ID: 900555402

View in Genome Browser
Species Human (GRCh38)
Location 1:3277934-3277956
Sequence ATGCACGGACTTCACGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900555402_900555410 18 Left 900555402 1:3277934-3277956 CCAACACCGTGAAGTCCGTGCAT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900555410 1:3277975-3277997 CGATCATTGCTAGCAGGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 33
900555402_900555406 -9 Left 900555402 1:3277934-3277956 CCAACACCGTGAAGTCCGTGCAT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104
900555402_900555409 12 Left 900555402 1:3277934-3277956 CCAACACCGTGAAGTCCGTGCAT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900555409 1:3277969-3277991 GGTCAGCGATCATTGCTAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
900555402_900555411 19 Left 900555402 1:3277934-3277956 CCAACACCGTGAAGTCCGTGCAT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900555411 1:3277976-3277998 GATCATTGCTAGCAGGCCATGGG 0: 1
1: 0
2: 0
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900555402 Original CRISPR ATGCACGGACTTCACGGTGT TGG (reversed) Intronic