ID: 900549645

View in Genome Browser
Species Human (GRCh38)
Location 1:3247831-3247853
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549638_900549645 14 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549645 1:3247831-3247853 CGCCTTTCCTGGCCGCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 94
900549635_900549645 24 Left 900549635 1:3247784-3247806 CCGGCGCTTCCCAAAAAGTCACA 0: 1
1: 0
2: 1
3: 4
4: 114
Right 900549645 1:3247831-3247853 CGCCTTTCCTGGCCGCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 94
900549637_900549645 15 Left 900549637 1:3247793-3247815 CCCAAAAAGTCACATTGGCTGTG 0: 1
1: 0
2: 1
3: 14
4: 151
Right 900549645 1:3247831-3247853 CGCCTTTCCTGGCCGCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type