963451-29963473 CCCAGCTGCCTGGCCGAGTGGGG + Intergenic
928387543 2:30883252-30883274 CCCCTCTCCCTGGGAGATAAGGG + Intergenic
930115744 2:47716914-47716936 CTCGGATGCCTGGCAGGGAAGGG + Intronic
930725179 2:54675115-54675137 CCCCAATGCCTGGTGGAGAAGGG - Intergenic
930951073 2:57145315-57145337 CCCTGCTGCCAGGGAGAGGAGGG - Intergenic
932432642 2:71685107-71685129 CCCTGCTGCCTGGCTGGGAGAGG + Intronic
932673010 2:73754468-73754490 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
934543218 2:95193510-95193532 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
934559412 2:95304898-95304920 ACCAGGTGACTGGCAGAGAATGG + Intronic
934852994 2:97713088-97713110 TCCAGATGCCTGGCACAGAAGGG + Intergenic
934882441 2:97995704-97995726 CGCCGCCGCCTCGCCGAGAAGGG - Exonic
936410536 2:112254598-112254620 ACCCGCTGCTGTGCAGAGAAAGG + Intronic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
938972569 2:136445946-136445968 CCCCAATGCCTGGCACAGAATGG - Intergenic
939345702 2:140964113-140964135 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
940046412 2:149415346-149415368 CCCCTCTGCCTGGCTGAAAAAGG + Intronic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940357141 2:152755589-152755611 CTTGGCTGCCAGGCAGAGAAGGG + Intronic
940855322 2:158724730-158724752 CTCTGATGCCTGGCAGGGAAGGG + Intergenic
941641846 2:167997259-167997281 CCCAGATTCCTGGCAGAGAATGG - Intronic
941928237 2:170916672-170916694 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
942248476 2:174028020-174028042 CCCCTCTGCCTGGCAAGAAATGG + Intergenic
946167066 2:217870788-217870810 GCCAGCTGCCTCGCAGAGCAGGG + Intronic
946686223 2:222273149-222273171 CCAGGCTGGCTGGAAGAGAAAGG - Intronic
947822519 2:233081957-233081979 CCCCTCTGCCTCTCAGAGATGGG + Intronic
947993212 2:234503770-234503792 CGCCCCTGACAGGCAGAGAAGGG - Intergenic
948473665 2:238203214-238203236 CCCCTCTGCGTGGCGGTGAAAGG - Intronic
949019321 2:241732339-241732361 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
949046711 2:241875563-241875585 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1169295500 20:4393899-4393921 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1170053888 20:12177744-12177766 TCCCACGGCATGGCAGAGAAAGG - Intergenic
1170801757 20:19596160-19596182 CCCAACTGCTTGGCAGAGAAAGG + Intronic
1171043948 20:21792820-21792842 TCCCAATGCCTGGCAGAGTAAGG - Intergenic
1171460895 20:25297383-25297405 GCCCCCTGCCAGGCAGAAAATGG - Exonic
1172358935 20:34298904-34298926 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1172951320 20:38724973-38724995 CTCCGCTGCCTCGCTGATAATGG - Exonic
1173165201 20:40682976-40682998 CGGCGCTGCCTGGCGGGGAAGGG - Intergenic
1174296262 20:49547403-49547425 GCATGCTGCCTGGCAGAGTATGG + Intronic
1174541692 20:51294681-51294703 CCCTGCAGCCTAGGAGAGAAAGG - Intergenic
1175273113 20:57748790-57748812 CCCAGCTGTCTGGCAGGGATGGG - Intergenic
1175986856 20:62768346-62768368 CCCCCCTGGCTGGCACAGAACGG + Intergenic
1176270325 20:64232891-64232913 GCCCACTGCCTGACAGAGAGGGG - Intronic
1179134549 21:38668128-38668150 CCTACCTGCCTGGGAGAGAAGGG + Intergenic
1179695788 21:43116978-43117000 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1179916129 21:44479368-44479390 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1180045627 21:45303829-45303851 CCCCCCTGGCTGGCAGTCAATGG - Intergenic
1180099205 21:45576583-45576605 CCCCGGTCCCTGCCAGGGAAAGG + Intergenic
1180201004 21:46224205-46224227 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1180783869 22:18536248-18536270 CCCCACTGCCCCGCAGAGAAAGG - Intergenic
1180830772 22:18904925-18904947 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1180933270 22:19607638-19607660 GCCTGCTGCCTGGCAGGGGAGGG + Intergenic
1180939826 22:19652586-19652608 CCCAGCTGCATGGCAGACTAAGG + Intergenic
1181106881 22:20580966-20580988 CACCTCTGCCTGGGAGAGGAGGG - Intronic
1181127437 22:20710297-20710319 CCCCACTGCCCTGCAGAGAAAGG - Intronic
1181240769 22:21475600-21475622 CCCCACTGCCCCGCAGAGAAAGG - Intergenic
1181729870 22:24837274-24837296 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1181773673 22:25144742-25144764 CCCCACTCCCAGGCATAGAAAGG + Intronic
1181837860 22:25625840-25625862 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1182336248 22:29585453-29585475 CACCCCTGCCTGGGAGAGATGGG + Intergenic
1182648461 22:31829782-31829804 CCCTGCTGCCCAGCAGAGACAGG + Intronic
1183585231 22:38749590-38749612 CACCCCTGCCTGACAGAGGATGG - Intronic
1183951297 22:41354546-41354568 CCCAGCAGCCTGGAAGAGCAAGG + Intronic
1183987119 22:41575964-41575986 CACCCCTGCCTGGGAGTGAATGG - Exonic
1184275348 22:43406594-43406616 CCCCTCGGCCTGGCAGGGCATGG + Intergenic
1184344403 22:43904192-43904214 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1184351613 22:43947767-43947789 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1184358923 22:44002067-44002089 GCCTGCACCCTGGCAGAGAATGG - Intronic
1184661136 22:45966078-45966100 CCCCTCGGGCTGCCAGAGAAGGG - Intronic
1185336671 22:50273931-50273953 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1203280861 22_KI270734v1_random:130196-130218 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
951694903 3:25436354-25436376 CCCAGATGACTGGCAGATAAAGG + Intronic
953059794 3:39417939-39417961 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
953791613 3:45951857-45951879 CCCCTCCTCCTGGCAGAGATGGG - Intronic
954400656 3:50317921-50317943 CCCCTCTGGCAGGGAGAGAAGGG + Exonic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955370265 3:58345155-58345177 CCCCTCTGCCTGGGAGAGCAGGG + Intronic
956504222 3:69920593-69920615 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
957555629 3:81761700-81761722 CCCCGCTGGCGGGGGGAGAAAGG - Exonic
958657267 3:97018524-97018546 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959995489 3:112676105-112676127 AGCCACAGCCTGGCAGAGAAAGG + Intergenic
960593376 3:119386811-119386833 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
961458648 3:127036688-127036710 CACCGCTGCTGGGCACAGAACGG - Exonic
961556492 3:127699844-127699866 CCCCTCTGGCTGGCTGTGAAGGG - Intronic
962796791 3:138856425-138856447 CCCCACTGCCTTGCAAAAAAAGG + Intergenic
963291615 3:143495899-143495921 CCCTCCTGCCTGCCTGAGAAGGG - Intronic
963781246 3:149488782-149488804 CCCCTCTGCCTGACAGTGACTGG + Intronic
963849649 3:150198277-150198299 CACAGCTGCCTGGCAAAGGAGGG + Intergenic
964186938 3:153957036-153957058 GCCAGGTGCCAGGCAGAGAAAGG + Intergenic
965439767 3:168698688-168698710 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
965644004 3:170860790-170860812 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
966815579 3:183887230-183887252 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
966874626 3:184315024-184315046 CCCGGCGGCCTGGCCGCGAAGGG - Intronic
967073783 3:185984058-185984080 CCCGGCTGCCAGGCGGAGAAAGG - Intergenic
967925247 3:194640600-194640622 CCCAGCCGCCTGGCGGAGACAGG + Intergenic
967939351 3:194754335-194754357 CCCGGATGCCTGGCAGTGCAGGG + Intergenic
968050876 3:195654216-195654238 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
968064965 3:195753484-195753506 CCCCGAAGGCTGGCAGAGGAGGG + Intronic
968104948 3:195994122-195994144 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
968303243 3:197631709-197631731 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
968397811 4:259825-259847 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
968542901 4:1177425-1177447 CCCCGATGCCTGACTGGGAAAGG - Intronic
969060573 4:4431079-4431101 CACCATTGCCTGCCAGAGAAAGG + Intronic
969537607 4:7766349-7766371 CCCCACTGCCTGGGAGGAAATGG - Intronic
969618538 4:8267473-8267495 CCCAGCTGCAGAGCAGAGAAGGG + Intergenic
969642398 4:8406670-8406692 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
970137213 4:12938011-12938033 CTAGGCTGCCTGGCAGACAAAGG - Intergenic
972321220 4:37975214-37975236 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973296392 4:48526626-48526648 TCAAGCTGACTGGCAGAGAAGGG + Intronic
974240056 4:59235492-59235514 CTTGGCTGCCAGGCAGAGAAGGG - Intergenic
974493413 4:62595843-62595865 CTCCGCTGCCAGGCAGGGAAGGG + Intergenic
975387444 4:73773839-73773861 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
975632298 4:76416162-76416184 CTCAGCTGCCAGGCAGGGAACGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
980093684 4:128467808-128467830 CCCCAGGGCCTGGCATAGAAAGG - Intergenic
980112658 4:128649507-128649529 CCCTGCTGACTGGCAGAGGTTGG - Intergenic
980292408 4:130860236-130860258 CCCAGATGCCTAGCAGAAAATGG + Intergenic
982166841 4:152621093-152621115 CCCTGCTGCCTTGCAGAGATTGG + Exonic
983821023 4:172193419-172193441 CACAGCAGCCTGGCAAAGAAGGG + Intronic
984436897 4:179720447-179720469 TACCCGTGCCTGGCAGAGAAAGG + Intergenic
985472204 5:53392-53414 CCCCACAGCCTGCCTGAGAAGGG - Intergenic
985613285 5:902852-902874 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
985622450 5:962689-962711 CCCAGCCGCCTGGCACAGAGTGG + Intergenic
985629306 5:1006461-1006483 CCCCACTGACTGGCAGATCAGGG - Intergenic
985651761 5:1111000-1111022 CCCTGCTCCCTGGCAGTGGAAGG - Intronic
987235264 5:15936093-15936115 CCCAGCTGCCTCCCAGGGAATGG + Intronic
987359695 5:17095646-17095668 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
988479758 5:31619936-31619958 CCCAGCGGCCTGGCAGAGTTGGG - Intergenic
989448120 5:41554752-41554774 CCATGGTGTCTGGCAGAGAAGGG + Intergenic
991200469 5:63986002-63986024 CCTCTCTGCGAGGCAGAGAAAGG + Intergenic
992460651 5:76956617-76956639 CCCAGCTACTTGGGAGAGAATGG + Intronic
996574147 5:124963393-124963415 CCTCCCTGCCTGGCAGGGAGAGG - Intergenic
997971951 5:138410778-138410800 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
998154197 5:139775204-139775226 CCCTGCTGCCTTGCAAAGATAGG - Intergenic
1001650464 5:173312273-173312295 CCCCGAGGCCTGTCAGAGCATGG - Intergenic
1002618850 5:180472007-180472029 CCCAGCTGCCTGGCTGGGACTGG + Intergenic
1002919224 6:1554552-1554574 CCAGGCTGGCTTGCAGAGAACGG - Intergenic
1003165866 6:3677892-3677914 GGCCGCAGCCTGGCAGAGGAAGG - Intergenic
1003696834 6:8415496-8415518 CCACTCTGCCTGGGACAGAAGGG - Intronic
1004864266 6:19837827-19837849 CTGCGCTGCCTGGCCGAGCACGG + Exonic
1005706242 6:28456525-28456547 CCCAGATGCCTGGCAGCAAAGGG + Intergenic
1005709762 6:28491760-28491782 CTCAGCTGCCAGGCAGGGAAGGG + Intergenic
1006011057 6:31043278-31043300 CCCTCCTGCCTTGAAGAGAATGG - Intergenic
1006136097 6:31897291-31897313 CCCCGCGGCCTGGGGGACAAAGG - Intronic
1006304932 6:33213226-33213248 CCCCGCTGCCCGGCGGGCAAAGG - Intergenic
1006386605 6:33734554-33734576 GCCGGCTGCCTGGCAGAGTGTGG + Intronic
1006652101 6:35559985-35560007 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1007282753 6:40724314-40724336 CCCCGCTGGGTAGCAGAGCAGGG + Intergenic
1007596897 6:43056516-43056538 CACTGCTCTCTGGCAGAGAATGG - Intronic
1008435103 6:51466685-51466707 GCCTGGTGCTTGGCAGAGAAGGG - Intergenic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1010244916 6:73653908-73653930 ACTCGCCACCTGGCAGAGAAGGG + Exonic
1017520090 6:155194410-155194432 CCCCGGTGCCAGCCAGGGAAGGG + Intronic
1019139424 6:169934202-169934224 CTCAGCAGCCTGGAAGAGAACGG + Intergenic
1019215021 6:170437925-170437947 CCTTGCTGGCTGGCAGAGATGGG + Intergenic
1022981825 7:35611448-35611470 CCCCACTGGCTGACAGATAAGGG + Intergenic
1023021770 7:36017595-36017617 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1025872356 7:65446877-65446899 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1026731759 7:72917947-72917969 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1027524331 7:79247495-79247517 CCCAGCTGCTTGGGAGACAAGGG + Intronic
1029477280 7:100792485-100792507 GCCCGCCTCCTGGCAGAGGATGG - Intronic
1029699655 7:102237912-102237934 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1029756035 7:102574176-102574198 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1029773977 7:102673248-102673270 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG + Intergenic
1030606653 7:111645169-111645191 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1031153598 7:118083395-118083417 CACCCCTGCCAGGCAGAGAAAGG + Intergenic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032415615 7:131733206-131733228 CCCCTGTGCCTGGCACACAAGGG - Intergenic
1033785698 7:144727433-144727455 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1034054645 7:148021743-148021765 ACCCGGTGGCTCGCAGAGAAGGG + Intronic
1034432879 7:151049747-151049769 CCCCACCTCCTGGCAGAGATAGG - Intronic
1034606375 7:152319848-152319870 CTCAGCTGCCAGGCAGGGAAGGG + Intronic
1034866897 7:154649672-154649694 CCCAGGTGCCAGGTAGAGAAAGG - Intronic
1037057262 8:14457721-14457743 CTCGGCTGCCAGGCAGAGAAGGG + Intronic
1037322702 8:17658998-17659020 TCTCGTTGCCTGGCACAGAATGG + Intronic
1038375094 8:27032425-27032447 CCCGGCTGCCCTGCAGAGAATGG + Intergenic
1038994135 8:32902781-32902803 CCCCACTGCCTGACAGAGATTGG + Intergenic
1039907342 8:41796812-41796834 CCGTGCTGCCAGGCAGAGATAGG + Intronic
1040417300 8:47206654-47206676 CCCCGGTGGCTTGCAGATAAGGG + Intergenic
1040794762 8:51276994-51277016 CCCCTCAGCATGGCAGTGAAGGG - Intergenic
1040828224 8:51646846-51646868 TGCCACTGCCTGGGAGAGAAAGG + Intronic
1041181663 8:55255839-55255861 CAACTCTGCCTGGCAGACAACGG - Intronic
1042910927 8:73825424-73825446 CACCGCTGAGTGTCAGAGAAGGG - Intronic
1043456957 8:80422127-80422149 GTCAGCTTCCTGGCAGAGAAGGG - Intergenic
1044306748 8:90647387-90647409 CCCAGTTGCCTGCCAGATAACGG + Intronic
1047220425 8:122914244-122914266 TCAGGCTGCCTGGCAGAGCATGG - Intronic
1047469107 8:125150176-125150198 CCCTGCTGCCTGGGACCGAAGGG - Intronic
1048354287 8:133640840-133640862 CATCGTTGCCTGGCAGAGAAAGG - Intergenic
1049327730 8:142032303-142032325 CCCCAGTGGCTGGCAGATAAGGG + Intergenic
1049429192 8:142551302-142551324 CCCTGCTGGCTTGGAGAGAAGGG + Intergenic
1049516216 8:143058407-143058429 CTCAGCTGCCAGGCAGGGAAGGG - Intronic
1049666249 8:143844534-143844556 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1049810646 8:144567771-144567793 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1049857220 8:144870256-144870278 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1049880056 8:145055825-145055847 CTCTGCTGCCAGGCAGGGAAGGG + Exonic
1050864468 9:10480292-10480314 CTCAGCTGCCTGGTAGAGAATGG - Intronic
1051292186 9:15555839-15555861 CACCGGGGCCTGGCAGAGAGTGG - Intronic
1052052742 9:23866592-23866614 CCCCTCTGCATGGCAGTGAAGGG + Intergenic
1052269569 9:26613636-26613658 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1053089241 9:35258704-35258726 TCCAGCTGCCTGGCAGAGCTAGG + Intronic
1053785499 9:41649966-41649988 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1054159532 9:61664207-61664229 GTCTGCTGCCTGGCACAGAATGG + Intergenic
1054174218 9:61863918-61863940 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1054449077 9:65392985-65393007 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1054663319 9:67716863-67716885 GTCTGCTGCCTGGCACAGAATGG + Intergenic
1057554494 9:96076853-96076875 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1057698003 9:97341083-97341105 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1057730233 9:97602156-97602178 CCCAGCTGCATGGAACAGAAAGG + Exonic
1058159204 9:101549301-101549323 CTCGGCTGCCAGGCAGGGAAGGG - Intronic
1059061437 9:111038337-111038359 CCCCGCCGCCCGGCCGAGCACGG - Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1061039179 9:128129736-128129758 CTCCGCTGCCAGGCAGGGAAGGG - Intergenic
1061048797 9:128182063-128182085 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1061349660 9:130054195-130054217 CCCCGCCACCTGTCAGTGAAAGG - Intronic
1061535405 9:131245309-131245331 CTCGGCTGCCAGGCAGGGAAGGG + Intergenic
1061835847 9:133329101-133329123 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1061961376 9:133990936-133990958 CCCCCCAACCCGGCAGAGAAAGG + Intronic
1062183900 9:135206105-135206127 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1062639390 9:137510477-137510499 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1062645517 9:137546214-137546236 CTCGGCTGCCAGGCAGGGAAGGG + Intronic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1185471926 X:389186-389208 CCCAGTAACCTGGCAGAGAAAGG - Intergenic
1186131705 X:6473687-6473709 TCCCTCTGCCTTGCATAGAAAGG - Intergenic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187960060 X:24559760-24559782 CCCTGCTCCCAGGCAGAGACCGG - Intronic
1190775081 X:53546194-53546216 CCCCGCTGCCCGGCACACAGTGG - Intronic
1190808382 X:53861099-53861121 ACCTGCTGCCTTGAAGAGAAGGG - Intergenic
1192584705 X:72309733-72309755 CCCCGCTGCCTAGGAGGGTAAGG + Intergenic
1197077915 X:122375353-122375375 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1198344685 X:135747847-135747869 CTCAGCTGCCAGGCAGGGAAGGG - Intergenic
1198998642 X:142606464-142606486 CTCGGCTGCCAGGCAGGGAAGGG - Intergenic
1199316047 X:146379420-146379442 CCCCACTGCCTTGAAGGGAAGGG + Intergenic
1199607106 X:149586128-149586150 CCCTGATGCCTGGCAGAGCCTGG + Intronic
1199632016 X:149783240-149783262 CCCTGATGCCTGGCAGAGCCTGG - Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1199874873 X:151921538-151921560 CCCCGATGCCAGGCAGAGCCTGG - Intronic
1199991551 X:152990209-152990231 CCCTGCTGCCTGCCAGGGGAAGG + Exonic
1200164867 X:154029047-154029069 CGCGGCTGCCTGGAAGAGAAGGG + Intronic
1200746461 Y:6908420-6908442 CACTGCTGCCTGGGAGACAAAGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic