ID: 900558510

View in Genome Browser
Species Human (GRCh38)
Location 1:3291936-3291958
Sequence GGAGAAGGCACCTGCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900558510_900558517 -8 Left 900558510 1:3291936-3291958 CCCACACAGCAGGTGCCTTCTCC 0: 1
1: 0
2: 2
3: 42
4: 232
Right 900558517 1:3291951-3291973 CCTTCTCCCGGGCTCCTTTGGGG 0: 1
1: 1
2: 1
3: 14
4: 186
900558510_900558522 8 Left 900558510 1:3291936-3291958 CCCACACAGCAGGTGCCTTCTCC 0: 1
1: 0
2: 2
3: 42
4: 232
Right 900558522 1:3291967-3291989 TTTGGGGCCTACCCGGTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 155
900558510_900558520 1 Left 900558510 1:3291936-3291958 CCCACACAGCAGGTGCCTTCTCC 0: 1
1: 0
2: 2
3: 42
4: 232
Right 900558520 1:3291960-3291982 GGGCTCCTTTGGGGCCTACCCGG 0: 1
1: 0
2: 0
3: 7
4: 148
900558510_900558515 -9 Left 900558510 1:3291936-3291958 CCCACACAGCAGGTGCCTTCTCC 0: 1
1: 0
2: 2
3: 42
4: 232
Right 900558515 1:3291950-3291972 GCCTTCTCCCGGGCTCCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
900558510_900558514 -10 Left 900558510 1:3291936-3291958 CCCACACAGCAGGTGCCTTCTCC 0: 1
1: 0
2: 2
3: 42
4: 232
Right 900558514 1:3291949-3291971 TGCCTTCTCCCGGGCTCCTTTGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900558510 Original CRISPR GGAGAAGGCACCTGCTGTGT GGG (reversed) Intronic
900424307 1:2568999-2569021 GGGGAAGGCACCTCCCGTCTTGG + Intergenic
900558510 1:3291936-3291958 GGAGAAGGCACCTGCTGTGTGGG - Intronic
900824392 1:4914342-4914364 GGAGAGGGCACCTGGTGGGCAGG + Intergenic
901117152 1:6856175-6856197 GGAGAAGCCACCTGCGTTGCAGG + Intronic
902460878 1:16575738-16575760 GGAGAAGGCACTTTATGTGGTGG - Intronic
902461652 1:16582004-16582026 GGAGAAGGCACTTGATGTGGGGG - Intronic
902462433 1:16588309-16588331 GGAGAAGGCACTTGGTGTAGGGG - Intronic
902778872 1:18691955-18691977 TGAGGAGGCACCTGCGGTGTCGG + Intronic
902941057 1:19800229-19800251 GGAGAAGGGCCCTGCAGGGTTGG + Intergenic
902997021 1:20233875-20233897 GGAGAAACCAGCTGCTGTTTAGG + Intergenic
903159128 1:21472310-21472332 AGAGAAGGCACTTGATGTGGGGG + Intronic
904422496 1:30403223-30403245 GGAGTAGGCAGCTACTGTATGGG + Intergenic
905016041 1:34779646-34779668 GGAGAAGTCACGTCCGGTGTTGG + Intronic
905990080 1:42329306-42329328 GGAAAAGGCATCTGCTGTACAGG - Intronic
907128888 1:52077244-52077266 GGAGTAGGCAACTGCTGGCTGGG + Intronic
907585765 1:55616406-55616428 GGTGAAGGCACATTCTGTTTGGG + Intergenic
908531615 1:65039752-65039774 GGAAAAGGCAATGGCTGTGTCGG - Intergenic
908741869 1:67337118-67337140 GTAGAGGGCAGGTGCTGTGTGGG - Intronic
909900510 1:81128942-81128964 GGAGGAGGCACCTGGTGGGAGGG + Intergenic
910757183 1:90706435-90706457 AGAGAAGGGCCCTGCTCTGTAGG + Intergenic
912274311 1:108240424-108240446 GGAGAAGGCACTTGATGTGGTGG - Intronic
912286956 1:108379438-108379460 GGAGAAGGCACTTGATGTGGTGG + Intronic
912293908 1:108453899-108453921 GGAGAAGGCACTTGATGTGGTGG + Intronic
912799006 1:112709675-112709697 GGAGAAGGAACATGCTATGGAGG + Intronic
913543113 1:119840846-119840868 GGAGAAGGCACTTGATATGGAGG - Intergenic
913603038 1:120440208-120440230 GGAGAAGGCACTTGATGTGGGGG + Intergenic
913603786 1:120446560-120446582 GGAGAAGGCACTTGATGTGGGGG + Intergenic
913604545 1:120452841-120452863 GGAGAAGGCACTTTATGTGGGGG + Intergenic
913641416 1:120815554-120815576 GGAGAAGGCACTTTATGTGGGGG + Intronic
913665260 1:121042413-121042435 GAAGAAGGGACCTGCTGAGAAGG - Intergenic
913990532 1:143607754-143607776 GGAGAAGGCACTTGATGTAGGGG - Intergenic
914016652 1:143825682-143825704 GAAGAAGGGACCTGCTGAGAAGG - Intergenic
914083997 1:144436362-144436384 GGAGAAGGCACTTTATGTGGGGG - Intronic
914161133 1:145135329-145135351 GAAGAAGGGACCTGCTGAGAAGG + Intergenic
914190018 1:145401640-145401662 GGAGAAGGCACTTTATGTGGGGG - Intronic
914277066 1:146134774-146134796 GGAGAAGGCACTTTATGTGGGGG - Intronic
914277827 1:146141068-146141090 GGAGAAGGCACTTGATGTGGGGG - Intronic
914364218 1:146963823-146963845 GGAGAAGGCACTTGATGTGGGGG + Intronic
914364987 1:146970113-146970135 GGGGAAGGCACTTGATGTGGGGG + Intronic
914365743 1:146976402-146976424 GGAGAAGGCACTTGATGTGGGGG + Intronic
914381388 1:147119548-147119570 GGAGAAGGCACTTGATGTGGGGG - Intergenic
914486701 1:148117040-148117062 GGAGAAGGCACTTGATGTGGGGG - Intronic
914487464 1:148123313-148123335 GGAGAAGGCACTTGATGTGGGGG - Intronic
914538110 1:148585722-148585744 GGAGAAGGCACTTTATGTGGGGG - Intronic
914538872 1:148592016-148592038 GGAGAAGGCACTTGATGTGGGGG - Intronic
914587031 1:149072185-149072207 GGAGAAGGCACTTTATGTGGGGG - Intronic
914587808 1:149078467-149078489 GGAGAAGGCACTTGATGTGGGGG - Intronic
914627807 1:149479608-149479630 GGAGAAGGCACTTGATGTGGGGG + Intergenic
914655266 1:149734223-149734245 GAAGAAGGGACCTGCTGAGAAGG - Intergenic
914940872 1:152021903-152021925 GGAGAAGGCACTTGATGTGGGGG + Intergenic
915628013 1:157128113-157128135 GGAGAAGGCACCAGCTGATTGGG - Intronic
915729593 1:158043672-158043694 GGAGAAGGCCTCTGCTTTCTTGG + Intronic
915915239 1:159936870-159936892 GGAGACACCTCCTGCTGTGTTGG - Exonic
916556918 1:165901184-165901206 GGAGAAGGCTGCTGCTGGGCTGG + Intronic
916658596 1:166900187-166900209 AGAGAAGGAGCCTGCTGTGGAGG - Intergenic
917299193 1:173555264-173555286 GGAGAAGGCAGGAGCTGTGGTGG + Intronic
920947843 1:210546424-210546446 GGAGAAGGGAACTGCTGAGGAGG + Intronic
921417379 1:214905727-214905749 ACAGAAGGCAGCAGCTGTGTGGG + Intergenic
922823959 1:228504081-228504103 GGAAAAAGCACAGGCTGTGTAGG - Intergenic
1064006770 10:11705107-11705129 GGAGAGAGCAACTGCAGTGTGGG + Intergenic
1064679473 10:17795530-17795552 GGAGAAGGCTCTTGGTGTCTTGG - Intronic
1065306800 10:24376963-24376985 GCAGCAGGCACCTGTTATGTTGG + Intronic
1067275801 10:44833113-44833135 GGGGAAGCCAACTGCTGTGCTGG + Intergenic
1067476827 10:46572972-46572994 ACAGTAGGCAGCTGCTGTGTTGG - Intergenic
1067617910 10:47768808-47768830 AGAGTAGGCAGCTGCTGTGTTGG + Intergenic
1069988959 10:72302505-72302527 AGAGAATGCACCTGCTGGCTGGG - Intergenic
1069991183 10:72317173-72317195 GGCGATGGCACCTGCTGGGTGGG + Intergenic
1070621186 10:78012646-78012668 GGACATGGCACCGGCTGTGTAGG - Intronic
1070664137 10:78331719-78331741 GGAAGAGGGCCCTGCTGTGTGGG + Intergenic
1070916567 10:80158844-80158866 GGAGTAGGGAACTGCAGTGTGGG - Intronic
1070960897 10:80499544-80499566 GTGGAAGGCAGCTGCTCTGTGGG + Intronic
1073021309 10:100446612-100446634 GGGAAAGCCAGCTGCTGTGTTGG - Intergenic
1073306346 10:102505666-102505688 GGACCAGCCACCTGCTGTCTAGG + Intronic
1074863781 10:117533123-117533145 GGGGAAGGTAGCTGCTGTGAGGG - Intergenic
1075571917 10:123552413-123552435 GGCGAAGGCACATGCAGTGTGGG - Intergenic
1075661285 10:124198373-124198395 GGAGAAGTCGCCTGCTGGCTGGG - Intergenic
1076218745 10:128716350-128716372 GCAACAGGCACCTACTGTGTGGG - Intergenic
1076227805 10:128794189-128794211 GGGGAAGGCACCAGCTGGGGTGG + Intergenic
1076480963 10:130785066-130785088 GGAGAATTCACCTGCAGTGTAGG - Intergenic
1076854693 10:133110120-133110142 GGAGACGGCACCTGGAGTCTTGG - Intronic
1076880897 10:133238548-133238570 TGAGCAGGCACCGGCTGTGCTGG - Intronic
1077139165 11:1016006-1016028 GGAGAAGGCAGGGGCGGTGTGGG + Exonic
1077268758 11:1665480-1665502 GGAGGAGGCCCCTGGAGTGTGGG + Intergenic
1077278782 11:1732608-1732630 CGAGAATGCACCTGCTGTGGGGG + Exonic
1077516781 11:3007006-3007028 GGAGGAGGCACTGGTTGTGTGGG - Intronic
1077516796 11:3007054-3007076 GGAGGAGGCACTTGTTCTGTGGG - Intronic
1078254354 11:9644789-9644811 GGAGAAGGAAGCTGCTCTGAAGG - Intergenic
1078354723 11:10625213-10625235 GGAGAAGCCTCCTGCTCTGAGGG + Intronic
1080173033 11:29328938-29328960 GGAGAAGACACGTGCTTTATTGG + Intergenic
1083547916 11:63562880-63562902 GGAAAGGGCTCCAGCTGTGTGGG - Intronic
1083587211 11:63869128-63869150 GAAGAAGGCACCAGCTGTGTGGG + Intronic
1083749271 11:64752555-64752577 GGAAATGGCCCCTTCTGTGTTGG - Intronic
1083799388 11:65037802-65037824 GGAGAAGGCACCTCCTGGCTGGG - Intronic
1084027267 11:66459037-66459059 GGAGAATCCAGCTGCCGTGTTGG + Intronic
1084119170 11:67058967-67058989 GGGGAAGGCACCTGATGGGCGGG + Intronic
1086950627 11:92887020-92887042 GGAGAAGTGACCTGCTTTGCAGG + Exonic
1087130619 11:94666598-94666620 GGAGGAGGCAACTGCTGAATAGG - Intergenic
1088087200 11:105995767-105995789 GGAGAAGACACATGCTGCATTGG + Intronic
1089340111 11:117751559-117751581 GAAGAAGGCACCAGCTCTTTGGG + Intronic
1089603725 11:119629677-119629699 GGAGAGGGGACATGCTGTGCAGG + Intronic
1089658692 11:119971424-119971446 GGAGCAGGCACCTGAACTGTTGG + Intergenic
1089756166 11:120689060-120689082 GAAGAAGGCCCCTGCTGCATTGG + Intronic
1090596430 11:128325485-128325507 GGAGAAAGCACCTGTTGATTTGG + Intergenic
1091081543 11:132673638-132673660 GGAGAAAGCACTTTCTGTTTTGG + Intronic
1096667164 12:53173527-53173549 AGAGGAGGCTCCTGCTGGGTAGG - Intronic
1101955596 12:109209342-109209364 GGAGCACGCACCTGCTGGCTGGG - Exonic
1102298673 12:111756109-111756131 GCAGAAGGCACCTGCAGAGTGGG + Intronic
1103997841 12:124841659-124841681 TGCGAAGGAGCCTGCTGTGTTGG - Intronic
1104780606 12:131417599-131417621 GGAGAAGCCACCTGAAGTATTGG - Intergenic
1105559949 13:21480890-21480912 GGACATGGCAGCTGCCGTGTTGG + Intergenic
1106198044 13:27510668-27510690 GGAGATGGCACCAGCAATGTAGG - Intergenic
1110290691 13:73803518-73803540 GGAGAAGGTAAGTGCTGTGGTGG - Intronic
1110386664 13:74920243-74920265 GGAAAAAGCCCCTGCTCTGTGGG - Intergenic
1112494205 13:99893065-99893087 GGAGATGGCACATGCTCCGTGGG + Exonic
1112576689 13:100642589-100642611 GAAGAAGGTACCTGCTGCGTGGG - Intronic
1114512859 14:23276764-23276786 GGAGGAGGCACCTCCTCTGGGGG + Exonic
1115814976 14:37153729-37153751 AGAGCAGGCACCAGCTGTGGTGG - Intronic
1118055886 14:62079417-62079439 GGAGATGGTACCTTCTGTGTAGG - Intronic
1119421275 14:74509293-74509315 GGAGAAGGAGCCAGCCGTGTTGG + Exonic
1120763797 14:88309940-88309962 GGGGAAGTCAGGTGCTGTGTAGG - Intronic
1130212662 15:81939502-81939524 GGAAAAGGCATCTGGGGTGTTGG + Intergenic
1130284109 15:82541176-82541198 GGAGAAGGTACCTGAGGTGTTGG - Intronic
1130813552 15:87406929-87406951 GGAGAAGACACCTGTTGGGAGGG - Intergenic
1131079586 15:89523432-89523454 GAAGAAGGCCCCTGCTGGCTTGG + Intergenic
1133833401 16:9345000-9345022 GCAGAAGGAAACTGCTGGGTGGG + Intergenic
1133942271 16:10319464-10319486 GGAGAAGACCTTTGCTGTGTAGG - Intergenic
1134131214 16:11651419-11651441 GGAGGAGGCTCCTACAGTGTGGG - Intergenic
1134457141 16:14403108-14403130 GGTGGAGCCACCTGCTTTGTAGG - Intergenic
1136234695 16:28906208-28906230 GGAGGAGTCACCTGCTGGGCTGG + Intronic
1138504786 16:57472854-57472876 TGAGAAGCCACCTGCTGTTCCGG + Exonic
1138653361 16:58474492-58474514 TGAGAAGCCACCTGCTGAGAAGG - Intronic
1139583395 16:67886025-67886047 GGAGGAGGCAGCTGCAGTGTGGG + Exonic
1140985428 16:80154013-80154035 GGAGAAGGATACTGATGTGTGGG - Intergenic
1141174878 16:81712317-81712339 GGAGGAGGCAGCTGAAGTGTGGG - Intergenic
1143112460 17:4560092-4560114 GCAGGAGGCACCTGCTGGGCAGG - Intronic
1143575978 17:7793313-7793335 GGAGAAGGACGCTCCTGTGTGGG - Intronic
1145049240 17:19647003-19647025 GGAAAACGCACCTTCTTTGTTGG + Intergenic
1145932225 17:28694072-28694094 GGAGAGGGCTCTTCCTGTGTGGG + Intronic
1146901767 17:36593297-36593319 GGAGAATGCCCCTGTTGTGAGGG + Intronic
1147871627 17:43591732-43591754 GGTGAAGGCTCCTGTTGTTTGGG + Intergenic
1149536173 17:57435337-57435359 TGTGATGGCACCTGGTGTGTTGG + Intronic
1149620350 17:58040097-58040119 GGAGAAGGGACCTGGGGGGTAGG + Intergenic
1150315426 17:64164965-64164987 TGAGAGGGCACCTGCTGCTTGGG + Intronic
1152879796 17:82808444-82808466 GGGGGAGGCCCCTGCTGTGGAGG + Intronic
1152897413 17:82920809-82920831 GGGGAAGGGCCCTCCTGTGTTGG - Intronic
1154355132 18:13619201-13619223 GGAGACGTCACATGGTGTGTGGG + Intronic
1154358177 18:13638555-13638577 CGAGAGGGCACCTGCTCTGGGGG - Intronic
1157289536 18:46399889-46399911 GGAAAAGCCACCTGCCATGTGGG - Intronic
1157486765 18:48093214-48093236 GGAGATGCCACCTGATGTGGTGG + Intronic
1157593367 18:48849159-48849181 GGAGCAGGCACCCTCTGTGTGGG - Intronic
1157611105 18:48956206-48956228 GGAGAATTCACCTGCTTTTTCGG - Intergenic
1161534751 19:4812061-4812083 GCAGATGGCACCTGGTGTGTTGG - Intergenic
1162322696 19:9979248-9979270 GAAGAAGGCTCCTGTTGAGTGGG + Intronic
1164823705 19:31268728-31268750 GGAGAAGGCCTCTGCTTTCTTGG + Intergenic
1165145537 19:33727764-33727786 GGAGAAGGCTCCTGCCGTAGCGG + Intronic
1166811037 19:45514819-45514841 GGAAAGGGCACCTGGTGTTTGGG + Intronic
1202677307 1_KI270711v1_random:19478-19500 GGAGAAGGCACTTTATGTGGTGG - Intergenic
1202678089 1_KI270711v1_random:25751-25773 GGAGAAGGCACTTGATGTGGGGG - Intergenic
925005631 2:441070-441092 GGACAGGGCAGCTGCTGGGTGGG + Intergenic
925045197 2:767619-767641 CCAGAAGGCCCCTGCTGTGGTGG - Intergenic
925981335 2:9179906-9179928 GGAAAAAGCACCTCCCGTGTTGG + Intergenic
926799423 2:16646530-16646552 AGAGAAGCCACGTGCAGTGTGGG + Intronic
927222687 2:20728612-20728634 GGCGAAGGCAGCTTCTGTGAGGG + Intronic
927313078 2:21651997-21652019 AGAGAAGTCACCTGCAGGGTGGG - Intergenic
927464575 2:23327590-23327612 TGAGCAGGCACCTGGTGAGTGGG - Intergenic
928674036 2:33632921-33632943 GAAGCAGGCACCAGCTGTGGTGG - Intergenic
932099030 2:68879799-68879821 TGAGAATGCACCTGCAGTTTTGG - Intergenic
932827943 2:74958721-74958743 GGAGGAGGGACCTGCTGGGGAGG + Exonic
935039910 2:99416321-99416343 GGAGAGGGAACCTTCTGTGGTGG - Intronic
938137855 2:128774052-128774074 GCAGAAGGGAGCTGCTGGGTTGG - Intergenic
939044416 2:137233051-137233073 GGAGAAGCCACGTGTGGTGTAGG + Exonic
943247277 2:185472704-185472726 GGGGACGGCAGCTGCTGTGGGGG + Intergenic
943367267 2:186977949-186977971 GGAGTTTGCACCTGTTGTGTGGG + Intergenic
946231610 2:218294923-218294945 GGAGAAGGGGCCTGCTATGGTGG - Intronic
947856874 2:233330083-233330105 GCAGAAGGCACCTCCCCTGTAGG - Intronic
948074714 2:235156805-235156827 GGAGAAAGAACCTTCTGTGATGG + Intergenic
948148267 2:235724564-235724586 GGAAAAGGTACCTGCGGTGGTGG + Intronic
948212517 2:236205210-236205232 GGAGAGGGCACAGGTTGTGTGGG - Intronic
948660772 2:239505332-239505354 GGAGAGCTCACCTGCTCTGTGGG + Intergenic
948933543 2:241148448-241148470 GGAGGAGGCACCTGCAGAGCCGG + Intronic
1168891838 20:1300010-1300032 GGAGATGTATCCTGCTGTGTGGG + Intronic
1169831510 20:9830733-9830755 GGAAAATGTACCTTCTGTGTGGG + Intronic
1170481102 20:16765778-16765800 GGAGAAGCCAGGTGCTGTGAAGG - Intronic
1170603819 20:17861157-17861179 TGAAAAGGCAGCAGCTGTGTTGG - Intergenic
1175261545 20:57677313-57677335 CCAGAAAGCACCTGGTGTGTAGG + Intronic
1176018294 20:62949595-62949617 GCACAAGGCACCTGGTGTGCAGG + Intergenic
1176090898 20:63318227-63318249 GAGGAGGGCTCCTGCTGTGTGGG + Intronic
1178546091 21:33494055-33494077 AGAGAAGGGACTTGCTTTGTGGG - Intergenic
1179010847 21:37554928-37554950 AGAGAAGGCAACGGTTGTGTTGG + Intergenic
1181291454 22:21797134-21797156 AGAGAAAGAACCTGTTGTGTGGG + Intronic
1181468991 22:23126611-23126633 GGAGAAGGCGCATGCTGAGCTGG + Intronic
1181595313 22:23910745-23910767 GTAGGAGGCAGCTGCTGTGAGGG - Intergenic
1181969060 22:26676498-26676520 GCAGAAGGGACGTGCTGTTTAGG + Intergenic
1184336308 22:43855205-43855227 GGAGATGCCACCTGCAGAGTTGG + Intronic
949874785 3:8619044-8619066 GGAGAACAAACCAGCTGTGTTGG - Intergenic
949979491 3:9492820-9492842 GGAGAAGAGAACTGCTTTGTAGG - Intergenic
950568024 3:13782805-13782827 GGAGACGGGACGTGCTGCGTGGG - Intergenic
952197311 3:31089312-31089334 GAAGCAGGCACCTTCTTTGTAGG - Intergenic
954155180 3:48681460-48681482 GGAGAAGGCAGCAGCTGAGGCGG - Exonic
954386538 3:50246814-50246836 GAAGGAGGCCCCAGCTGTGTAGG + Intronic
957179335 3:76856890-76856912 ACAGAAAGCACTTGCTGTGTTGG - Intronic
960844328 3:121993035-121993057 GGAGGAGGCACCCTCTGTGGTGG + Intronic
961518694 3:127454867-127454889 GGATAAAGCACCTGCTTTGAAGG + Intergenic
962344545 3:134609774-134609796 GGAGAAGGAGCCTGGTGTCTGGG + Intronic
964639366 3:158892304-158892326 GGAGAAACCACCTGCATTGTAGG + Intergenic
966913140 3:184570210-184570232 GGAGGAGGCAACAGCTCTGTTGG + Intronic
967878407 3:194282029-194282051 GGAGGAGGCGCCTGGTGGGTGGG - Intergenic
968569788 4:1333613-1333635 GGAGCAGCCAGCTGCTGGGTTGG - Intronic
969173353 4:5381424-5381446 TGAGAGGGCAGCTGCTGTCTTGG - Intronic
969175862 4:5398614-5398636 GGAGAAGGCACCTCCCTTGCAGG + Intronic
973643506 4:52926739-52926761 GGAGGTGGCCCCTGCTGCGTTGG - Intronic
980971244 4:139569095-139569117 GGAGATGGCCCCTGCTTTGGGGG - Intronic
984589017 4:181595764-181595786 ATAGAATGCACCTACTGTGTGGG - Intergenic
985606626 5:861513-861535 GGTGGTGGGACCTGCTGTGTGGG - Intronic
989732352 5:44664220-44664242 GGAGATGTCACCTGCAGTGGGGG + Intergenic
990658843 5:57989231-57989253 GGAGGAGACAGCTGCTGTATTGG + Intergenic
990690732 5:58360955-58360977 GGAGGTGGCACCTGCTGGGCAGG - Intergenic
991029749 5:62070618-62070640 GGAGCAGGCCCCTGCTTTGTGGG + Intergenic
994163646 5:96584751-96584773 GGAGAAGGCAGCTGATTAGTTGG + Intronic
996487825 5:124057429-124057451 GGTGGGGGCACCTGCTGTGGAGG + Intergenic
998491505 5:142551139-142551161 GGAGAAGGCAGCCTATGTGTGGG + Intergenic
1000133645 5:158323385-158323407 GGAAAGGGAACCTGGTGTGTTGG + Intergenic
1001084000 5:168687185-168687207 GGAGAGGCCACCTGCTGAGGGGG - Intronic
1002088798 5:176792663-176792685 GGAGAAGGCAGGTGCCTTGTGGG + Intergenic
1002782557 6:378827-378849 AGCGAAGGCACCTGAGGTGTGGG + Intergenic
1002863378 6:1099899-1099921 GGAGAAGGATCCCCCTGTGTGGG + Intergenic
1003929317 6:10908325-10908347 GCAGAAGGCAGCTGCTGTGATGG + Intronic
1006597200 6:35202142-35202164 GCAGAAGCCACCTGCTGTATGGG + Intergenic
1006782912 6:36644177-36644199 GTGGAATGCAGCTGCTGTGTGGG - Intergenic
1006830403 6:36964664-36964686 GGAGAGCGCACATGCTGTGTGGG - Exonic
1007937795 6:45749054-45749076 GGAAGAAGCACCTGCTGTTTGGG + Intergenic
1017380090 6:153818140-153818162 GGAGAAGGGACTTGGTGTGTTGG - Intergenic
1017712994 6:157186522-157186544 GGAGAGGCCACCTGCTGTGTGGG - Intronic
1017975442 6:159353083-159353105 GGAGAAGGGACTTTCTGGGTGGG - Intergenic
1018447154 6:163868084-163868106 GGAGGAGGCACCGGAGGTGTGGG + Intergenic
1019751914 7:2736006-2736028 GGACAATGCACCTGCTGATTGGG + Intronic
1029163284 7:98568201-98568223 GGATAAGGAACTTGCTTTGTAGG + Intergenic
1030427695 7:109400481-109400503 AGAGAAGGCAGCTGCCATGTTGG + Intergenic
1031297141 7:120014890-120014912 TGTGAAGGCACTTGCTGGGTAGG + Intergenic
1034006704 7:147480741-147480763 GGAGAATGCAGTTGCTGAGTAGG - Intronic
1035192991 7:157188636-157188658 GGTGAAGGAACTTTCTGTGTAGG + Intronic
1035244716 7:157554435-157554457 TGATAAAGCACCTGCTGGGTGGG + Intronic
1036154242 8:6326987-6327009 GGAGAAGGCTGCTGCTGTGGAGG - Intergenic
1038527261 8:28286573-28286595 GGAGGAAGCCCCTGATGTGTAGG - Intergenic
1039455069 8:37700612-37700634 GGTAAAGGCACCTGCTGAGAGGG + Intergenic
1039884640 8:41648030-41648052 GGAGATGGCACCTGCCCTGCAGG - Intronic
1040576248 8:48654048-48654070 GGAGAAGGGAGCTGGTGGGTAGG + Intergenic
1041495977 8:58485788-58485810 GGAGAAGGCATCAGTTCTGTGGG - Intergenic
1041571673 8:59344217-59344239 GCAGAAGGTACCTGCTATGGGGG - Intergenic
1042300780 8:67278503-67278525 GGAGAAAGCAACTTCTGGGTAGG - Intronic
1042359371 8:67865245-67865267 GGAGAAGGCTCCTGTTGAGTGGG + Intergenic
1049806900 8:144545181-144545203 GGAGAGGGCTCCTGCTGTGCTGG - Intronic
1050595324 9:7199286-7199308 GGAGAAGGGAACTGCTGGGCTGG + Intergenic
1051088301 9:13377636-13377658 GAAGAATGAACCTGCTGGGTGGG - Intergenic
1051360696 9:16278988-16279010 GGAGCAGGCCCAAGCTGTGTGGG + Intergenic
1052772226 9:32700097-32700119 GGAGAAAGCAGCTGCCCTGTGGG + Intergenic
1055228002 9:74024146-74024168 AGAGAAGGAACATACTGTGTGGG - Intergenic
1059336958 9:113575051-113575073 GGAGAAGGGACCTGGTGAGGGGG + Intronic
1059713057 9:116887350-116887372 GGAGAAGGGACAAGCTGTTTAGG + Intronic
1060503585 9:124181188-124181210 GGAAAAGGCAGCTACTCTGTGGG - Intergenic
1060510774 9:124230372-124230394 GGAGAAGGCACCTGGGGAGGTGG - Intergenic
1060596978 9:124854287-124854309 GGAGTGGGCAGCTGCTGTGGAGG + Exonic
1061217285 9:129229038-129229060 GGGCAAGGCACCTGCTGTCACGG + Intergenic
1061461565 9:130743748-130743770 GGAGCAGGCACAAGCTTTGTGGG + Intronic
1061512079 9:131067637-131067659 GGAGCCGGCAGCTGCTGCGTGGG - Intronic
1061969921 9:134039478-134039500 GGGGGAGGCAACAGCTGTGTGGG - Intronic
1185720209 X:2375236-2375258 TGAGAACGCACCTGCTGACTGGG - Intronic
1186144973 X:6615706-6615728 GGAGAAGGCACTGGCATTGTTGG + Intergenic
1187270278 X:17774478-17774500 GGAGAAGGCAGCTCATGTGTGGG - Intergenic
1189240362 X:39519939-39519961 GAAGAAGCCACGTGATGTGTCGG + Intergenic
1192051362 X:67727000-67727022 GGAGAAGGCTCCGTCTGTGCTGG + Exonic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1198595353 X:138229967-138229989 TGAGAAGGCAGGTGCTGGGTGGG - Intergenic
1199074087 X:143510384-143510406 GGAGAAGGGACCTGGAGAGTTGG - Intronic
1199091681 X:143700744-143700766 GGAGCAGGCATCTCATGTGTTGG - Intergenic
1199093086 X:143713619-143713641 GGAGAAGGGACCTGGAGAGTTGG - Intronic
1200785746 Y:7258995-7259017 AGAGAAGGCACTTCCTCTGTAGG - Intergenic