ID: 900558767

View in Genome Browser
Species Human (GRCh38)
Location 1:3293204-3293226
Sequence TCTGTAGAGGATCCTAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900558762_900558767 -6 Left 900558762 1:3293187-3293209 CCAGCAATGAACCTGCCTCTGTA 0: 1
1: 0
2: 2
3: 14
4: 180
Right 900558767 1:3293204-3293226 TCTGTAGAGGATCCTAAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900558767 Original CRISPR TCTGTAGAGGATCCTAAGTC GGG Intronic
900558767 1:3293204-3293226 TCTGTAGAGGATCCTAAGTCGGG + Intronic
901505027 1:9679379-9679401 TCTATAGAGGATGAGAAGTCAGG + Intronic
903746953 1:25593458-25593480 TCTGGAGTGGCTCTTAAGTCTGG + Intergenic
905311478 1:37051975-37051997 CAAGTAGAGGAACCTAAGTCTGG + Intergenic
907774947 1:57505009-57505031 TCTGGACAGGATCCTGAGACAGG + Intronic
1068253236 10:54470700-54470722 TATGCAGAGGCTCCTTAGTCTGG - Intronic
1076171171 10:128321236-128321258 TGTGGAGAGGATCCCATGTCTGG + Intergenic
1078436223 11:11327991-11328013 TCTGTTTAGGTTCCTAAGACAGG - Intronic
1080317779 11:30970087-30970109 TCTGGAGAGGATCCCCAGTGTGG + Intronic
1084966209 11:72746022-72746044 TCTGCAGAGGCTCCTGAGCCTGG + Intronic
1085529414 11:77182665-77182687 TCTGCAGAGGAGCCCAAGGCTGG - Intronic
1086042577 11:82496544-82496566 TCTGCAGAGGATACTAGCTCAGG + Intergenic
1087661591 11:100995181-100995203 TCTGTAGAATGTCCTCAGTCTGG - Intergenic
1088070919 11:105784002-105784024 TATGTAGAGGAAGCAAAGTCAGG - Intronic
1094011284 12:25812723-25812745 TCCTTAGAGAATCCTAAGACTGG - Intergenic
1097708107 12:62888883-62888905 TCTCTGGAGGTTCCTAATTCTGG - Intronic
1098213089 12:68186727-68186749 TCTTGAGTGAATCCTAAGTCAGG + Intergenic
1100361384 12:93882832-93882854 TCTTTAGTGGCTCCTAACTCTGG - Intronic
1101517275 12:105448471-105448493 TCTGTAGAGGACCCCAAGGTAGG + Intergenic
1102509056 12:113402084-113402106 TATTTAGGGGATGCTAAGTCTGG - Intronic
1104144920 12:126024021-126024043 TCTGCAGAGGCTTCTCAGTCTGG - Intergenic
1114179158 14:20350716-20350738 TCAGTAGAGGCTCTGAAGTCTGG + Intronic
1115628064 14:35215166-35215188 TCTTTAGAGAATATTAAGTCTGG - Intronic
1117658223 14:57978222-57978244 TCTATAGAGGACCCTGTGTCAGG - Intronic
1118070379 14:62240499-62240521 TCTGAAGAGGACCCTATGCCAGG - Intergenic
1120820221 14:88905364-88905386 TCTGGTGGGCATCCTAAGTCAGG - Intergenic
1127773461 15:62248293-62248315 TCTCTAGAGGATTCTATGGCAGG + Intergenic
1127774968 15:62257423-62257445 TCTCTAGAGGATTCTATGGCAGG + Intergenic
1130814618 15:87418201-87418223 TCTCTAGTGGATCCTAAGTTGGG + Intergenic
1131283033 15:91035949-91035971 TCTCTAGAGGATTCTATGGCAGG + Intergenic
1132825951 16:1905676-1905698 TCTGCAGAGAATTCTAAGTCAGG + Intergenic
1133111931 16:3552975-3552997 TCAGAAGAGGAACCTAAGCCAGG - Intronic
1144600641 17:16609562-16609584 TATTTAGAGGAACATAAGTCAGG + Intergenic
1159999563 18:75003858-75003880 TCTGTAGAAGGTTCTAACTCTGG - Intronic
1162229304 19:9252510-9252532 TCTGTGGAGGATGTTAAGTGAGG + Intergenic
1165356005 19:35304487-35304509 GCTGTAGAGGATTCAAGGTCTGG - Intronic
929829222 2:45334103-45334125 TCTGAAAAGGATCCTAGGCCAGG - Intergenic
946549206 2:220782138-220782160 TCACTAGAGGTTCCTAACTCAGG - Intergenic
947700512 2:232230453-232230475 TCTGTTGAGGCTCCTATGTTGGG + Intronic
948516368 2:238506248-238506270 TCTGGAGAGGACCCCAATTCTGG + Intergenic
1170859518 20:20089793-20089815 TCTGTAGAGGGTCCTGAGAATGG + Intronic
1171353837 20:24528248-24528270 TTTGTAAAGTATCCTAAGTATGG + Intronic
1173457324 20:43213953-43213975 TCTGTTGAGGATCTTAATGCTGG - Intergenic
1173830816 20:46086172-46086194 TCTGTAAAGTATCTTAAGGCTGG - Intronic
1175918959 20:62441114-62441136 TCTTTGGAGGAGCCTCAGTCTGG - Intergenic
1181426125 22:22840818-22840840 TCTGTGGAGAATCCTAATACAGG - Intronic
957190302 3:76999751-76999773 ACTGTTGAGGCTCCTAAGGCAGG + Intronic
960409022 3:117299070-117299092 TCTGAAGAGGTTCCATAGTCTGG + Intergenic
970052926 4:11936720-11936742 TCTATAAAGGAACCTAAGCCTGG + Intergenic
973587850 4:52410343-52410365 TCTGTAGTTGGTCCTAAGTTGGG + Intergenic
975753788 4:77552322-77552344 ACTGTAGAGAATCCTAGGTAGGG + Intronic
976369866 4:84275242-84275264 TCTGTATTGGATCCTTAGTTTGG + Intergenic
979918810 4:126473731-126473753 TCTATAGAGGATGCTCAGTAAGG - Intergenic
982285487 4:153729310-153729332 TCTGTTGAGGATTCTGAGCCTGG + Intronic
995360007 5:111285503-111285525 TATGTAGAGGAACCTCAGTTTGG - Intronic
996064223 5:119064352-119064374 TGTGAAGAGGATTATAAGTCTGG - Intronic
1000589640 5:163143507-163143529 ACTGTAGAGAATGCTAAGTAGGG + Intergenic
1002554729 5:180027433-180027455 TCAGAAGAGGATCATAATTCTGG + Intronic
1009481881 6:64169535-64169557 TCAGCAGAGGGTCCTAAGACAGG + Intronic
1010406662 6:75513972-75513994 TCTCTAGAGAATCCTAACCCGGG - Intergenic
1014514886 6:122366168-122366190 TCTGTAGAGGATTGTCAGTAAGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1015223414 6:130830239-130830261 ACTGTAGAGGATCCTGCCTCTGG - Intronic
1028185779 7:87784490-87784512 TCTGTAGGGGTTCCTTAGTTTGG + Intronic
1041370736 8:57158010-57158032 TCTGTAGAGTGTTCTAGGTCTGG + Intergenic
1041593936 8:59624086-59624108 GCAGTGGAGGATCCTAAGTGGGG + Intergenic
1041895852 8:62924076-62924098 GCTGTAGATGATTCTTAGTCAGG - Intronic
1043508513 8:80926463-80926485 TCTGAACAGGATCCTAAGCTTGG + Intergenic
1045719706 8:105094099-105094121 TCTGTGGAGAATCCTAATACAGG - Intronic
1046256355 8:111701261-111701283 TCTGCAGGGGATCCTGAGTGTGG + Intergenic
1056536827 9:87535475-87535497 TCTGTATGGGATCCTAATTTGGG + Intronic
1058382013 9:104387701-104387723 TATTTAGAGGATCTTAAGACAGG + Intergenic
1193839544 X:86392494-86392516 TTTGTGGAGGATAATAAGTCAGG + Intronic