ID: 900549650

View in Genome Browser
Species Human (GRCh38)
Location 1:3247841-3247863
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900549637_900549650 25 Left 900549637 1:3247793-3247815 CCCAAAAAGTCACATTGGCTGTG 0: 1
1: 0
2: 1
3: 14
4: 151
Right 900549650 1:3247841-3247863 GGCCGCGGTGCGGGGACCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 276
900549638_900549650 24 Left 900549638 1:3247794-3247816 CCAAAAAGTCACATTGGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 900549650 1:3247841-3247863 GGCCGCGGTGCGGGGACCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type