ID: 900558616

View in Genome Browser
Species Human (GRCh38)
Location 1:3292479-3292501
Sequence GACGCTGCGGCCCCAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900558616_900558623 12 Left 900558616 1:3292479-3292501 CCTCTATCTGGGGCCGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 900558623 1:3292514-3292536 AAAAGAGTTCTCCTGGTGAGCGG 0: 1
1: 0
2: 0
3: 14
4: 178
900558616_900558622 5 Left 900558616 1:3292479-3292501 CCTCTATCTGGGGCCGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 900558622 1:3292507-3292529 AGTGCTGAAAAGAGTTCTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900558616 Original CRISPR GACGCTGCGGCCCCAGATAG AGG (reversed) Intronic
900558616 1:3292479-3292501 GACGCTGCGGCCCCAGATAGAGG - Intronic
901019632 1:6249276-6249298 GGTGCTGCGGCCCCGGAGAGCGG + Exonic
903125391 1:21244215-21244237 CACGCTCGGGCCCCAGAGAGTGG - Intronic
903141229 1:21340301-21340323 GAGGCTGTGGCCCCAGACAGAGG - Intronic
903284633 1:22268914-22268936 GCCCCTGAGGCCCCAGATGGTGG - Intergenic
905664695 1:39755958-39755980 GACCCTGCCGCCACAGATTGAGG - Intronic
906306583 1:44723854-44723876 GAGGCTGAGACCCCAGAGAGGGG - Intronic
906540634 1:46583188-46583210 GAAGCTGCAGGCCCAGATATAGG + Intronic
915511274 1:156388325-156388347 GACGCGGCGGCCCCAACTCGGGG + Intergenic
1067277765 10:44850131-44850153 GAGGCTGCAGCCCCACACAGAGG + Intergenic
1077268909 11:1666037-1666059 GAGGCTGCGGCCCCAGTCATGGG - Intergenic
1077271843 11:1685143-1685165 GAGGCTGCGGCCCCAGTCATGGG + Intergenic
1083202775 11:61130510-61130532 GATGCTGCGTCCTCAGGTAGTGG + Exonic
1083887234 11:65578908-65578930 CACCCTGTGGCCCCAGATAAGGG + Intronic
1084593182 11:70102339-70102361 GAGGATGCGGCACCAGCTAGGGG - Intronic
1090817811 11:130314523-130314545 GGCGCGGCGGCCCGAGATAGGGG - Exonic
1092713669 12:11365464-11365486 GAAGCTGCAGTCCCAGTTAGTGG + Intronic
1113587314 13:111474285-111474307 GAAGCTGCAGCCCCAGTGAGGGG + Intergenic
1119522214 14:75294481-75294503 GGCGCTGGGGGCCCAGAGAGAGG + Intergenic
1122359372 14:101150544-101150566 GAGACTGAGGCCCCAGACAGAGG - Intergenic
1123097755 14:105774430-105774452 GACGTTGCTGCCCCAGGTTGAGG - Intergenic
1126009386 15:44288657-44288679 GACGACCCGGCCCCAGCTAGTGG + Intergenic
1129666634 15:77582949-77582971 TACGCTGCTGGCCCAGATGGAGG - Intergenic
1133339916 16:5029406-5029428 GGAGCTGAGGCCCCAGATGGCGG + Intronic
1136129627 16:28211688-28211710 GAGGCTGCGGGCCCAGGCAGGGG + Exonic
1138782652 16:59807911-59807933 GACACTGCTGCCCCAGATCCTGG + Intergenic
1142893611 17:2960647-2960669 GACACTGGGGCCCCAGAAGGAGG - Intronic
1144480145 17:15622238-15622260 GCCGCTGCTGGGCCAGATAGAGG + Intronic
1144918160 17:18741500-18741522 GCCGCTGCTGGGCCAGATAGAGG - Intergenic
1147193881 17:38752459-38752481 GAAGCTGCGGCCCCAGCTGAAGG - Intergenic
1151611940 17:75182335-75182357 GCCGCCGCGGCCCCAGGCAGGGG + Intergenic
1154170513 18:12047457-12047479 GGCAGTGCAGCCCCAGATAGTGG + Intergenic
1154170543 18:12047554-12047576 GGCAGTGCAGCCCCAGATAGTGG + Intergenic
1154172418 18:12061318-12061340 GGCAGTGCAGCCCCAGATAGTGG - Intergenic
1160948441 19:1654323-1654345 GACTCAGGGGCTCCAGATAGGGG - Intergenic
1168020164 19:53603374-53603396 GACGATGCGGCCCCATCTCGGGG + Exonic
1168711052 19:58500165-58500187 GAGGCGGAGGCCCCAGATGGTGG + Intronic
926094383 2:10071720-10071742 GACACAGCAGCCCCAGATGGTGG + Intronic
945997183 2:216447567-216447589 GAGGCTGAGGCCCCAGGCAGAGG + Intronic
946236454 2:218327289-218327311 GACGCATTGGCCCCAGATAACGG - Intronic
947529916 2:230902358-230902380 GACGCTGCTGCCCCAGACGCTGG + Intergenic
947624991 2:231613688-231613710 GACGCTGCCGGCCCAGATCCTGG - Intergenic
1168804324 20:663597-663619 GGCGCTGCGGGCGCAGGTAGGGG + Exonic
1171452637 20:25247273-25247295 CAGGCTGCAGCTCCAGATAGGGG - Intergenic
1171464791 20:25319878-25319900 CAGGCTGCAGCTCCAGATAGGGG + Intronic
1173424606 20:42931989-42932011 GCTGCTGTGGCCTCAGATAGTGG - Intronic
1175947647 20:62566212-62566234 GTCGCTATGTCCCCAGATAGTGG + Intronic
1177870340 21:26564804-26564826 GATGCTGCTGTCCCAGGTAGAGG - Intronic
966326008 3:178755152-178755174 GTTGCTGCTGCCCCAGATGGAGG - Intronic
968078339 3:195829513-195829535 TAAGCTGCTGCCCCAGAGAGGGG - Intergenic
969252073 4:5974539-5974561 GACACTGAGGCCCCAGAGGGAGG + Intronic
981481436 4:145243151-145243173 AACGCTGCAGCCCCAGTCAGGGG - Intergenic
985894205 5:2739378-2739400 GGCGCTGGGGCCGCAGATCGGGG + Intergenic
986723904 5:10580398-10580420 GACCCTGCTGCCCCAGCAAGGGG - Intronic
1000048437 5:157541109-157541131 GACGCTGCTGTCCCACAGAGAGG + Intronic
1009355590 6:62740322-62740344 CAGGCTGGGGCCCCAGACAGAGG - Intergenic
1025144558 7:56492796-56492818 GCCGCTGGGCCCCCAGAGAGTGG + Intergenic
1027616852 7:80434154-80434176 GACCCTGAAGCCCCAGAAAGGGG - Intronic
1034193033 7:149225513-149225535 GATGCTGCTGCACCAGATTGAGG - Exonic
1035126074 7:156608277-156608299 GACGCTGCGGCCGCAGTGGGAGG - Intergenic
1041918314 8:63157940-63157962 GACGGTGCGGCTTCAGAGAGGGG - Intergenic
1042719107 8:71807831-71807853 GAGGCTGCTGCACCAGATGGCGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1062119571 9:134827094-134827116 ACCGCTGCGGCCCCAGAAATGGG - Intronic
1062541651 9:137044274-137044296 GAGGCTGCTGCCCCAGGTTGTGG - Intronic
1185595729 X:1305621-1305643 GACGCTGCGGTCCCATCTGGTGG - Intronic
1199607167 X:149586316-149586338 GACGCCCCCACCCCAGATAGAGG - Intronic
1199628844 X:149762306-149762328 GACGCTCCCTCCCCAGATAGAGG - Intergenic
1199947157 X:152679276-152679298 GACGCCTCCACCCCAGATAGAGG + Intergenic
1199962523 X:152789178-152789200 GACGCCTCCACCCCAGATAGAGG - Intergenic