ID: 900555406

View in Genome Browser
Species Human (GRCh38)
Location 1:3277948-3277970
Sequence TCCGTGCATCCGGGAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900555402_900555406 -9 Left 900555402 1:3277934-3277956 CCAACACCGTGAAGTCCGTGCAT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104
900555400_900555406 26 Left 900555400 1:3277899-3277921 CCCATACACTCATGCACATGAGC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104
900555401_900555406 25 Left 900555401 1:3277900-3277922 CCATACACTCATGCACATGAGCA 0: 1
1: 0
2: 2
3: 17
4: 198
Right 900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900555406 Original CRISPR TCCGTGCATCCGGGAGCTCT AGG Intronic