ID: 900549638

View in Genome Browser
Species Human (GRCh38)
Location 1:3247794-3247816
Sequence CCACAGCCAATGTGACTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549638_900549643 3 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549638_900549644 9 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549644 1:3247826-3247848 CGTCGCGCCTTTCCTGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 45
900549638_900549651 25 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549651 1:3247842-3247864 GCCGCGGTGCGGGGACCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 338
900549638_900549648 16 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549648 1:3247833-3247855 CCTTTCCTGGCCGCGGTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 103
900549638_900549646 15 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549646 1:3247832-3247854 GCCTTTCCTGGCCGCGGTGCGGG 0: 1
1: 0
2: 2
3: 13
4: 129
900549638_900549645 14 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549645 1:3247831-3247853 CGCCTTTCCTGGCCGCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 94
900549638_900549650 24 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549650 1:3247841-3247863 GGCCGCGGTGCGGGGACCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900549638 Original CRISPR CCACAGCCAATGTGACTTTT TGG (reversed) Intronic