ID: 900549436

View in Genome Browser
Species Human (GRCh38)
Location 1:3246750-3246772
Sequence CAGTCTGAGCCCTGGGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 271}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549436_900549455 28 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549455 1:3246801-3246823 CTCGGGGAGCCGGGGGGGTTGGG 0: 1
1: 0
2: 1
3: 26
4: 223
900549436_900549450 20 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549450 1:3246793-3246815 TAGGCACTCTCGGGGAGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
900549436_900549447 12 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549447 1:3246785-3246807 TACATTTCTAGGCACTCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 148
900549436_900549449 19 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549449 1:3246792-3246814 CTAGGCACTCTCGGGGAGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 122
900549436_900549445 10 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549445 1:3246783-3246805 GTTACATTTCTAGGCACTCTCGG 0: 1
1: 0
2: 0
3: 4
4: 119
900549436_900549452 22 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549452 1:3246795-3246817 GGCACTCTCGGGGAGCCGGGGGG 0: 1
1: 0
2: 1
3: 29
4: 119
900549436_900549448 18 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549448 1:3246791-3246813 TCTAGGCACTCTCGGGGAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 74
900549436_900549453 23 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549453 1:3246796-3246818 GCACTCTCGGGGAGCCGGGGGGG 0: 1
1: 1
2: 1
3: 22
4: 203
900549436_900549456 29 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549456 1:3246802-3246824 TCGGGGAGCCGGGGGGGTTGGGG 0: 1
1: 0
2: 1
3: 40
4: 416
900549436_900549454 27 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549454 1:3246800-3246822 TCTCGGGGAGCCGGGGGGGTTGG 0: 1
1: 0
2: 2
3: 25
4: 303
900549436_900549442 1 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549442 1:3246774-3246796 ACCCGTTCAGTTACATTTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 100
900549436_900549446 11 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549446 1:3246784-3246806 TTACATTTCTAGGCACTCTCGGG 0: 1
1: 0
2: 2
3: 55
4: 396
900549436_900549451 21 Left 900549436 1:3246750-3246772 CCCTAACCCCAGGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 271
Right 900549451 1:3246794-3246816 AGGCACTCTCGGGGAGCCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900549436 Original CRISPR CAGTCTGAGCCCTGGGGTTA GGG (reversed) Intronic
900535355 1:3174347-3174369 CATTCTGAGGCCTGGGGGTTAGG + Intronic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
900557563 1:3287987-3288009 CAGGCAGAGCCCTGGGCTCAGGG + Intronic
900641910 1:3691598-3691620 CAGCCTGAGCCCTGGGGACCTGG + Intronic
900746019 1:4361294-4361316 CGGAATGAGCCCTGGGGTTCTGG + Intergenic
901510238 1:9714790-9714812 GAGTGTGTGCCCTGGGGTGACGG - Intronic
902096474 1:13950067-13950089 CAGGCTCAGCCCTGGGGTGTGGG - Intergenic
902857524 1:19219723-19219745 CAGTCTGAGCACTGCTGTAAAGG + Intronic
904553642 1:31342730-31342752 CAGTCTGTGGCCTGGGGGTTAGG + Intronic
904643976 1:31952117-31952139 CAGTCTCAACCCTGAAGTTAAGG - Intergenic
905244688 1:36604421-36604443 CAGCCTCAGCCCTGGTGTTCTGG + Intergenic
906051562 1:42878899-42878921 CAGTCTGGGACCTGGGCTGATGG - Intergenic
906086860 1:43143684-43143706 CAGTCTCAGCCCTACGTTTATGG + Intergenic
906664681 1:47612067-47612089 CAGTCTGTGGCCGGGGGTTGGGG - Intergenic
906723073 1:48023309-48023331 CAGGCTGAGCCCAGAGGGTAGGG - Intergenic
906820904 1:48928980-48929002 CATTCTGAACCCTGGGATTTTGG + Intronic
907300990 1:53486135-53486157 CACTCTGGGCTCTGGGGCTAGGG + Intergenic
910182715 1:84503757-84503779 CAGCCAGAGCCCTGTTGTTATGG + Intronic
912063951 1:105712240-105712262 CAGTCTGTGGCCTGGGGGTTGGG - Intergenic
912312070 1:108632882-108632904 CAGGCTGAGCCCGGGGTTGAAGG - Intronic
912314660 1:108656924-108656946 CTGTCTGAGCCCTGTGTTTCTGG + Intronic
912876837 1:113368548-113368570 CATTCTCAGCCCATGGGTTAGGG + Intergenic
913557868 1:119987020-119987042 CATTCTGACACCTGTGGTTAGGG + Exonic
915348701 1:155211553-155211575 CAGGCTGAGACCTGGGGGTATGG + Intronic
915351893 1:155232179-155232201 CAGGCTGAGACCTGGGGGTATGG + Intergenic
917348132 1:174049946-174049968 CAGTCTGTGGCCTGGGGGTTGGG - Intergenic
917364019 1:174209243-174209265 CAGTCTGTGGCCTGGGGGTTGGG + Intronic
918523950 1:185444828-185444850 CTGTCTGCGGCCTGGGGTTTGGG - Intergenic
921456413 1:215377283-215377305 CAGTCTGATACCTGGCTTTAGGG - Intergenic
921925810 1:220709436-220709458 CAGTCAGATCCCTCAGGTTAAGG - Intergenic
922872283 1:228912610-228912632 CAGTCTGGTCCCTGGTGTTGTGG + Intergenic
923096206 1:230777312-230777334 CAGGCTCAGCCCTGGTGTTGGGG - Intronic
923688400 1:236170128-236170150 CAGTGTGAGTCCAGGGGTTCTGG + Intronic
924596826 1:245453498-245453520 TAGTCCCAGCCCTGGGGTAAAGG + Intronic
1063458193 10:6199938-6199960 CACTCAGCACCCTGGGGTTAGGG + Intronic
1064449801 10:15431607-15431629 CAGTCTGTGGCCTGGGGTTTGGG - Intergenic
1066011214 10:31195281-31195303 GTGTCTGAGCCATGGAGTTAAGG + Intergenic
1067052212 10:43028272-43028294 GGCTCTGAGCCCTGGGGTTGTGG - Intergenic
1067077885 10:43198353-43198375 CTGGCTGAGCCCTGGGGCCAGGG + Intronic
1067082140 10:43217854-43217876 CAGTCTGAGAGCTGGGATTTGGG - Intronic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1068374985 10:56166062-56166084 CAGTCTGTGGCCAGGGGTTGGGG + Intergenic
1070569857 10:77632604-77632626 CAGACTGAGACATGGGCTTATGG - Intronic
1071714031 10:88077074-88077096 GACTCTTAGCCCTGGGGTCATGG + Intergenic
1072121844 10:92411638-92411660 CACTCTCAGCCCTGTGGTCACGG + Intergenic
1072298741 10:94038481-94038503 GGGACTGAGCCTTGGGGTTAGGG - Intronic
1072343327 10:94477774-94477796 CAATCTGGGGCCTGGGGTTTGGG - Intronic
1073746856 10:106479128-106479150 TAGTCTGTGGCCTGGGGTTTGGG - Intergenic
1074422600 10:113322610-113322632 TGGTCTGAGCCCTGGGCTCATGG + Intergenic
1074435825 10:113433345-113433367 AATTCTGGGCCCTGTGGTTATGG + Intergenic
1074687591 10:115974696-115974718 CAGTGGGAGGCCTGGGGTTCTGG + Intergenic
1075344643 10:121673295-121673317 CAGTCTGAGGCCTGTGGGGATGG - Intergenic
1075495319 10:122914714-122914736 TAATCTGAGCCCTGGGGTGGAGG + Intergenic
1076450502 10:130554047-130554069 CAGTCTGTGGCCTGGGGGTTAGG + Intergenic
1078907849 11:15704175-15704197 CAGCCTGAGCCATGGGCCTAAGG + Intergenic
1080770950 11:35340875-35340897 CAGTGTGCCCCCTGGGATTATGG + Intronic
1081758092 11:45558939-45558961 CAGCCTGAACCCTGGGGTCTGGG - Intergenic
1083431896 11:62617547-62617569 CAGCCTGAGCTCTGGAGTTGAGG - Intronic
1083633197 11:64106186-64106208 GAGTCTGAGGCCTGGGTTTGTGG + Intronic
1083716647 11:64581316-64581338 CAGTGTGGGGCCTGCGGTTAGGG + Intergenic
1084377445 11:68787493-68787515 CAGCCTGTGCCCTGGGGTATAGG - Intronic
1085018989 11:73193239-73193261 GAGTGAGAACCCTGGGGTTAGGG + Intergenic
1085390992 11:76182106-76182128 CAGGCAGAGCCCTGGGGCTTTGG - Intergenic
1086120944 11:83304054-83304076 CACTCTGAGGCCTGGGGAGATGG + Intergenic
1092844380 12:12570515-12570537 CAGTCTGACACCTGAGGTCAGGG + Intergenic
1093717095 12:22395308-22395330 CAGGCTGAGCCTTGAGGATAAGG - Intronic
1094747611 12:33363859-33363881 CAGTCTGTACCCTGGGGGTTGGG - Intergenic
1095945443 12:47751004-47751026 CTGTGTGAGGCCTGGGGTCACGG + Intronic
1096364080 12:51013653-51013675 CTGCTTGAGCCCTGGGGTCAAGG + Intronic
1096566535 12:52486841-52486863 TAGGCTGAGCCCTGGCGTAAGGG + Intergenic
1097094000 12:56530904-56530926 CATGCTAGGCCCTGGGGTTAAGG + Intronic
1098864419 12:75745763-75745785 GAGTCTAAGCTCTGGGGGTATGG - Intergenic
1099444406 12:82735065-82735087 GAGTCTCAGCCCTGTGGTTTAGG - Intronic
1101512803 12:105407809-105407831 CAGTCTGTGGCCTGGGGTTTAGG - Intergenic
1101741347 12:107502592-107502614 CAGTCTGTGGGCTGGGGTTTGGG - Intronic
1103732185 12:123035125-123035147 CAGTCTGAGCCATGCCATTAGGG + Intronic
1104039735 12:125122001-125122023 CTGTCAGAGACCTGGGGTCAGGG + Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1105786733 13:23757398-23757420 CAGTCTGTGGCCTGGGGGTTGGG + Intronic
1108826139 13:54415110-54415132 CAGTCTCAGGCCTGGTGTTTGGG - Intergenic
1110781024 13:79464971-79464993 CAGTCCGCGGCCTGGGGTTTGGG + Intergenic
1112464149 13:99629080-99629102 CAGAGAGAGCCCTGGGGTTGGGG + Intronic
1112770913 13:102794016-102794038 CAGCCTGAGCCCAGGAGTTCGGG + Intronic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1116984681 14:51206097-51206119 CAGTCAGATCCCTCAGGTTAAGG + Intergenic
1117057881 14:51931591-51931613 CACTCTGAGACCTGGGGATCAGG + Intronic
1117827047 14:59714785-59714807 CAGTCTGCGGCCAGGGGTTTGGG - Intronic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122626497 14:103087879-103087901 CAGTCCCAACCCTGGGGGTAGGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124350054 15:28948715-28948737 CAGTCTGTGCCCTGCGGTTGTGG + Intronic
1124624371 15:31299709-31299731 CAGCCTGCACCCTGGGGTGACGG - Intergenic
1125144086 15:36445957-36445979 CAGTCTGAGCTCTAGGTTTCAGG - Intergenic
1125333598 15:38606016-38606038 CAGTCTGAGGACTGGGGTCCCGG - Intergenic
1125715134 15:41815402-41815424 CAGTGTGAGCCCTGAGGCTGTGG + Exonic
1127063529 15:55213471-55213493 CAGTCTGTGGCCTGGGGATTGGG - Intronic
1127234629 15:57035809-57035831 CAGTCTGTGCCCAGGGGTTTGGG - Intronic
1127998342 15:64168704-64168726 CAGCCAGATCCTTGGGGTTAGGG - Exonic
1128922852 15:71628108-71628130 CAGTCAGAGTCCTGTGGGTAAGG + Intronic
1129695433 15:77738304-77738326 CAGTCTGTACCATGGGCTTATGG - Intronic
1132863902 16:2084446-2084468 CCGGCTGAGCCCTGAGGTTAAGG + Exonic
1133441329 16:5823494-5823516 CAGTCCGTGGCCTGGGGTTTGGG - Intergenic
1135526885 16:23219984-23220006 CTGCCTGAGCCCAGGAGTTAGGG + Intergenic
1136173800 16:28504040-28504062 CAGGCTGAGCCCTGGAGAGATGG + Exonic
1136497176 16:30651584-30651606 CAGGCTGCGGCCTGGGGTAAGGG - Exonic
1136590288 16:31214412-31214434 GAGGCTGAGGCCTGGGGCTAAGG + Intronic
1138446903 16:57070354-57070376 GAGCCTGAGCCCTGGAGCTAGGG + Intronic
1138529489 16:57627342-57627364 CAGGCTGAGGCCTGGGGTGCTGG + Intronic
1138599336 16:58045784-58045806 CAGTTACAGCCCTGGGGTTCAGG - Exonic
1139243737 16:65420297-65420319 CAGTCTGAGCCCTATGGCCAAGG + Intergenic
1139576658 16:67846606-67846628 CAGTCTGTGCACTGGGGTGGGGG - Intronic
1142132033 16:88435558-88435580 CACTCTGGGACCTGGGGTGATGG + Exonic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1143455375 17:7064368-7064390 CCGTGTGAGCCCTGGGGTTGTGG + Intergenic
1143538981 17:7558466-7558488 CTGGCTGAGTTCTGGGGTTAAGG - Intronic
1143701887 17:8666688-8666710 AAGTCTGGGCACTTGGGTTAGGG - Intergenic
1146312573 17:31780458-31780480 CAGCCTGGGCCCCTGGGTTAAGG + Intergenic
1146471045 17:33125131-33125153 CAGTCTGTGGCCTGGGGGTTGGG + Intronic
1148496052 17:48054245-48054267 CAGTGAGAGCCCTGGGGGAAGGG - Intronic
1148781599 17:50125212-50125234 CAGGCTGAGCCCTGTGGTCCTGG + Intronic
1149542159 17:57475668-57475690 CACCCTGAGACATGGGGTTACGG - Intronic
1149710924 17:58741446-58741468 CAGTCCGTGCCCTGGGGGTTGGG - Intergenic
1150882258 17:69043386-69043408 CAGTCTGTGGCCTGGGGCTTGGG + Intronic
1151034206 17:70779568-70779590 CAGCCTGAGTCCTGGGGGTTGGG - Intergenic
1151816578 17:76474222-76474244 GAGACTGAGCCCTGGGGAGATGG - Intronic
1152305729 17:79519254-79519276 GAGTGTGAGCCCTGGGGGTGGGG - Intergenic
1153395665 18:4617708-4617730 CAGTCTGTGGCCTGGGGGTTGGG - Intergenic
1155175013 18:23294207-23294229 CAGTCAGAGCCTTGGGATTTGGG - Intronic
1156532788 18:37834477-37834499 CACTCTGTGACCTGGGGTTTGGG + Intergenic
1160284097 18:77523217-77523239 CAGGCTGAGCCATGGGGCTGGGG + Intergenic
1161238186 19:3208204-3208226 CAGTGCCAGCCCTGGGGTTCTGG + Exonic
1162376945 19:10310436-10310458 CAATCTGGGCCCTGGGGCCATGG + Exonic
1163592623 19:18203019-18203041 CGGGCTCAGCCCTGGGTTTAGGG - Intronic
1164291655 19:23874848-23874870 CAGTCTGTGCTCTGGTGTTGAGG + Intergenic
1164301882 19:23969907-23969929 CAGTCTGTGCCCTGGTGTTGAGG + Intergenic
1165282216 19:34807208-34807230 CAGTCTAGGCCCTGGTGTTTAGG - Intergenic
1168627628 19:57931687-57931709 AAGGCTGAGGCCTGGGGCTAAGG - Intronic
928513269 2:32021355-32021377 CATTCTGATACCTGTGGTTAAGG - Intronic
928994369 2:37271511-37271533 CAGTCTGTGGCCTGGGGCTTGGG - Intronic
929762023 2:44814757-44814779 CAGCCTCAGCCCTGGTGTTTGGG - Intergenic
929929135 2:46238606-46238628 GATTGTGAGCCCTGGGGTCAGGG - Intergenic
930270933 2:49255821-49255843 CAGTCAGAGCCCTGTGCTAAAGG - Intergenic
931444696 2:62316776-62316798 GAGCCTGAGCCCTGTGGTTGAGG - Intergenic
933817597 2:86080668-86080690 TAGTGTGAGCTCTGGGCTTAGGG - Intronic
937292027 2:120787546-120787568 CAGGCTGAGGGCTGGGGTGAAGG - Intronic
937393869 2:121517633-121517655 CAGCTTGAGCCCAGGGGTTTGGG + Intronic
938288675 2:130138186-130138208 CAGCCTGTGCCCTGGACTTAGGG - Intergenic
938467858 2:131534746-131534768 CAGCCTGTGCCCTGGACTTAGGG + Intergenic
941936525 2:170985673-170985695 CAGTCTGTGGCTTGGGGTTTGGG + Intergenic
943651004 2:190457412-190457434 AAGTCTGAGTCCTGGGGGTAGGG - Intronic
944756576 2:202768426-202768448 CAGACAGATCCCTGGGGTTTGGG + Exonic
946639312 2:221766324-221766346 CAAGCTGAGTCCTGGGGTCACGG + Intergenic
948394945 2:237638485-237638507 CAGTCTGTGCCCCAGGGGTAGGG + Intronic
1170233809 20:14079846-14079868 CAGTCTGAGACCTAGGGATTGGG - Intronic
1170491979 20:16886500-16886522 GAGTCAGAGCCCTAGGGTCATGG + Intergenic
1170742002 20:19066387-19066409 TAGTCTATGCCCTGGGGTTTGGG - Intergenic
1172165509 20:32896624-32896646 CAGTCTTAGCCCTTGGGGTTTGG + Intronic
1172526056 20:35601177-35601199 CAGCCTGAGCCCTGGGGGCGGGG + Intergenic
1172943127 20:38668104-38668126 AAGTCTGAGCTCCGGGGTGATGG + Intergenic
1175919568 20:62444368-62444390 CAGCCTGAGACCTGTGGTCATGG - Intergenic
1176129033 20:63488474-63488496 CGGCCAGAGCCCTGGGGTTGGGG - Intronic
1176369554 21:6054076-6054098 CACTCTGGGCCCTGGGTTTCAGG - Intergenic
1177274055 21:18884015-18884037 CAGTCCTTGGCCTGGGGTTAGGG + Intergenic
1178669529 21:34578604-34578626 CACTCTGGGCCCTGGGGGAATGG + Intronic
1179753965 21:43484465-43484487 CACTCTGGGCCCTGGGTTTCAGG + Intergenic
1179910393 21:44444363-44444385 CTGTCTGTGCCCTGGGGATGGGG + Intergenic
1180634682 22:17254904-17254926 CAGTCCTAGCCTTGGAGTTATGG + Intergenic
1180652988 22:17394285-17394307 CTGTTTGAGCCCAGGGTTTAAGG - Intronic
1181624100 22:24111289-24111311 CAGTCTGTGACCTGGGGGTTGGG - Intronic
1181637426 22:24180947-24180969 CAGGCTGAGCCCTGGGGCGGAGG - Intergenic
1182078018 22:27508254-27508276 TATTCTTAGCCCTGGGGTTGGGG - Intergenic
1182756264 22:32682119-32682141 CATTCTGACCCCAGGGGATATGG + Intronic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183415840 22:37681400-37681422 GAGACTGTGCCTTGGGGTTATGG - Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183980076 22:41534185-41534207 CAGTCTGGGCACTGGGCTCACGG + Intronic
1184834708 22:47014372-47014394 CAGACTGAGGCCTGCGGCTATGG - Intronic
1184868782 22:47219922-47219944 CACACTGAGGCCAGGGGTTAGGG + Intergenic
949924765 3:9032422-9032444 AATTCTCAGCCCTGGGGGTAGGG - Intronic
949953427 3:9248203-9248225 CACTCTGTGCCCTGGCGTTTAGG - Intronic
950453807 3:13080582-13080604 CAGACAGAGCCCTGGGGACATGG + Intergenic
951534780 3:23730637-23730659 CAGGCTGAGCCATGAGGTCAAGG + Intergenic
952406050 3:33006173-33006195 CAGTCTGTGGCCTGGGGTTTGGG - Intronic
952823593 3:37506355-37506377 AAGACTGAGCCCTGGCCTTATGG + Intronic
953296723 3:41725788-41725810 TACTCTGAGGCCTAGGGTTACGG + Intronic
954035125 3:47847227-47847249 CAGTCACAGCCCCGGGGTAAGGG - Intronic
956104366 3:65801816-65801838 CAGTCTGTGGCCCGGGGTTTGGG - Intronic
956601656 3:71029075-71029097 CAGTCTGTGAACTGGGGTTTGGG + Intronic
956648079 3:71476495-71476517 CAGAATGAGTCCTCGGGTTATGG + Intronic
959045002 3:101464306-101464328 CAGTCCATGGCCTGGGGTTAGGG - Intronic
959565151 3:107826079-107826101 CAGTTTGAGGCCTGGGATCACGG + Intergenic
961155531 3:124676384-124676406 AACTCTGACCCCTGTGGTTATGG - Intronic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
966223010 3:177569210-177569232 GAGTCTGAGCACTGGGGGAAAGG - Intergenic
968489344 4:881744-881766 ATGGCTGAGCCCTGGGCTTACGG - Intronic
968745674 4:2358748-2358770 CATTCTGAGTCCTGGGGGTTAGG - Intronic
970057145 4:11988068-11988090 CTGTGGGAGCCTTGGGGTTAAGG + Intergenic
970900445 4:21152651-21152673 CAGTCTGTGGCCTGGGGATTGGG - Intronic
971166857 4:24192387-24192409 AAGTCTTAGCACTGGGGGTAAGG - Intergenic
972564266 4:40256224-40256246 CAGTTTGAGGCCTGGATTTATGG - Intergenic
973140742 4:46765596-46765618 CAGTCTGGAACCTGGGGTCATGG - Intronic
973291256 4:48473088-48473110 AACTCTGAGGCCTGGGTTTAGGG + Intergenic
977301593 4:95273839-95273861 CAGTCTGAACCCTGAGGGCAAGG - Intronic
978213640 4:106170069-106170091 CAGTCTGTGGCCTGGGGGTTGGG + Intronic
979566299 4:122157650-122157672 CAGTCTGCGGCCTGGGGGTTGGG + Intronic
980304458 4:131039628-131039650 GAATCAGAGCCCTGGGATTACGG + Intergenic
981470604 4:145130317-145130339 CAGACTAGGCACTGGGGTTAAGG - Intronic
982079857 4:151778723-151778745 CAGTCTGCGGCCTGGGGGTTGGG - Intergenic
984817763 4:183853817-183853839 CAGTCTGGGTCCTGGGTTTCTGG - Intronic
985143974 4:186874380-186874402 CAGGCTGAGCCTTGGGCTTGAGG - Intergenic
987081419 5:14428550-14428572 CAGTCTGAGACCTGTGATTAAGG + Intronic
988144684 5:27291216-27291238 CAGTCTGTGGCCTGGGGTTTGGG - Intergenic
988304885 5:29481268-29481290 CCTTCTCAGCCCTGGGGATATGG - Intergenic
989187738 5:38641424-38641446 TAGTCTTAGTCCTGGGGTGAGGG + Intergenic
990236316 5:53771682-53771704 CAGCCTGAAGCCTGGGGATATGG - Intergenic
990650870 5:57898127-57898149 CAGTCTGCGCCATGGGATTTGGG + Intergenic
991929466 5:71738207-71738229 CAGCCTGAGCAGTGGGGTTTGGG - Intergenic
992064403 5:73092371-73092393 CAGTCTGTGGTCTGGGGTTGGGG + Intergenic
992151181 5:73905041-73905063 CACTCTGCACCCTGGGGTTTGGG - Intronic
994246941 5:97489091-97489113 CAGTCTGAAGCCTGGGGTTCAGG - Intergenic
995185478 5:109266975-109266997 CAGTCTGAAGCCTGGGGCCATGG - Intergenic
996655741 5:125933769-125933791 CAGACTGAACCCTGGTGTTTTGG + Intergenic
997362429 5:133303606-133303628 CAAGCTGTGTCCTGGGGTTAGGG - Intronic
997400670 5:133599363-133599385 TAGGCTGACCCCTGAGGTTAGGG + Intronic
998017452 5:138743772-138743794 CAGTCTGTTGCCTGGGGTTTGGG + Intronic
998026131 5:138818332-138818354 CAGTGTGAGCCCAGGAGTTCGGG - Intronic
998456618 5:142278741-142278763 CAGTCTGAGCCCATGGGCTGGGG - Intergenic
999237735 5:150109115-150109137 CAGGCTGAGCCCTGGGGTCAGGG - Intronic
999512812 5:152270570-152270592 CAGTCTGTGGCCTGGGGTTTGGG - Intergenic
1000326346 5:160175513-160175535 CAGTCTGCTCCCTGGGGTGCAGG + Intergenic
1001106567 5:168859512-168859534 CATTCTGAAGCCTGGGCTTATGG - Intronic
1001644241 5:173268529-173268551 AAGTCAGAAACCTGGGGTTATGG + Intergenic
1002298703 5:178245825-178245847 CAGTCCCAGCCCTGGGGAAAGGG + Intronic
1002443062 5:179274229-179274251 CAGTGTGAGACCTTGGTTTATGG - Intronic
1003092273 6:3114269-3114291 CAGTATCAGCCCTGAGGTTCTGG - Exonic
1004893807 6:20127390-20127412 CAGTCTGAGCCCCAGGGGTTGGG - Intronic
1005527635 6:26666707-26666729 TAGTCTGCGCCCTGGGGTTTGGG + Intergenic
1006725963 6:36199106-36199128 CAGTCTGCGGCCTGGGGGTTGGG - Intronic
1007426569 6:41749861-41749883 CAATCAGAGCCCTGGGATAACGG - Intronic
1007472368 6:42099269-42099291 GAGTCTGAGCCCTGCTGTTGGGG - Intergenic
1007597552 6:43060658-43060680 CAGTCTGAGTCCTGGGGGGTGGG + Intronic
1007778031 6:44234599-44234621 CAGGCTGAGCTTTGGTGTTAAGG - Intergenic
1009630216 6:66188557-66188579 CAGTCTGTGGCCTGGGGGTTGGG + Intergenic
1010293457 6:74167388-74167410 TTGGCTGAGGCCTGGGGTTATGG - Intergenic
1010765446 6:79773438-79773460 AAGTCTCAGCCCTGGTTTTAAGG - Intergenic
1011280215 6:85669961-85669983 CAATCTGGGCCCTAGGGGTAGGG + Intergenic
1012281763 6:97336082-97336104 CAGTCTGCAGCCTGGGGTTTAGG + Intergenic
1013944439 6:115704812-115704834 CAGTCTGGAGCCTGGGGTTGTGG + Intergenic
1014171116 6:118280285-118280307 CAGTATGACCCGTGGGGTAAAGG - Intronic
1015385964 6:132623870-132623892 AAATCTGAGCCCTTGAGTTATGG + Intronic
1015568626 6:134599434-134599456 CAGTCTGAGCCCAGGGTAAAGGG - Intergenic
1017827113 6:158089832-158089854 CAGTCCGAGCCTTGGGCTTGAGG - Exonic
1018031523 6:159845339-159845361 CACTCTCAGCCCTGGGCTTATGG + Intergenic
1018737104 6:166695528-166695550 CAGTCTGAGGCCTGAGGATTGGG - Intronic
1018950181 6:168374015-168374037 CAGTTTAAGCCCTGGGATTTGGG - Intergenic
1020073707 7:5243784-5243806 CAGTCTGACCCCTGGAGTCAGGG - Intergenic
1021710260 7:23409215-23409237 CAGTCTGAGGCCTGGGGGTTAGG + Intronic
1022494948 7:30846997-30847019 CAGTCTGTGGCCTGGGGGTTGGG + Intronic
1023277532 7:38535902-38535924 CAGTCTGAGGCCCAGGGTTTGGG + Intronic
1024716076 7:52080556-52080578 CTTTCTGAGTCCTGGCGTTAGGG + Intergenic
1030342612 7:108397784-108397806 CAGTGTGAACCCTGAAGTTAAGG - Intronic
1031045211 7:116879731-116879753 CTGTCTGTGGCCTGGGGTTTGGG + Intronic
1031849267 7:126844357-126844379 GTGTCTGAGCCATGGGGTGAGGG + Intronic
1033542476 7:142369624-142369646 CAGTCTGTGCATTTGGGTTAGGG - Intergenic
1035692164 8:1567362-1567384 CAGCCTCAGTCCTGGGGTTTTGG + Intronic
1036552492 8:9827445-9827467 CAGCTTGAGACCTGGGGTTGAGG + Intergenic
1037231507 8:16664335-16664357 AAGACTGAGCCCTGGGGCTCTGG + Intergenic
1037521492 8:19684514-19684536 AACTGAGAGCCCTGGGGTTATGG - Intronic
1037742471 8:21618525-21618547 CAGTCTGTGGCCTGGGGGTTGGG - Intergenic
1039903058 8:41766960-41766982 CAGGCTGTCCCCTGGGGTGAGGG + Intronic
1040470428 8:47731739-47731761 TTGTCTGAGTCCTGGGGGTAGGG + Intronic
1040683745 8:49845020-49845042 AAGTCTGAGCATTGGGGTGATGG - Intergenic
1040880895 8:52203200-52203222 CACTTTGAGCCCTGGTGTCATGG - Intronic
1041712464 8:60906911-60906933 CAGTCTGTGGCCTGGGGGTTAGG + Intergenic
1042315691 8:67423821-67423843 CAGTCTGTGGCCTGGGGGTTGGG - Intronic
1043098003 8:75999982-76000004 CAGTCTGTGGCCTGGGGTTGGGG + Intergenic
1044540009 8:93398262-93398284 CAGCCTGAGCCTGAGGGTTATGG + Intergenic
1044557124 8:93575119-93575141 CAGTCTGTGGCCTGGGGGTTGGG + Intergenic
1045117012 8:98993470-98993492 AAGTCTGTGCATTGGGGTTAAGG + Intergenic
1048281482 8:133108762-133108784 CATACTGAGCACTGGGGCTATGG + Intronic
1048575662 8:135687982-135688004 CAGTCTGAGGGCTGGATTTAGGG - Intergenic
1048779383 8:137985064-137985086 CAGTCTGTGGCCTGGGGTTTCGG - Intergenic
1049005723 8:139854447-139854469 GTGTCTGTGCCCTGGGGTCAGGG + Intronic
1051641647 9:19230152-19230174 CAGTCTGAGCCCTGCAGGAAGGG + Intergenic
1051767989 9:20545388-20545410 CTGCCTGAGGCCTGGGGTGAAGG + Intronic
1056311034 9:85341147-85341169 CAGTGTGAGCCCTGGGGTGGAGG + Intergenic
1057572245 9:96213639-96213661 CCGTCTTCGCCCTGGGGTTTGGG - Intergenic
1058767746 9:108198437-108198459 AACTGTGAGGCCTGGGGTTAGGG - Intergenic
1060468360 9:123928129-123928151 AATTCTGAGCACTTGGGTTAGGG - Intronic
1061238925 9:129358034-129358056 CAGCCAGAGCCCTGGGGTGGGGG + Intergenic
1061467534 9:130793693-130793715 CAGTCTGTGGCCTGGGGATTGGG - Intronic
1062217341 9:135396337-135396359 CTGTCTGTGGCCTGGGGTTTGGG - Intergenic
1062329120 9:136029096-136029118 CAGCCTGGGCCCTGGGCTTCAGG - Intronic
1185705268 X:2262117-2262139 CAGCCTCAGGCCTGGAGTTAGGG + Intronic
1185971508 X:4670654-4670676 CAGTCTGTGGCCTGGGGGTTGGG - Intergenic
1192152965 X:68723543-68723565 CAGTTTGAGGCCTGGACTTAGGG + Intronic
1198531267 X:137550967-137550989 CAGGATGAGCCCTGCGGTTCTGG + Intergenic