ID: 900549635

View in Genome Browser
Species Human (GRCh38)
Location 1:3247784-3247806
Sequence TGTGACTTTTTGGGAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549635_900549644 19 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549644 1:3247826-3247848 CGTCGCGCCTTTCCTGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 45
900549635_900549643 13 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549635_900549641 -8 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549641 1:3247799-3247821 AAGTCACATTGGCTGTGGGTCGG 0: 1
1: 0
2: 2
3: 13
4: 222
900549635_900549642 -7 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549642 1:3247800-3247822 AGTCACATTGGCTGTGGGTCGGG 0: 1
1: 0
2: 1
3: 18
4: 159
900549635_900549646 25 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549646 1:3247832-3247854 GCCTTTCCTGGCCGCGGTGCGGG 0: 1
1: 0
2: 2
3: 13
4: 129
900549635_900549645 24 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549645 1:3247831-3247853 CGCCTTTCCTGGCCGCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 94
900549635_900549648 26 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549648 1:3247833-3247855 CCTTTCCTGGCCGCGGTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900549635 Original CRISPR TGTGACTTTTTGGGAAGCGC CGG (reversed) Intronic