ID: 900555400

View in Genome Browser
Species Human (GRCh38)
Location 1:3277899-3277921
Sequence GCTCATGTGCATGAGTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900555400_900555404 17 Left 900555400 1:3277899-3277921 CCCATACACTCATGCACATGAGC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 900555404 1:3277939-3277961 ACCGTGAAGTCCGTGCATCCGGG 0: 1
1: 0
2: 0
3: 1
4: 38
900555400_900555406 26 Left 900555400 1:3277899-3277921 CCCATACACTCATGCACATGAGC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104
900555400_900555403 16 Left 900555400 1:3277899-3277921 CCCATACACTCATGCACATGAGC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 900555403 1:3277938-3277960 CACCGTGAAGTCCGTGCATCCGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900555400 Original CRISPR GCTCATGTGCATGAGTGTAT GGG (reversed) Intronic