ID: 900561616

View in Genome Browser
Species Human (GRCh38)
Location 1:3309861-3309883
Sequence CCCCCTTGAGGGAGTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900561612_900561616 -4 Left 900561612 1:3309842-3309864 CCAGGGAGGAGGAGCGTGGCCCC 0: 1
1: 0
2: 5
3: 33
4: 320
Right 900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 129
900561611_900561616 -3 Left 900561611 1:3309841-3309863 CCCAGGGAGGAGGAGCGTGGCCC 0: 1
1: 0
2: 2
3: 23
4: 249
Right 900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 129
900561608_900561616 9 Left 900561608 1:3309829-3309851 CCAGGGAGGGGACCCAGGGAGGA 0: 1
1: 0
2: 17
3: 64
4: 572
Right 900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900561616 Original CRISPR CCCCCTTGAGGGAGTCCTTG AGG Intronic
900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG + Intronic
901454100 1:9353381-9353403 CGCCATGGAGGGAGTCCTAGAGG + Intronic
903829265 1:26164861-26164883 CCCCCCTGAGGGAAGCCCTGGGG + Intergenic
904260903 1:29287110-29287132 CCCCCAGGAGGGAGTCCCAGGGG + Intronic
905110062 1:35588517-35588539 CCCCCAGGAGGGAGGCGTTGAGG - Exonic
906964794 1:50445697-50445719 CCACCTTTTGGGACTCCTTGGGG + Intronic
912501778 1:110127330-110127352 CCCTCTTGAGGGAGGCCTTGAGG + Intergenic
916171159 1:162002588-162002610 CACGCTTGGGGGTGTCCTTGGGG - Intronic
924740501 1:246791832-246791854 GCCTCCTGAGGGAGCCCTTGGGG + Intergenic
1064230412 10:13525053-13525075 CCCCCTTGATGGGGTAATTGTGG + Intronic
1065241387 10:23708606-23708628 AGGCCTTGAGGCAGTCCTTGCGG + Intronic
1069780273 10:70950963-70950985 TCCCCTTGAGGGACTCCCTGGGG + Intergenic
1070115626 10:73526116-73526138 CTACCTGGAGGGAGCCCTTGTGG - Intronic
1070812596 10:79305853-79305875 TCCCCACGAGGGAGCCCTTGAGG + Intronic
1071674683 10:87644447-87644469 CACCCTTGTGAGAGACCTTGAGG - Intergenic
1071855879 10:89623850-89623872 CCACCCTGAGGGAACCCTTGTGG - Intronic
1072502503 10:96032166-96032188 CACCCCTGAGTGAGTCTTTGAGG + Exonic
1077041890 11:528454-528476 CCCCCTTGCTGGAGGCCCTGCGG - Intergenic
1077948336 11:6926781-6926803 CACGCTTGAGGGCGTCCATGCGG + Intronic
1081007615 11:37766339-37766361 CCCACTTGATGGTGTCCTTCAGG + Intergenic
1084545203 11:69811942-69811964 ACCCCATGAGGCAGCCCTTGAGG - Intronic
1085265891 11:75237758-75237780 CCCCCTTCAGGGAGCCCTCATGG - Intergenic
1104202485 12:126603950-126603972 CCACCCAGAGGGACTCCTTGAGG + Intergenic
1104399768 12:128465727-128465749 CACCCTTGAGGGTGTTCTTTTGG - Intronic
1106121303 13:26862143-26862165 CCCCTGTGATGGAGTCCTTTGGG + Intergenic
1112033524 13:95477464-95477486 CCCCCTGGAAGGAGTCCTCCGGG - Intronic
1112156602 13:96824093-96824115 CCCTCTTGAGGGAAGCCCTGTGG + Intronic
1113833278 13:113313545-113313567 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833304 13:113313641-113313663 CCTCCTGGAGGGAGTCAGTGTGG + Intronic
1113833329 13:113313737-113313759 CCTCCTGGAGGGAGTCAGTGTGG + Intronic
1113833354 13:113313833-113313855 CCTCCTGGAGGGAGTCAGTGTGG + Intronic
1113833380 13:113313929-113313951 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833406 13:113314025-113314047 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833513 13:113314409-113314431 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833538 13:113314505-113314527 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833563 13:113314601-113314623 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833588 13:113314697-113314719 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833613 13:113314793-113314815 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833637 13:113314889-113314911 CCTCCTAGAGGGAGTCAGTGTGG + Intronic
1113833699 13:113315128-113315150 CCTCCTGGAGGGAGTCAGTGCGG + Intronic
1113856043 13:113445997-113446019 CCCCCCAGAGAGAGTGCTTGGGG + Intronic
1113879250 13:113614515-113614537 CTCCCTTGAGTCAGACCTTGAGG + Intronic
1113961417 13:114128385-114128407 CTCCCGTGAGGGAGTCCATCAGG + Intronic
1120504584 14:85339111-85339133 CCCTCAGGAAGGAGTCCTTGTGG + Intergenic
1120824281 14:88941325-88941347 TCTCCTTGAGGAAGCCCTTGAGG - Intergenic
1122165138 14:99817587-99817609 ACCCCTTCAGGAAGTCCCTGAGG - Intronic
1128062429 15:64743365-64743387 CCAGCCTGAGGGACTCCTTGGGG + Intronic
1129037096 15:72657017-72657039 CCCCCTTCAGTGACTCCTAGAGG - Intronic
1129212791 15:74080208-74080230 CCCCCTTCAGTGACTCCTAGAGG + Intronic
1129397608 15:75260878-75260900 CCCCCTTCAGTGACTCCTAGAGG - Intronic
1129401220 15:75285155-75285177 CCCCCTTCAGTGACTCCTAGAGG - Intronic
1129457910 15:75685443-75685465 TCCCCTCGAGGGCGTCCTTGTGG - Exonic
1134268392 16:12711662-12711684 CCCCCATGATGGTGCCCTTGGGG + Intronic
1136108994 16:28052953-28052975 CCACCTTGAGGGAGACTTTCTGG - Intronic
1138652011 16:58465979-58466001 CCCCCTGGAGGGAAGGCTTGCGG + Intronic
1139364426 16:66425262-66425284 ACACTTTGAGTGAGTCCTTGCGG - Intergenic
1141878440 16:86842173-86842195 CTTCCTTGAGGGCTTCCTTGTGG - Intergenic
1147184051 17:38704264-38704286 CCCCCTTTAGGAAGTTTTTGGGG + Intergenic
1148075857 17:44934860-44934882 CCCCCTTGTCGGGGTCCTCGCGG + Exonic
1148785489 17:50144216-50144238 CCCCCATGAGGGAGTGTTTGTGG - Intronic
1149266483 17:54932892-54932914 CCCCCTTGAAGGAAGCCTTTAGG - Intronic
1150001370 17:61443002-61443024 GCCTCTTGAGGAAGCCCTTGAGG + Intergenic
1151880774 17:76893216-76893238 CCCCCCTCAGGGTGTCCTTGAGG + Intronic
1156179453 18:34586003-34586025 CCTCCATGAGGCAGTCCCTGTGG - Intronic
1157462437 18:47911460-47911482 CTTCCTGGAGGGAGGCCTTGGGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160172746 18:76568207-76568229 GCCCCTTGATGCAGTTCTTGGGG + Intergenic
1161234267 19:3190171-3190193 AGACCTCGAGGGAGTCCTTGGGG - Intronic
1163206210 19:15804794-15804816 CCCCATTGTGGGAGTCAGTGTGG - Intergenic
1163908186 19:20166210-20166232 CCCCCTTGAGGCATTCATTGAGG - Intergenic
1166047762 19:40239420-40239442 CCCCCTGGTGGGAGTCTCTGAGG - Intronic
1166806214 19:45488844-45488866 CCACCTTGAGGGAATCCACGAGG + Exonic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167517033 19:49929458-49929480 CCCTCTTTAGGGAGCCCTGGGGG + Exonic
927318906 2:21720063-21720085 CCCCCCTCAGGGTGCCCTTGAGG - Intergenic
930776986 2:55182842-55182864 CCCACCTGAGAGAGTCTTTGGGG + Intronic
932715854 2:74100427-74100449 CCACCTTGAGGGAGGGCTTCAGG - Exonic
934994961 2:98949479-98949501 GCCCCAAGAGGGAGTCCTTGGGG + Intergenic
937379437 2:121363171-121363193 CCTCCTTATGGGAGTCTTTGTGG + Exonic
938265606 2:129925987-129926009 CCTCCTTGAGGAAGTCCATCTGG - Intergenic
946433424 2:219637613-219637635 CCCCCCTGAGGGGGCCCTGGAGG + Exonic
1172974975 20:38899436-38899458 CCCTCCTGAAAGAGTCCTTGGGG - Intronic
1175379957 20:58556136-58556158 TCTCCTTTGGGGAGTCCTTGAGG + Intergenic
1175390883 20:58626610-58626632 CCCCCTTGACTGAGAACTTGGGG + Intergenic
1175678756 20:60969116-60969138 CCTCCTTGTGGGGTTCCTTGGGG - Intergenic
1180848894 22:19001222-19001244 CTCCCTTGAAGGATTGCTTGTGG + Intergenic
1183483337 22:38076544-38076566 CCCCCTTCAGGGAGGCAGTGTGG - Intergenic
1185319534 22:50194073-50194095 ACCCCATGAGGGCGACCTTGGGG - Intronic
950101022 3:10356930-10356952 CCTCCTTGGGGGTGTCATTGTGG - Intronic
951066374 3:18271260-18271282 CCACCTCTATGGAGTCCTTGAGG + Intronic
952946294 3:38479683-38479705 TCCCCTTGAGGTAATCCGTGAGG - Exonic
954924919 3:54225413-54225435 TCCCCTTGTGGGACTCCATGAGG + Intronic
960292087 3:115898027-115898049 CCCTCCTGAGGAAGTCCTAGGGG + Intronic
961006685 3:123410267-123410289 TGCCCTGGAGGGAGTCTTTGTGG - Intronic
968511108 4:996345-996367 CCTCCTTTAGGGAGACCTTGAGG - Intronic
969070399 4:4533312-4533334 CCCACCAGAGGGAGTCCATGTGG + Intronic
978317382 4:107454066-107454088 CCCCCTTGATGAAGTCCTACGGG + Intergenic
980457846 4:133069018-133069040 AGCCAGTGAGGGAGTCCTTGGGG + Intergenic
980799663 4:137733367-137733389 CACCCTTAAGGGACTCCTAGAGG + Intergenic
980801412 4:137755456-137755478 ACACCTTGAGGGAATCCCTGGGG + Intergenic
980845424 4:138318595-138318617 CCCCTTGGAGGTAGTCCTGGTGG - Intergenic
985630897 5:1013494-1013516 CCCCCTTGTGGGAGGCGTCGAGG + Intronic
991300038 5:65121175-65121197 TCCCTTTGAGGGAGTATTTGTGG - Intergenic
996548375 5:124705236-124705258 CTCACTGGAGGGAGTCCTTGTGG - Intronic
997607046 5:135182687-135182709 CCCCCTTGAGCCAGGCCTGGGGG - Intronic
997648480 5:135497548-135497570 GCCAGTGGAGGGAGTCCTTGGGG + Intergenic
999364464 5:151012953-151012975 CCCCAGGCAGGGAGTCCTTGAGG - Intergenic
1000358735 5:160427619-160427641 ACCCTTTGAGGGGGTCCATGAGG - Intronic
1000378074 5:160602753-160602775 CGCCCTTGAGAGAGTCCCTCTGG - Intronic
1004389779 6:15200367-15200389 CCCCCTTGTGAGTGTTCTTGTGG - Intergenic
1007616123 6:43180621-43180643 CCCCTTTGGGGTAGACCTTGAGG + Exonic
1012628307 6:101431293-101431315 CACCCATGTGGGAGTCCTTCTGG + Intronic
1024255195 7:47535653-47535675 TCCCCCTCAGGGAGTCCTTGTGG - Intronic
1024906869 7:54393177-54393199 ACCCCTTGGGAGAGTCCCTGGGG + Intergenic
1028314218 7:89379941-89379963 CCACATTGAGGGAGTTCTTCAGG + Intergenic
1032706372 7:134423907-134423929 CCCCATTGAGGAAGTACTTGTGG + Intergenic
1032988344 7:137363274-137363296 CCTACTTGAGGGAGGCATTGTGG - Intergenic
1033082851 7:138314171-138314193 CCCCTTTGAGAGTGGCCTTGAGG + Intergenic
1034349084 7:150405049-150405071 CCCCCTTTCGGGATTCCCTGAGG - Intronic
1035224355 7:157425295-157425317 CACCCTTGAGGGAGGCCTAGGGG - Intergenic
1036813504 8:11884526-11884548 GCTCCTTGAGGGAGTCTCTGGGG - Intergenic
1037998291 8:23369029-23369051 GCCCATTGAGGGAGCCCGTGTGG + Intronic
1038186907 8:25283524-25283546 TCCCATTGGCGGAGTCCTTGTGG - Intronic
1040899786 8:52406471-52406493 TGGCCTTGAAGGAGTCCTTGGGG + Intronic
1047618744 8:126585200-126585222 CATCCTTGAGGGACTCCTCGTGG - Intergenic
1048011284 8:130458190-130458212 GCCCCTTGAAGCATTCCTTGTGG - Intergenic
1049196043 8:141316207-141316229 CCCCCTTGAAGGGGACTTTGAGG + Intergenic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1049664474 8:143836877-143836899 CCCCCTTGTGGGGGTCATGGGGG - Intronic
1050992412 9:12170852-12170874 CCCCCACCAGGGAGTCCTAGAGG - Intergenic
1051699633 9:19808066-19808088 CCATCTGTAGGGAGTCCTTGGGG - Intergenic
1053050715 9:34958559-34958581 ACGCCTTGGGGGAGTCCCTGAGG + Intronic
1055731905 9:79287194-79287216 CCCCCTTGGTGGGGACCTTGTGG - Intergenic
1059512284 9:114860344-114860366 ACCCATTTAGGGAGTCCATGTGG + Intergenic
1060219180 9:121755367-121755389 GCCCCAGGTGGGAGTCCTTGTGG + Intronic
1060698642 9:125731477-125731499 CCCCCATGAGTGAATCCCTGGGG - Intergenic
1061127241 9:128684636-128684658 CCACCTTGAGGGAGGCCTCCAGG - Intronic
1061383855 9:130276700-130276722 GTCCCTTGAGGGTGTCTTTGAGG + Intergenic
1062108935 9:134771464-134771486 TCCCCTTGAGGGAGGCTTTGAGG - Intronic
1062452888 9:136622935-136622957 CCCCCTACAGGGAGTCCTGAGGG + Intergenic
1190969307 X:55333422-55333444 CCCCCTTGAGGGATGGCTTTTGG - Intergenic
1192207442 X:69105767-69105789 CACTGTTGAGGGAGTCCTGGTGG - Intergenic
1200144708 X:153920646-153920668 CCTTCTTGAGGGAGCTCTTGCGG + Exonic