ID: 900547882

View in Genome Browser
Species Human (GRCh38)
Location 1:3238630-3238652
Sequence GCTCCCGCAAGAACCGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900547882_900547891 22 Left 900547882 1:3238630-3238652 CCTTTCACGGTTCTTGCGGGAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 900547891 1:3238675-3238697 TTTGCTGGAGCCCACACGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 142
900547882_900547890 18 Left 900547882 1:3238630-3238652 CCTTTCACGGTTCTTGCGGGAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 900547890 1:3238671-3238693 CAGCTTTGCTGGAGCCCACACGG 0: 1
1: 0
2: 2
3: 34
4: 338
900547882_900547893 26 Left 900547882 1:3238630-3238652 CCTTTCACGGTTCTTGCGGGAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 900547893 1:3238679-3238701 CTGGAGCCCACACGGCCGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 118
900547882_900547892 25 Left 900547882 1:3238630-3238652 CCTTTCACGGTTCTTGCGGGAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 900547892 1:3238678-3238700 GCTGGAGCCCACACGGCCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 156
900547882_900547886 7 Left 900547882 1:3238630-3238652 CCTTTCACGGTTCTTGCGGGAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 900547886 1:3238660-3238682 GGGAAGCCGCCCAGCTTTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900547882 Original CRISPR GCTCCCGCAAGAACCGTGAA AGG (reversed) Intronic
900547882 1:3238630-3238652 GCTCCCGCAAGAACCGTGAAAGG - Intronic
904456141 1:30649382-30649404 GCTCCCACAGGAGCCGTGATGGG + Intergenic
917380310 1:174399220-174399242 GCTACCCCAAGGACAGTGAAAGG - Intronic
1077180128 11:1208554-1208576 GCCCCTGCAAGAACTGGGAAAGG - Intergenic
1086931563 11:92699053-92699075 ACTCCCCAAAGAACCCTGAATGG + Intronic
1090422611 11:126585857-126585879 GCTCCCGCACGGAACGTGATTGG + Intronic
1097473511 12:60024829-60024851 CCTCCTGCAAGAACCATGAGAGG - Intergenic
1098567176 12:71950027-71950049 GATTCAGCAAGAACGGTGAAAGG + Intronic
1102858881 12:116318424-116318446 GCTTCAGCAGGAACAGTGAAAGG - Intergenic
1107840352 13:44450991-44451013 GCACTTGCAAGAACCTTGAATGG + Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1124214579 15:27796095-27796117 GGTCCTGCTAGAACCGTGGATGG - Intronic
1126249133 15:46545853-46545875 TCTCCTGCCAGAACCATGAAGGG + Intergenic
1141702448 16:85648704-85648726 GCTCCAACCAAAACCGTGAATGG + Exonic
1151892131 17:76957035-76957057 GCTCTCGCGAGGACCGTGACGGG - Intergenic
1151980684 17:77506692-77506714 GCTCCCCCGAGAGCCCTGAAGGG + Intergenic
1155957592 18:31966837-31966859 GCTGGAGCAAGAACCCTGAACGG - Intergenic
1160369770 18:78362390-78362412 GCTCCCGCCCGAACCCTGAGCGG - Intergenic
1162806523 19:13140368-13140390 GCTCCAGCCAGACCCCTGAAAGG + Exonic
933711068 2:85326661-85326683 CCTCCAGTGAGAACCGTGAAGGG - Exonic
934573767 2:95387935-95387957 GCTGACGCAAGAAGCATGAAGGG - Intergenic
937350870 2:121160389-121160411 GCTCCCCTAAGAAAAGTGAATGG - Intergenic
944405645 2:199380564-199380586 GCTCCCACAAGACCCAAGAATGG - Intronic
1169278003 20:4246488-4246510 GCTCCAGCAAGAAACCAGAAAGG + Intronic
1177613454 21:23485606-23485628 GTTCTCTCAAGAACTGTGAAAGG + Intergenic
1180067101 21:45418002-45418024 GCTGCCGCAGGAACCGAGAAGGG + Intronic
1180084057 21:45499612-45499634 GCTCCCGCAGGAACCGGCACAGG + Intronic
954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG + Intronic
954955902 3:54518040-54518062 GCTCCCATAAGTATCGTGAATGG + Intronic
976004029 4:80406819-80406841 GCTCCCACAACAACCTTGAAGGG + Intronic
978869361 4:113556691-113556713 GCTCCCCAAAGACCCCTGAAGGG + Intronic
985399392 4:189579464-189579486 GTTCCCACAACAGCCGTGAAAGG - Intergenic
989379277 5:40797923-40797945 GCTCCCGCAGGATCCGGGACAGG + Intronic
999080636 5:148840203-148840225 GCTGGCACAAGGACCGTGAAAGG - Intergenic
1002460153 5:179369307-179369329 ACTCCCGCAAGACCAGTGCAGGG + Intergenic
1035066076 7:156105877-156105899 GCTCGCGCATGAACCCTGATTGG - Intergenic
1045357796 8:101404811-101404833 GCTTCCCCAAGAAAGGTGAAGGG - Intergenic
1046648038 8:116806804-116806826 GCTCCCGCCAGCTCCGTGCAAGG - Intronic
1059043781 9:110842480-110842502 GCCCCTGAAAGAACCGTGTATGG - Intergenic
1059441790 9:114311699-114311721 CCTCCCTCCAGGACCGTGAAGGG - Exonic
1197526973 X:127575997-127576019 GCTCCTGCAAGCAGCATGAAGGG - Intergenic