ID: 900549643

View in Genome Browser
Species Human (GRCh38)
Location 1:3247820-3247842
Sequence GGGCTGCGTCGCGCCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549637_900549643 4 Left 900549637 1:3247793-3247815 CCCAAAAAGTCACATTGGCTGTG 0: 1
1: 0
2: 1
3: 14
4: 151
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549635_900549643 13 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549634_900549643 28 Left 900549634 1:3247769-3247791 CCTGGGCGCGCGTCACCGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549638_900549643 3 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
900549633_900549643 29 Left 900549633 1:3247768-3247790 CCCTGGGCGCGCGTCACCGGCGC 0: 1
1: 0
2: 0
3: 8
4: 42
Right 900549643 1:3247820-3247842 GGGCTGCGTCGCGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900549643 Original CRISPR GGGCTGCGTCGCGCCTTTCC TGG Intronic