ID: 900555401

View in Genome Browser
Species Human (GRCh38)
Location 1:3277900-3277922
Sequence TGCTCATGTGCATGAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900555401_900555404 16 Left 900555401 1:3277900-3277922 CCATACACTCATGCACATGAGCA 0: 1
1: 0
2: 2
3: 17
4: 198
Right 900555404 1:3277939-3277961 ACCGTGAAGTCCGTGCATCCGGG 0: 1
1: 0
2: 0
3: 1
4: 38
900555401_900555406 25 Left 900555401 1:3277900-3277922 CCATACACTCATGCACATGAGCA 0: 1
1: 0
2: 2
3: 17
4: 198
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104
900555401_900555403 15 Left 900555401 1:3277900-3277922 CCATACACTCATGCACATGAGCA 0: 1
1: 0
2: 2
3: 17
4: 198
Right 900555403 1:3277938-3277960 CACCGTGAAGTCCGTGCATCCGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900555401 Original CRISPR TGCTCATGTGCATGAGTGTA TGG (reversed) Intronic