ID: 900558857

View in Genome Browser
Species Human (GRCh38)
Location 1:3293795-3293817
Sequence ATGGAGAAGCCGACAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900558857_900558869 22 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558869 1:3293840-3293862 GGAGAGGCGATGGCGTGGCCCGG 0: 1
1: 0
2: 4
3: 85
4: 790
900558857_900558861 1 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558861 1:3293819-3293841 TCCTGGTGAACGTTGCCCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 89
900558857_900558864 12 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558864 1:3293830-3293852 GTTGCCCCTTGGAGAGGCGATGG 0: 1
1: 0
2: 2
3: 14
4: 111
900558857_900558863 6 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558863 1:3293824-3293846 GTGAACGTTGCCCCTTGGAGAGG 0: 1
1: 0
2: 3
3: 4
4: 44
900558857_900558870 28 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558870 1:3293846-3293868 GCGATGGCGTGGCCCGGCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 141
900558857_900558867 17 Left 900558857 1:3293795-3293817 CCATCCTTTGTCGGCTTCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 242
Right 900558867 1:3293835-3293857 CCCTTGGAGAGGCGATGGCGTGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900558857 Original CRISPR ATGGAGAAGCCGACAAAGGA TGG (reversed) Intronic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900878639 1:5364650-5364672 AGGGAGAACCCAACCAAGGAGGG - Intergenic
902152492 1:14455000-14455022 ATGGAGAAGCCCACAAGGTGAGG - Intergenic
903014623 1:20353943-20353965 AGGGAGAAGCTGTCACAGGACGG - Exonic
910415795 1:86996665-86996687 ATGGAGAAACAGACAACTGAAGG + Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911058561 1:93728579-93728601 ATGGGGAAGCCAAAAAGGGATGG + Intronic
913214807 1:116611265-116611287 ATTAAGAAGAGGACAAAGGAAGG + Intronic
916009595 1:160692687-160692709 ATTGAGAAGTCAAGAAAGGAAGG + Intronic
919078965 1:192847242-192847264 AGGGAGGAGCCGAGAAAGGAGGG + Intergenic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922646349 1:227290651-227290673 AGGGATATGCCAACAAAGGATGG + Intronic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923483402 1:234405811-234405833 AAGGAGAAGCTGACACAGTATGG + Intronic
924672411 1:246142901-246142923 ATGAAGAAGCTGCCAAAGGTTGG - Intronic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1067564200 10:47325248-47325270 TTGGAGAAGACAACAAAGAAGGG - Exonic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072559195 10:96554555-96554577 TTGGAGAAGTTCACAAAGGATGG - Intronic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1076165346 10:128277893-128277915 ATGAAGAAACTCACAAAGGAAGG - Intergenic
1076539730 10:131206439-131206461 CTGGAGCAGCCCTCAAAGGAAGG + Intronic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077243696 11:1525354-1525376 AAGGAGAAGACAGCAAAGGAGGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077848837 11:6054689-6054711 ATGGAAAAGCAAGCAAAGGAAGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1079122063 11:17693122-17693144 ATGGAGAAGCCCACATGGCAAGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1084665029 11:70571720-70571742 CTGGAGGAGTCGGCAAAGGAGGG + Intronic
1085401032 11:76235597-76235619 AAGGAGATGCGGAAAAAGGAAGG - Intergenic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1086855112 11:91856470-91856492 ATGAGAAAGCAGACAAAGGAGGG + Intergenic
1088260011 11:107935025-107935047 ATGGAGAGGCAGGCAAAGGCCGG - Intronic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1091467528 12:698220-698242 AGGCAGAAGAGGACAAAGGAAGG - Intergenic
1094817820 12:34204517-34204539 ACGGAGGAGCCAACAAAAGAAGG + Intergenic
1097043343 12:56169662-56169684 AAGGAGAAGGAGCCAAAGGAAGG - Exonic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098487073 12:71033772-71033794 ATGGAGAAGCAGACAAAGTTGGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1102133957 12:110557030-110557052 AGGGAGAAGCTGAAAAATGAAGG + Intronic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1107978767 13:45714439-45714461 AAGGCGAGGACGACAAAGGAAGG - Exonic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1109984760 13:69965465-69965487 ATGGAGAAGGGGAGAAATGAGGG - Intronic
1115431138 14:33320075-33320097 TTGGAGAAGCCATCAAAGAAAGG + Intronic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117214066 14:53531841-53531863 ATGGAGAAAAGGACAAAGGGAGG - Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118328729 14:64799741-64799763 GTGGAGAAGCCGCCCAAGTAAGG - Exonic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1123038434 14:105480669-105480691 ATGGGGAAGCCGGCGAAGGTCGG + Intergenic
1202918152 14_KI270723v1_random:3611-3633 AGGGAGAAGCCGTCAGAGAAGGG - Intergenic
1124360415 15:29032839-29032861 GTGGAGCAGCCCACAAAGAAAGG - Intronic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1128079103 15:64845607-64845629 ATGGAGAAGGGGACAACTGAAGG - Intronic
1128095802 15:64954424-64954446 AAGGAGAAGACGACGAACGAAGG - Intronic
1131861732 15:96660973-96660995 TTGGAGAATCCTGCAAAGGATGG - Intergenic
1131900354 15:97081411-97081433 ATTGAGAAGCAGTCAAATGAGGG + Intergenic
1132007143 15:98237700-98237722 ATGAAGAAAACAACAAAGGAAGG - Intergenic
1132594549 16:742441-742463 ATGGAGAAGGCCACACAGGCTGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1134378211 16:13699394-13699416 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1135261035 16:20981029-20981051 ATGCAGAAGCTGACAAACTATGG - Intronic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1137954412 16:52814538-52814560 ATGGTGAAGCCTTCAAAAGATGG - Intergenic
1138303000 16:55948237-55948259 ATGGGCAGGCCGAGAAAGGAGGG + Intronic
1138833016 16:60398704-60398726 ATGGAGAGGCTGACTAAAGAAGG - Intergenic
1138972811 16:62167308-62167330 AAGGAGAAGAAGACAAAGAAGGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1150135782 17:62694240-62694262 CTGGAGATGCCAACAAAGGAAGG + Intergenic
1151124885 17:71833728-71833750 ATGTAGATGCCAACAAACGATGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1156681518 18:39594891-39594913 ATGGAGAAGACCACATAGCAGGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158283205 18:55850404-55850426 AGGGAGAAGAGGACAAAGAAAGG - Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1163634059 19:18430348-18430370 ATGGAGAAGGCGACAAGACAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166825565 19:45607039-45607061 GTGGAGAAAGCCACAAAGGATGG + Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167634243 19:50644785-50644807 ATGGAGAATTAGATAAAGGATGG + Intronic
925207239 2:2017248-2017270 ATGCAGAATGCTACAAAGGAAGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928266954 2:29820260-29820282 ATGGAGAAGTCCACACAGGGAGG + Intronic
928656132 2:33453500-33453522 ATGGAGAAGTCCACGAAGAAAGG - Intronic
929344200 2:40860574-40860596 ATGGAGAAGTCTAGCAAGGAAGG + Intergenic
929755499 2:44760877-44760899 ATGGAGAAGAGGACAATGAATGG + Intronic
929993708 2:46811869-46811891 AAGGAGAAGGAGACAAAAGAAGG - Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
933091632 2:78126540-78126562 ATAGAGAAGGCCACAAGGGAAGG - Intergenic
934295768 2:91741887-91741909 ATTAAGAAGAGGACAAAGGAAGG - Intergenic
935675649 2:105592991-105593013 ATGGAGAAGCCGTGCCAGGAAGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936938544 2:117860098-117860120 GTGGAGAAGGCGGCATAGGAGGG - Intergenic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
940139953 2:150483044-150483066 ATGGAGAAAGGGAGAAAGGAAGG + Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
944247194 2:197543677-197543699 AGGTAGAAGCTGCCAAAGGATGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
947163794 2:227241035-227241057 AAAGAGAAACCCACAAAGGAAGG - Intronic
948254114 2:236553438-236553460 ATGGAAAAGCCAATAAAGAAAGG + Intergenic
1169060196 20:2655446-2655468 CTGGAGGAGCTGACAATGGATGG + Exonic
1169124715 20:3119210-3119232 ATGGAGAGGCCCACAAGGCAAGG + Intronic
1169521718 20:6380649-6380671 GTGGAGAAAACGAAAAAGGAAGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1173174976 20:40757737-40757759 ATGGAGAAGTCCACATGGGAAGG - Intergenic
1175016749 20:55799814-55799836 ATGGAGAACCCGACAATGCCAGG + Intergenic
1175152597 20:56946822-56946844 CTGGAGCATCCCACAAAGGATGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1177474070 21:21595382-21595404 ATGGAGAGGCCCACAAGGCAAGG + Intergenic
1178250150 21:30996089-30996111 AAGGAGGAACCGAAAAAGGAAGG + Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1179439285 21:41381857-41381879 ATGGAGAAGTCCACAAGGTAAGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180317169 22:11285313-11285335 AGGAAGAAGCAAACAAAGGAAGG - Intergenic
1181381320 22:22507093-22507115 ATGGAGAGGCCCACAGAGCAAGG + Intronic
1182488263 22:30652691-30652713 ATGGAGAAGCCCACATGGCAAGG - Intronic
1182995307 22:34806826-34806848 ATGGAGAGGCAAACAAAGAAAGG + Intergenic
1183650609 22:39151557-39151579 AGGGAGGAGGAGACAAAGGAAGG + Intronic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184234834 22:43177629-43177651 ATGGAGAGGCCCACAAGGCAGGG + Intronic
950000613 3:9653252-9653274 ATGGGGAAGCTGACCAATGAAGG + Intronic
950545248 3:13634435-13634457 ATGGAGATGCCCAGAAGGGAAGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
954345745 3:49996950-49996972 ATGTAGAAGGCGGCAAAGAAAGG - Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
955007819 3:54986198-54986220 CTGGAGCAGCCAACAAATGATGG + Intronic
956021868 3:64941649-64941671 ATGGAGAGGCCCACATAGCAAGG - Intergenic
956184568 3:66550317-66550339 ATGAAGAATCCAGCAAAGGATGG + Intergenic
956758842 3:72419377-72419399 ATGGATAAGGGGAGAAAGGAAGG + Intronic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
958788011 3:98620179-98620201 ATCCAGAAGCTGACAAAAGATGG + Intergenic
959864743 3:111253331-111253353 ATGGAGAAGCCTCCATAGCAAGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961572582 3:127810610-127810632 ATGGAGATGCCTTCAAAGGCAGG + Intronic
961687044 3:128640766-128640788 ATGGAGGAGGAGGCAAAGGAAGG - Intronic
962346587 3:134623517-134623539 ATGGAGCAGCCAGGAAAGGAAGG - Intronic
962967203 3:140366044-140366066 AAGGACAAGCTGACACAGGAGGG + Intronic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
965105690 3:164349001-164349023 ATGCAGAAGGGGACAAAGGGAGG + Intergenic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966828391 3:183984872-183984894 ATGGAGCAGTCTCCAAAGGAAGG + Intronic
967018829 3:185504836-185504858 ATGGAAAAGCAAACAAGGGAGGG + Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
973148982 4:46864382-46864404 TTGGAGAAGCCAACAACTGAAGG + Intronic
973571646 4:52246210-52246232 AAAGAAAAGCCGAGAAAGGATGG + Intergenic
975620953 4:76295935-76295957 ATGGAGAGGCCCACATAGCAAGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
980877454 4:138676379-138676401 GGGGAGAAGCCTCCAAAGGATGG + Intergenic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
984546574 4:181111617-181111639 ATGGAGAAGAAAACAAATGACGG - Intergenic
984581230 4:181512064-181512086 ATGAAGAAGGCGAGAAAGCAGGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988973694 5:36494334-36494356 ATGGAGAAATGAACAAAGGAGGG + Intergenic
990903589 5:60779475-60779497 ATGGAGAAGCTGCCAAAGCTTGG + Intronic
991411600 5:66351644-66351666 AGGGGGAAGCAGTCAAAGGAGGG - Intergenic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
994977579 5:106829672-106829694 CTGGAGAAGCTGACCAATGACGG + Intergenic
998666814 5:144307062-144307084 ATGGAGAAGGCCAGAAAGGTGGG - Intronic
1000052515 5:157575341-157575363 AAGGAGAAGGCGAGAAGGGAAGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003424384 6:5987938-5987960 GTGGAGAAGCCCACATAGAAAGG - Intergenic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006731639 6:36240367-36240389 AAGGAGAAGGAGACAAAGAAGGG - Intergenic
1007274803 6:40665467-40665489 ATGGAGAAGCAGTCAAAAGGGGG + Intergenic
1008438440 6:51503920-51503942 ATGGAGAAGCCCACATAGCAAGG + Intergenic
1009897510 6:69771327-69771349 ATGGAGAGGCCCACATAGCAAGG - Intronic
1010026621 6:71225809-71225831 ATGGAGAGGGCCACAAAGCATGG - Intergenic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1016775509 6:147900211-147900233 ATGGAGGATCGGTCAAAGGAGGG + Intergenic
1016899225 6:149084388-149084410 AAGGAGAAGCCAAGAAAAGAGGG - Intergenic
1017344147 6:153359833-153359855 ATGTAGAAGGCTACAAATGATGG + Intergenic
1018697608 6:166402630-166402652 CTGGATGAGGCGACAAAGGAAGG - Intergenic
1019778510 7:2926213-2926235 ATGGAGAGGCCGACATTGGAGGG - Intronic
1021555187 7:21911853-21911875 ATGGAGATGACGAAAATGGATGG + Intronic
1023541006 7:41265753-41265775 ATGGAAAAGCCAAGAAAGAATGG + Intergenic
1025265739 7:57455487-57455509 TTGGTGAAGACCACAAAGGATGG + Intronic
1025719096 7:63993223-63993245 TTGGTGAAGACCACAAAGGATGG + Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1031082442 7:117271847-117271869 GTGGGGAATCAGACAAAGGATGG - Intergenic
1032422858 7:131796997-131797019 ATGGAGATGGCAACAAAGGAAGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033433232 7:141308094-141308116 ATGAAGAAGCCGGGGAAGGAGGG + Intronic
1035566813 8:646742-646764 ATGAAGAAGACGGCAAAGGAGGG + Intronic
1036543934 8:9748103-9748125 ATGAAGCAGCCCAGAAAGGAAGG + Exonic
1037499870 8:19475226-19475248 ATGCAGAAGCCGAGAAAGTCTGG + Intronic
1038803304 8:30768698-30768720 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1048193276 8:132309717-132309739 TTGAAGAAGCCGACAAAGACAGG + Intronic
1048762476 8:137810688-137810710 ATTGCGAAGCCAACAAAGCAAGG - Intergenic
1048803066 8:138212164-138212186 AGGGAGAGTCTGACAAAGGATGG + Intronic
1050310341 9:4346606-4346628 CTAGAGAAGCTGACCAAGGATGG - Intronic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1054806501 9:69400953-69400975 ATGGAGAAGCCTACATAGTGAGG - Intergenic
1056677871 9:88691691-88691713 ATGGAGCACCCAACAAATGAAGG + Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058706360 9:107640839-107640861 GTGGAGAAGCCCACACTGGAAGG - Intergenic
1059151507 9:111953581-111953603 ATGGAGAAGGGGAGAAAGTATGG - Intergenic
1060127221 9:121059800-121059822 ATGGAGAAGCCCACGTAGAAAGG + Intergenic
1061594509 9:131620207-131620229 ATGGAGAAGATGCCCAAGGATGG + Intronic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1186000972 X:5010077-5010099 ATGGAGAGGTTGAGAAAGGAAGG + Intergenic
1187344146 X:18447672-18447694 ATCAAGAAGCCCACACAGGAGGG - Intronic
1189172383 X:38922240-38922262 AGGGAGATGGCGACAAAGAAGGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1196201907 X:112896060-112896082 ATGGAAAAGACTACATAGGATGG - Intergenic
1197900783 X:131369124-131369146 ATGGAGAAGGCTCCAAAGGATGG + Intronic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1198634763 X:138684226-138684248 ATTGATAACCTGACAAAGGAAGG + Intronic
1199780773 X:151057277-151057299 ATGGAGAAGTTGTTAAAGGAAGG - Intergenic
1200104658 X:153705660-153705682 ATGGAGAGGCCTAGAAAGAAAGG + Intronic
1201563746 Y:15345131-15345153 ATGGTGAAACCCACAAAGCAAGG - Intergenic