ID: 900551120

View in Genome Browser
Species Human (GRCh38)
Location 1:3256107-3256129
Sequence TAACCAGGAGGGACGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900551111_900551120 17 Left 900551111 1:3256067-3256089 CCCCTTGCTTTTGCTGATGCTGA 0: 1
1: 0
2: 3
3: 38
4: 332
Right 900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 231
900551113_900551120 15 Left 900551113 1:3256069-3256091 CCTTGCTTTTGCTGATGCTGAGT 0: 1
1: 0
2: 2
3: 76
4: 620
Right 900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 231
900551110_900551120 20 Left 900551110 1:3256064-3256086 CCACCCCTTGCTTTTGCTGATGC 0: 1
1: 0
2: 0
3: 32
4: 518
Right 900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 231
900551112_900551120 16 Left 900551112 1:3256068-3256090 CCCTTGCTTTTGCTGATGCTGAG 0: 1
1: 0
2: 1
3: 27
4: 278
Right 900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900551120 Original CRISPR TAACCAGGAGGGACGAGGAG AGG Intronic
900121918 1:1051882-1051904 ACACCAGGAGGGCCCAGGAGGGG + Intronic
900381150 1:2384736-2384758 TACTCAGGAGGTACGCGGAGAGG - Intronic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
901509295 1:9708082-9708104 TACCCAGGCGGGACCAGGCGCGG - Intronic
901632936 1:10656733-10656755 GAACCTGGAGGGAGGAGGGGTGG + Exonic
901769116 1:11521543-11521565 TAACCAGGCGGGGAGGGGAGAGG + Intronic
902407273 1:16191636-16191658 GGACCAGGAGGAATGAGGAGGGG + Intergenic
903045436 1:20561092-20561114 TAAGTAGGAGGGACCAGGAAGGG - Intergenic
905240013 1:36575442-36575464 TACCCATAAGGGACTAGGAGAGG - Intergenic
905956848 1:42004144-42004166 GACCCAGGAGGAAAGAGGAGAGG + Intronic
906025281 1:42668341-42668363 GGAGCAGGAGGGAGGAGGAGAGG - Intronic
906287015 1:44594263-44594285 TAACAAGGAGGGAGGGGGGGAGG - Intronic
906542244 1:46596090-46596112 TAACAAGAAGGGACCAGGTGGGG - Intronic
908645932 1:66277806-66277828 TAACCAGGAGGTACATGGAAGGG - Intronic
909352694 1:74673418-74673440 GCAGCAGGAGGGAGGAGGAGGGG + Intronic
909547895 1:76868021-76868043 AAACTAAGAGGGACGGGGAGGGG + Intronic
910305700 1:85760719-85760741 TGACCAGGAGGCTGGAGGAGTGG + Intronic
910474853 1:87595714-87595736 AGACCGGGAGGGAGGAGGAGAGG - Intergenic
911465598 1:98249185-98249207 TGAGCAGGGGGGACCAGGAGAGG + Intergenic
911724316 1:101225998-101226020 TAACCAGTAGGACCGAGAAGGGG - Intergenic
912379306 1:109238616-109238638 TAGCCAGCAGGGCAGAGGAGAGG + Intergenic
915509487 1:156378709-156378731 CAGCGAGGAGGGAGGAGGAGGGG - Intronic
915519421 1:156432805-156432827 TAACCTGGAAGGAAGAGGAGGGG - Intergenic
915901961 1:159854194-159854216 TAAGCAGGAGGGAGGAGAGGGGG + Intronic
916161725 1:161922998-161923020 TAGCCTGGAGGGAAGAGGACAGG - Intronic
917556560 1:176096386-176096408 AAACCAGGAGGTAAGGGGAGTGG - Intronic
917754974 1:178089809-178089831 AAACCTGGAGGAAAGAGGAGGGG + Intergenic
918309384 1:183274926-183274948 TGCCCAGGAGAGAGGAGGAGTGG - Intronic
918405354 1:184206963-184206985 TAACCGGGAGAGAGGAGGAGAGG - Intergenic
919444342 1:197683084-197683106 TAACCAGGAAGCAGCAGGAGGGG + Intronic
920067398 1:203278548-203278570 TGGCCAGGAGAGAGGAGGAGGGG + Intergenic
921268417 1:213445546-213445568 TAAGCAGGAGGGAAGGGCAGGGG + Intergenic
923473438 1:234312286-234312308 AAACCAGGAGGGACGGGGGAAGG + Intronic
923473950 1:234315755-234315777 TCACCAGGTGGGAGGTGGAGAGG - Intronic
923987226 1:239395044-239395066 TAACCAGGACAGACAAGGAAGGG - Intronic
1063216407 10:3929899-3929921 TAACCAGGGTGGCCGAGGAACGG + Intergenic
1064970108 10:21056850-21056872 CATCCAGGAGGGAGGAGGTGTGG + Intronic
1065068898 10:22002714-22002736 TTCCCAGAAGGGAAGAGGAGGGG + Intronic
1065541003 10:26767555-26767577 TAACCAGGAAGGAGCATGAGGGG + Intronic
1067147546 10:43704198-43704220 AAACCAGCAGGGAGGAGGAGAGG - Intergenic
1069602496 10:69716984-69717006 AACTCAGGAGGGACCAGGAGGGG + Intergenic
1069949625 10:72009970-72009992 TCCCCAGGAGGAACGAGGAGAGG + Exonic
1070325184 10:75384214-75384236 TCACCAGGAGGGAGGGAGAGAGG - Intergenic
1071095523 10:81969447-81969469 TAGACAGGAGGGACGAGCAGGGG + Intronic
1072930718 10:99659615-99659637 GGACCCGGAGGGACGGGGAGAGG + Intronic
1075923621 10:126233443-126233465 GAACCAGCGGGGACCAGGAGTGG + Intronic
1076059926 10:127405796-127405818 TGACCAGGAGTGACCAGGACAGG - Intronic
1076224660 10:128764504-128764526 TAACAATGGGGGAAGAGGAGAGG + Intergenic
1076990115 11:268326-268348 GAGCCAGGGGGGCCGAGGAGCGG - Intergenic
1077096620 11:801747-801769 GATCCAGGAGGGACGGGGTGGGG + Intronic
1077096637 11:801799-801821 GATCCAGGAGGGACGGGGTGGGG + Intronic
1077411198 11:2404751-2404773 AGGCCAGGAGGGACAAGGAGCGG + Exonic
1080820818 11:35804766-35804788 TAACCAGCAGGAAAGGGGAGTGG + Intronic
1081310570 11:41566467-41566489 TAACCAAAAGGGACCATGAGTGG - Intergenic
1081723082 11:45304278-45304300 TAGTCAGAAGGGACAAGGAGTGG + Intergenic
1083154063 11:60811578-60811600 TAAGAAGGAAGGATGAGGAGGGG - Intergenic
1084708810 11:70831306-70831328 AAACCAGGAGGAAAGAGGAGAGG + Intronic
1085652407 11:78280315-78280337 AAAACAGGAGGGATGAGGAACGG + Intronic
1086522218 11:87682270-87682292 ATACCAGGAGGCACCAGGAGCGG - Intergenic
1090195394 11:124811970-124811992 TTACCATGGGGGAGGAGGAGAGG + Intergenic
1090320277 11:125837231-125837253 TGACCAGGAGGTAAGAGGAGAGG - Intronic
1090464837 11:126924797-126924819 TAACCAGGAGGGTTGAGGTGAGG - Intronic
1090526880 11:127546712-127546734 TAACCAGGTGTGAGGAGGGGAGG + Intergenic
1090648471 11:128785824-128785846 TTACCAGGAGCGGCAAGGAGTGG + Intronic
1092134474 12:6136932-6136954 TGAACAGGAGAGAGGAGGAGTGG - Intergenic
1096134248 12:49186492-49186514 GGAGGAGGAGGGACGAGGAGCGG + Intronic
1096828904 12:54299737-54299759 TAACGAGGGGGAACGATGAGAGG + Intronic
1097310856 12:58117630-58117652 AAGCCAGGAGGGAGCAGGAGTGG + Intergenic
1098644123 12:72877592-72877614 TAACCAAGAGAGAGCAGGAGTGG - Intergenic
1100428785 12:94511872-94511894 TAAACAGGAGGGCCTGGGAGAGG + Intergenic
1101065180 12:101013483-101013505 TAAGCAGGAGAGTAGAGGAGGGG - Intronic
1101863271 12:108500045-108500067 GGACGAGGAGGGACGAGCAGGGG + Intergenic
1102483264 12:113238583-113238605 TAAACAGGAAGGGCCAGGAGTGG - Intronic
1102547018 12:113664563-113664585 GAGCCAGGAGGGAAGGGGAGGGG - Intergenic
1106637279 13:31542653-31542675 TAACCTTGAGAGAGGAGGAGAGG + Intergenic
1107598694 13:41990690-41990712 TAAAGAGGAGGGAGGAGGAGAGG - Intergenic
1108732873 13:53253266-53253288 TAACCATGAGGAAGGAGGAAGGG + Intergenic
1108800690 13:54091904-54091926 TGACAAGGAGGGAGGAGCAGGGG + Intergenic
1108803946 13:54131675-54131697 TGACCAGGTGTGAGGAGGAGAGG + Intergenic
1108904999 13:55458019-55458041 TAAACAGGAGGGATGTAGAGTGG - Intergenic
1113595591 13:111529719-111529741 AAACAGGGAGGGAGGAGGAGGGG - Intergenic
1114525491 14:23365207-23365229 TAGCCAGGCAGGAGGAGGAGCGG + Exonic
1116475028 14:45330014-45330036 TAACAAGGAAAGAGGAGGAGAGG - Intergenic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1120124055 14:80719526-80719548 TATCAAGGAGGGACAAGGAAAGG + Intronic
1120779193 14:88470793-88470815 TAAACACTAGGGAGGAGGAGGGG + Intronic
1121001367 14:90454148-90454170 TACCCAGGAGGGAGGAGGGTGGG - Intergenic
1122542246 14:102505036-102505058 GATCTAGGAGGGACGTGGAGGGG + Exonic
1127488110 15:59437959-59437981 GAACGAGGAGGGAGGAGGGGCGG + Intronic
1128582712 15:68820299-68820321 TAACGAGGGAGGAGGAGGAGAGG - Intronic
1130018255 15:80203630-80203652 GTTCCAGGAGGCACGAGGAGCGG + Intergenic
1130289047 15:82580681-82580703 TAACCAGGGGCTAGGAGGAGAGG - Intronic
1131153241 15:90059888-90059910 TAACCAGGTGGGAGGAGAAGAGG - Intronic
1132614464 16:833291-833313 TGGCCAGGAGGGGCGAGGGGAGG + Intergenic
1133470614 16:6071744-6071766 TAACCAGGAGCCACGGGGAGGGG - Intronic
1134007160 16:10825726-10825748 TACCCAGGAGGGCGGAGCAGAGG + Intergenic
1134081533 16:11328170-11328192 AAACCAGGAGGGGTGGGGAGAGG - Intronic
1137446463 16:48535409-48535431 GAACCAGGAGGGAGCCGGAGGGG + Intergenic
1138217210 16:55214699-55214721 AAATCAGAAGGGAGGAGGAGAGG + Intergenic
1138509593 16:57500678-57500700 TGACCAGGAGGGGCGTGGAGAGG + Intergenic
1139210458 16:65071952-65071974 TACCCAGCAGGGACGAGGGACGG - Intronic
1141116767 16:81315548-81315570 GAACCGGGAGGGACAAGGCGGGG - Intronic
1141129768 16:81428117-81428139 TAACCAGTAGGGATGAGGCTGGG - Intergenic
1142614812 17:1128020-1128042 TAACCAGGAGGGATATGGAAGGG - Intronic
1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG + Exonic
1146063895 17:29620964-29620986 TTCCCAGCAGGGACCAGGAGGGG - Intronic
1146589663 17:34117746-34117768 TAACAAGGAGGGAAGAGTTGAGG + Intronic
1146745377 17:35324105-35324127 CAACCAGGAGGGAGAAGAAGTGG - Intergenic
1147899230 17:43773090-43773112 TGACCAGGAAGGACCATGAGGGG + Intronic
1148674054 17:49434835-49434857 TAGCCAGAAGGGATGAGGCGGGG + Intronic
1150983706 17:70171268-70171290 TAAACATGAGGGAGGAGGAGGGG - Intronic
1151875803 17:76867768-76867790 GAGCCAGGAAGTACGAGGAGGGG + Intergenic
1151943076 17:77304967-77304989 GGACCAGGAGGGGAGAGGAGCGG - Intronic
1152232011 17:79118430-79118452 GATCCATGAGGGAGGAGGAGGGG + Intronic
1152823456 17:82449170-82449192 CAACCAGCAGGGACCAGGACCGG + Exonic
1156489428 18:37487496-37487518 TGACCAGGAGGGAGGAGGACGGG - Intronic
1160448641 18:78947013-78947035 GAAGGAGGAGGGACGAGGGGAGG + Intergenic
1160913698 19:1487071-1487093 AAACCAGGAGGGGCGGGGAGGGG + Intronic
1160923153 19:1529890-1529912 TACCCAGGAGGGCCCAGGATGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163243969 19:16081056-16081078 TACCAAGGTGGGACGAGGCGGGG - Intronic
1163444150 19:17337092-17337114 TGACCGGGAGGGACGAGTACTGG - Intronic
1163466138 19:17469694-17469716 TAGACAGGAGGGAAGAGGGGCGG + Intronic
1163544435 19:17932796-17932818 GAACCAGGAGGGGCGGGCAGAGG - Intergenic
1163669297 19:18618072-18618094 TGACCAGGAGGGAGGAGGTCAGG - Intronic
1163718421 19:18885981-18886003 GCACCAGGAGGCAGGAGGAGGGG - Intronic
1164616357 19:29669010-29669032 GGACCAGGAAGGGCGAGGAGGGG - Intronic
1165335572 19:35167400-35167422 AAACCAGGAGGGAGCAGGGGTGG + Intronic
1167419685 19:49395580-49395602 AAAGCAGGAGGGGCAAGGAGTGG - Intronic
1168061750 19:53896985-53897007 CAACTAGGAGGGAAGGGGAGGGG + Intronic
1168703254 19:58453874-58453896 CAACCAGGAGGGAAGTGAAGAGG - Intronic
931762955 2:65432682-65432704 AAGCCAGGAGGGAGGGGGAGAGG - Intergenic
933204731 2:79493212-79493234 AAAACAGGAGGGAAGGGGAGGGG + Intronic
935134884 2:100291414-100291436 AAGGCAGGAGGGAGGAGGAGCGG - Intronic
935555171 2:104502120-104502142 TAAACAGGGGGCCCGAGGAGCGG - Intergenic
935844744 2:107153526-107153548 TAGCCAGGAGGTACATGGAGAGG - Intergenic
937274290 2:120674114-120674136 CAACCAGGAAGGACAGGGAGTGG + Intergenic
939639217 2:144618933-144618955 GAACCGGGAGGGAAGAGGATTGG + Intergenic
940912245 2:159218883-159218905 TAACTAAGAGGGGCGAGCAGCGG - Intronic
941419476 2:165264600-165264622 TGACAAGGTGGGAGGAGGAGAGG - Intronic
944341188 2:198602286-198602308 TGGCAAGGAGGGATGAGGAGAGG + Intergenic
948074013 2:235150984-235151006 CCACCAGGATGGAAGAGGAGTGG + Intergenic
948254061 2:236553189-236553211 TCAGCAGGGGGGAGGAGGAGAGG - Intergenic
1169935759 20:10881657-10881679 TGACTAGGAGGGACGTCGAGGGG - Intergenic
1171080446 20:22177195-22177217 TAACCAGAAGAGACCTGGAGTGG + Intergenic
1171994246 20:31719984-31720006 AAAGCAGGAGGGAACAGGAGAGG + Intronic
1172774969 20:37402030-37402052 CGACCAGGAGTGACGAGGATTGG + Intronic
1173000540 20:39102316-39102338 AATCCAGGAGTGACAAGGAGAGG - Intergenic
1174950436 20:55036037-55036059 TAAACAGGAGGGAGGGGCAGAGG + Intergenic
1175882755 20:62270331-62270353 AGGCCAGGAGGGACAAGGAGAGG - Intronic
1175882809 20:62270536-62270558 AGGCCAGGAGGGACAAGGAGAGG - Intronic
1176119226 20:63446519-63446541 TCACCAGGAGGGGTGAGGTGAGG + Intronic
1180613814 22:17114570-17114592 TGACCAGGTAGGAGGAGGAGAGG + Exonic
1181908246 22:26216911-26216933 TAACCAGGAGGGAAGTGGTAGGG + Intronic
1183122818 22:35743588-35743610 AAGACAGGAGGGAAGAGGAGAGG + Intronic
1183797453 22:40131530-40131552 TAATCAGGAGAGAGGAGGGGAGG - Intronic
1183949951 22:41347326-41347348 AAGCCAGGAGGGCCGAGGAAAGG - Intronic
1184690338 22:46114551-46114573 TCAACAGGAGGGGCGAGGATGGG - Intergenic
950283295 3:11725153-11725175 GAACAAGGAGGGAGGAGAAGAGG - Intergenic
950307104 3:11924346-11924368 TGACCAAGAGGGATGGGGAGAGG + Intergenic
950704890 3:14773487-14773509 AAACAAGGAGGGAGGGGGAGGGG + Intergenic
950967542 3:17156461-17156483 AAACTAGGAGGGATGGGGAGGGG - Intergenic
953015270 3:39069124-39069146 TAGCCAGATGGGACAAGGAGTGG - Intronic
953227073 3:41030624-41030646 TTAGGAGGAGGGCCGAGGAGGGG + Intergenic
953511008 3:43539142-43539164 GTACCAGGAGGGAGCAGGAGGGG - Intronic
955168585 3:56540454-56540476 TAACGGGGAGGGAAGTGGAGAGG - Intergenic
955476350 3:59340337-59340359 TAGCCAGCAGGAGCGAGGAGAGG + Intergenic
956727750 3:72170416-72170438 GAACCAGGAGGTACTAGTAGGGG - Intergenic
957265971 3:77966274-77966296 AAAGCAGTAGGGACAAGGAGGGG + Intergenic
960966755 3:123110863-123110885 TATGCAGGAGGGGCGGGGAGGGG + Intronic
961190946 3:124960896-124960918 TAAGCAGGAGGGAAGGGCAGAGG + Intergenic
962475559 3:135752183-135752205 TAACCAGGAGACACAAGGAGGGG - Intergenic
964318182 3:155465902-155465924 GAAAAAGGAGGGAAGAGGAGTGG + Intronic
965153348 3:165012033-165012055 TAAACAGAAGGGAACAGGAGTGG - Intronic
967419776 3:189260146-189260168 TAAACTGGAGGGAGGAGGGGAGG + Intronic
968553092 4:1234025-1234047 CAGCCAGCAGGGACGAGGAGGGG + Intronic
968865599 4:3209300-3209322 TAACCATGAGGTATGAGCAGTGG - Intronic
969371167 4:6732566-6732588 TAACCAGAAGGGACCCCGAGGGG + Intergenic
975846688 4:78532615-78532637 TTACCAGGAGCGACGAGGAGGGG - Intronic
980894954 4:138853232-138853254 GAAGCAGGAGGGAGGAAGAGAGG + Intergenic
982373168 4:154656804-154656826 TAAGCAGGAGAGAGGAGCAGTGG - Intronic
983940514 4:173530744-173530766 GCCCCAGCAGGGACGAGGAGCGG + Intergenic
984288333 4:177761941-177761963 GAACCAGGATGGCCGAGGAAAGG + Intronic
984963559 4:185121344-185121366 TAAACTGGAGGCAGGAGGAGAGG - Intergenic
985911480 5:2887406-2887428 CCACCAGGAGGGACGGGAAGCGG - Intergenic
987369437 5:17179819-17179841 TCACAAGGAAGGAGGAGGAGTGG - Intronic
990964069 5:61425683-61425705 TAACCAGGAAGGAAGAGAAGAGG + Intronic
991598425 5:68328142-68328164 TAACATAGAGGGAGGAGGAGAGG - Intergenic
992624908 5:78628125-78628147 TTACCAGGAGAGACGTGGACAGG + Intronic
997666335 5:135632362-135632384 TACCCAGGTGGGAGAAGGAGTGG + Intergenic
998288477 5:140887529-140887551 TAACCATGAGGGGTGGGGAGAGG - Intronic
1001897534 5:175394296-175394318 TAACCAGGAGGGACCTGGGAGGG + Intergenic
1002877735 6:1226364-1226386 CAACAAGGAGGGGCAAGGAGGGG + Intergenic
1003812935 6:9804817-9804839 TAACCAGAAGGAACGTGTAGAGG - Intronic
1004536588 6:16509088-16509110 TTACCAGGAGGGAGGGGGAAGGG + Intronic
1005054898 6:21720303-21720325 TGACCAGGAAGGACCAGGAGAGG - Intergenic
1005102763 6:22191230-22191252 TCTCCAGCAGGGAGGAGGAGGGG + Intergenic
1006051611 6:31349546-31349568 TACCCAGTAGGCACGAAGAGTGG - Intronic
1006187616 6:32189950-32189972 TAACCAGGCGGGGGGAGGGGCGG - Exonic
1006572891 6:35019969-35019991 GAAGCTGGTGGGACGAGGAGAGG + Intronic
1007323164 6:41041449-41041471 GAACCAGGAGGCACTGGGAGAGG + Intronic
1007439836 6:41849139-41849161 TAACCAGAAGAGAGCAGGAGTGG + Intronic
1007980321 6:46148438-46148460 TAATCAGAAGAGACTAGGAGCGG + Intergenic
1009038572 6:58148951-58148973 TAAAGAGGAGGGAGGAAGAGAGG - Intergenic
1010059868 6:71610391-71610413 CGACCAGGATGGAAGAGGAGAGG - Intergenic
1016835664 6:148474140-148474162 TAACGATGAGCGATGAGGAGCGG + Exonic
1019177208 6:170166038-170166060 CAACCAGCAGGCAGGAGGAGAGG + Intergenic
1020276572 7:6628264-6628286 TGAGCAGGAGGAAAGAGGAGAGG + Intergenic
1020308107 7:6850238-6850260 AAACCAGGAGGGGGGAAGAGGGG + Intergenic
1020643098 7:10780042-10780064 GAGCGAGGAGGGTCGAGGAGGGG - Intergenic
1021173662 7:17424949-17424971 TAGGCAGGAAGGAGGAGGAGAGG - Intergenic
1021630738 7:22644263-22644285 TAACCAGAAGAGAGCAGGAGTGG - Intergenic
1022174535 7:27860863-27860885 GAAAAAGGAGGGACGAGGGGAGG - Intronic
1023505261 7:40892994-40893016 TAACCAAAAGGGAGCAGGAGTGG + Intergenic
1026966564 7:74443910-74443932 GAAGCAGGAGGGGCCAGGAGGGG - Intergenic
1027268018 7:76504623-76504645 TAGCCTCGAGGGAGGAGGAGAGG + Intronic
1027319829 7:77004485-77004507 TAGCCTCGAGGGAGGAGGAGAGG + Intergenic
1028072469 7:86468242-86468264 AAACAAGGAGAGAAGAGGAGAGG + Intergenic
1029702276 7:102255009-102255031 TAATCAGGACGGAAGAGGAGGGG + Exonic
1032440130 7:131936323-131936345 TAACCAAGAGGTAAGAGGAAAGG - Intergenic
1033279412 7:139995173-139995195 GAAGCAGGAGGGGCGGGGAGGGG + Intronic
1034563298 7:151895021-151895043 GAACAAGGAGGGCAGAGGAGCGG - Intergenic
1035701016 8:1639292-1639314 GAGCCAGGAGGGATGGGGAGGGG + Intronic
1036571151 8:9980601-9980623 AAACCAGGAGGGAGGCAGAGAGG - Intergenic
1037515329 8:19625179-19625201 TGACCAGGAGGGACGTGGGGTGG + Intronic
1037538202 8:19847285-19847307 TAAGCAGGATGGACAAGGACTGG + Intronic
1039060666 8:33569781-33569803 TGGCCAGGAGGGACGAAGGGAGG - Intergenic
1040595588 8:48834811-48834833 TCATCAGGAGGGATGAGGAGAGG + Intergenic
1041252784 8:55950698-55950720 TAACCAGGAAGGACGCAGAAAGG + Exonic
1041417571 8:57628872-57628894 TAAGCAGAAGGGAAGAGGTGGGG - Intergenic
1041776272 8:61526741-61526763 TGACCAGTAGAGACTAGGAGTGG + Intronic
1042000857 8:64122511-64122533 TAACTAGGAGTGATGAAGAGTGG + Intergenic
1042663263 8:71178833-71178855 GATCCAGGAGGGATGAGGAGAGG - Intergenic
1042865888 8:73356605-73356627 TGAGCTGGAGGGAGGAGGAGGGG - Intergenic
1047826572 8:128582283-128582305 GAACAAGGAAGGAAGAGGAGAGG - Intergenic
1049035872 8:140075456-140075478 TAAGCAGGCTGGAGGAGGAGAGG - Intronic
1049273279 8:141707435-141707457 AAACCAGGAGTGACGTGGACAGG - Intergenic
1049498737 8:142949716-142949738 AAAGCAGGAGGGAGCAGGAGAGG - Intergenic
1049675350 8:143886638-143886660 TCCCCAGGAGAGAAGAGGAGGGG - Intergenic
1050395658 9:5192372-5192394 TCTCCAGGAGGGACTAAGAGAGG + Intergenic
1055976641 9:81962042-81962064 TAACCAGAAGAGAGCAGGAGTGG - Intergenic
1056271931 9:84955192-84955214 TTAGCAAGAGGGACGGGGAGGGG + Intronic
1056896776 9:90558893-90558915 TGACCAGGCGGGAAGAGGAAAGG + Intergenic
1057283930 9:93732685-93732707 TAACCAGGGGGGAGGGAGAGAGG + Intergenic
1060350231 9:122852615-122852637 TGACCGGGAGGGAGGTGGAGGGG + Intronic
1060729328 9:126027331-126027353 CAACCTGGAGGAAAGAGGAGAGG - Intergenic
1061861937 9:133472709-133472731 GAACCAGGAGGCAGGGGGAGTGG + Intronic
1062164995 9:135103198-135103220 ACACAAGGAGGGAAGAGGAGGGG - Intronic
1203759752 EBV:6104-6126 TAACGAGGAGAGATGAGGTGAGG + Intergenic
1186463605 X:9767328-9767350 TTACCAGGAGAGAGGAGGAAGGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1190330804 X:49234142-49234164 TCACCAGCAAGCACGAGGAGCGG - Intergenic
1194936962 X:99961656-99961678 TAGACAGGAGGGACGAAGAGTGG + Intergenic
1197967653 X:132082170-132082192 TAACTAGGAGGGAGGAAGATGGG - Intronic
1198127608 X:133661666-133661688 TAACCGAGAGAGAGGAGGAGGGG - Intronic
1200344405 X:155434618-155434640 TCACTTGGAGGGAAGAGGAGAGG - Intergenic
1200396557 X:155993124-155993146 TAACCAGAAGAGATCAGGAGTGG + Intergenic
1201724885 Y:17140665-17140687 GAACCAGGTGTGAGGAGGAGAGG + Intergenic