ID: 900562049

View in Genome Browser
Species Human (GRCh38)
Location 1:3312074-3312096
Sequence TGTCGCATGGGGGAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900562049_900562062 24 Left 900562049 1:3312074-3312096 CCCGGCTGCTCCCCCATGCGACA 0: 1
1: 0
2: 0
3: 6
4: 129
Right 900562062 1:3312121-3312143 CCACCTTCCCACGTGTGAAATGG 0: 1
1: 0
2: 2
3: 21
4: 176
900562049_900562063 25 Left 900562049 1:3312074-3312096 CCCGGCTGCTCCCCCATGCGACA 0: 1
1: 0
2: 0
3: 6
4: 129
Right 900562063 1:3312122-3312144 CACCTTCCCACGTGTGAAATGGG 0: 1
1: 0
2: 2
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900562049 Original CRISPR TGTCGCATGGGGGAGCAGCC GGG (reversed) Intronic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
908501044 1:64744686-64744708 CGTCACATGGGGGGCCAGCCGGG + Intergenic
910262636 1:85306947-85306969 TGTCTAGTGGGAGAGCAGCCTGG + Intergenic
913689751 1:121268043-121268065 TGTGGCATCGGGGATCAGCAGGG + Intronic
914147848 1:145012229-145012251 TGTGGCATCGGGGATCAGCAGGG - Intronic
914224226 1:145707174-145707196 AGTCCCATGGGGAGGCAGCCAGG - Intronic
915051886 1:153084014-153084036 TGTCTCCTGGGGTACCAGCCTGG + Intergenic
915196086 1:154190839-154190861 TGTGGCATGGGGGAGGAGGTAGG + Intronic
920068098 1:203283249-203283271 TGTTGGCTGGGGGAGAAGCCAGG + Intergenic
920276767 1:204812012-204812034 AGTCACATGGGGAAGCAGCAGGG - Intergenic
920477072 1:206286517-206286539 TGTGGCATCGGGGATCAGCAGGG + Intronic
922924498 1:229336470-229336492 TGTCTCATGGGGAATAAGCCTGG - Intronic
923934658 1:238747381-238747403 TGTCTCATGTGGCAGCAGACAGG - Intergenic
924502084 1:244647252-244647274 TTTCTCATGGTGGAGCAGACAGG + Intergenic
1062875393 10:939267-939289 TGGCACAGGAGGGAGCAGCCAGG + Intergenic
1062968259 10:1626639-1626661 TGTCGAGTGTGGGGGCAGCCCGG - Intronic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067017891 10:42771466-42771488 TGTGGCAAGGAGGTGCAGCCAGG + Intergenic
1067055504 10:43047512-43047534 TGTGGCATGGGTGGGCAGACTGG + Intergenic
1067258625 10:44666737-44666759 TGTCACATGGGGTGGCTGCCTGG + Intergenic
1069664429 10:70145447-70145469 TGTCCCCTCGGGAAGCAGCCAGG - Exonic
1071878174 10:89865390-89865412 TTGGGGATGGGGGAGCAGCCAGG + Intergenic
1073068035 10:100775502-100775524 TGGTGCATGGGGGAGGAGCTGGG - Intronic
1074983208 10:118635973-118635995 TGGCAGATGGGGGAGCAGCAGGG - Intergenic
1077981117 11:7301883-7301905 TGTAGCCTGGGGCAGAAGCCTGG + Intronic
1081027704 11:38036149-38036171 TGTTGGATGGGGTTGCAGCCAGG + Intergenic
1083898462 11:65632152-65632174 TGTCCCATGGGGAAGCTGACTGG + Intronic
1084179256 11:67438401-67438423 TGCCGCCTGGAGGAGCAGCTGGG - Exonic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1089128821 11:116195813-116195835 TTTCGTAAAGGGGAGCAGCCAGG + Intergenic
1089213500 11:116821704-116821726 ATTGGCATGGGGCAGCAGCCGGG + Exonic
1090262286 11:125330324-125330346 GGTCACATGGAGGAGAAGCCTGG + Intronic
1096109479 12:49020513-49020535 TGGGGCATGGGGGAGCCGGCTGG - Exonic
1103561709 12:121796310-121796332 TGAAGCCTGGGGGAGCGGCCGGG + Intronic
1104569742 12:129914760-129914782 TGTCTGATGGAGGAGGAGCCTGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1114083490 14:19220436-19220458 TGTGGGCTGGGGGAGCAGCTGGG + Intergenic
1114440962 14:22747345-22747367 TTTCGCAGCGGGGAGGAGCCTGG - Intergenic
1120969826 14:90198015-90198037 TGTGCCAAGGGGGAGCAGCAGGG + Intergenic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1127721342 15:61703021-61703043 TGTCTCATGTGGGAGTAGCAAGG - Intergenic
1128692607 15:69736545-69736567 TGTCACAATGGGGAGAAGCCAGG - Intergenic
1130859720 15:87875380-87875402 TGTGGTATGTGGCAGCAGCCAGG + Intronic
1132224715 15:100131642-100131664 TCTCTGATGTGGGAGCAGCCTGG - Intronic
1132954785 16:2585821-2585843 GGTTGCGTGGGGCAGCAGCCAGG + Intronic
1141110346 16:81266450-81266472 TGGGGGATGGGGGAGCAGCAAGG - Intronic
1141249062 16:82338485-82338507 TGATGCATGAAGGAGCAGCCTGG - Intergenic
1141313708 16:82939974-82939996 TGTCTCATGTGGCAGCAGACAGG + Intronic
1146835245 17:36105354-36105376 TGTCTCATGGAGAAGCATCCGGG - Exonic
1146957678 17:36946287-36946309 TCTCGCCTGGGAGGGCAGCCTGG + Intergenic
1147597087 17:41724319-41724341 GGTGGGATGGTGGAGCAGCCCGG - Exonic
1147720796 17:42538123-42538145 TGTCGCATGGGTGAGGAGATGGG - Intronic
1148211407 17:45810965-45810987 TGTCCAGAGGGGGAGCAGCCAGG - Intronic
1149540511 17:57464674-57464696 TGTCCCAAGGGGCAGCAGCGTGG - Intronic
1151660183 17:75514824-75514846 TGTCGGGTGGAGGAGCAGCTGGG + Intronic
1152134982 17:78498517-78498539 CTTCGGATTGGGGAGCAGCCTGG - Intronic
1152541758 17:80980125-80980147 TCTCCCCAGGGGGAGCAGCCAGG + Intergenic
1155830957 18:30514185-30514207 TGTTCCATGGAGCAGCAGCCTGG + Intergenic
1160726365 19:619470-619492 AGTGGTCTGGGGGAGCAGCCAGG + Intronic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1166083869 19:40462231-40462253 TCACACATGGGGGAGCAGCAGGG + Intronic
1167111711 19:47466346-47466368 CGGAGCATGGGGGAGCCGCCAGG + Exonic
1168563509 19:57403615-57403637 TGTCACATGGGGTGGCTGCCTGG - Intronic
926244743 2:11114209-11114231 GGTGGGAGGGGGGAGCAGCCTGG + Intergenic
927691028 2:25208284-25208306 AGTCTGATGGGGGAGGAGCCTGG + Intergenic
931116289 2:59170273-59170295 TGTGTCATGGGGGAGCTGCTTGG - Intergenic
932128562 2:69167374-69167396 TGTTGCCTGGAGGAGCAGCTTGG - Intronic
934526801 2:95057056-95057078 TTTCTGATGGGGGTGCAGCCAGG + Intergenic
938450199 2:131411642-131411664 GGTGGCCTGGGGGAGCAGCTGGG - Intergenic
947567049 2:231201002-231201024 TGTTGCATGGGGGAATGGCCAGG + Intronic
948455356 2:238102147-238102169 TCCCGCCTGGGGGGGCAGCCTGG + Intronic
948835628 2:240624739-240624761 TGCACCATGGGGGCGCAGCCTGG + Intronic
1172225024 20:33299788-33299810 TGTTGCATGGGGGGGCAGGTAGG - Intronic
1172836566 20:37877156-37877178 TTTCCCATGGGAGAGCAGCCAGG - Intergenic
1173654560 20:44690686-44690708 TGTCTCATGGTGGAGGAGGCTGG + Intergenic
1173740175 20:45394799-45394821 TGTTGCATGGGGTGGCAGCCTGG - Intronic
1174138859 20:48398863-48398885 TGTAGCAGGGAGGTGCAGCCGGG - Intergenic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1180294485 22:10872831-10872853 TGTGGGCTGGGGGAGCAGCTGGG - Intergenic
1180497291 22:15902245-15902267 TGTGGGCTGGGGGAGCAGCTGGG - Intergenic
1181624747 22:24115667-24115689 TCTCCCATTGGGTAGCAGCCTGG + Intronic
1182661619 22:31929193-31929215 TGGTGCTTGGGGGAGCAGCGTGG - Intergenic
1184296254 22:43527339-43527361 AGTCACATGGAGGAGCAGCTGGG + Intergenic
1185258905 22:49850650-49850672 TGTCACATGTGGAAGCAGCTGGG - Intergenic
1185343342 22:50301051-50301073 TGTAGGATGGGAGGGCAGCCTGG - Intronic
950913717 3:16621427-16621449 TGGCCCCTGGGAGAGCAGCCTGG + Intronic
953226513 3:41026498-41026520 TAGGGCATAGGGGAGCAGCCTGG + Intergenic
955917805 3:63924343-63924365 TGGAGCATGGTGGAGCAGTCTGG + Intronic
960869029 3:122230781-122230803 TGTCCCAAGGAGGAGCAGCTAGG + Intronic
961811837 3:129526648-129526670 TGTGGGATGGGGGCTCAGCCCGG + Intergenic
962325157 3:134426678-134426700 TGACGCCTGTGGGAGCATCCTGG + Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
969536090 4:7756863-7756885 TGTCCTATGGGAGAGCAGGCAGG + Intergenic
969860867 4:10034378-10034400 GGTCCCCTGGGGGAGCAGCATGG + Intronic
970092975 4:12430612-12430634 TCTCCCTTGGGGGAGCAGCCAGG - Intergenic
975290050 4:72667113-72667135 ATTTGCATGGGGGAGGAGCCTGG + Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
978524335 4:109649965-109649987 TGTGGTATGGAGGAGCAGCCCGG + Intronic
979507496 4:121514731-121514753 ATTTGCATGGGGGAGGAGCCTGG + Intergenic
981363457 4:143874277-143874299 TGTGGGATGGGGGAGATGCCAGG - Intronic
981383289 4:144098336-144098358 TGTGGGATGGGGGAGATGCCAGG - Intergenic
985811572 5:2094082-2094104 TTTCGCATGGGAGAGCGTCCTGG + Intergenic
986308165 5:6531037-6531059 GGTGGGATGGGGGAGAAGCCTGG + Intergenic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
991012902 5:61902167-61902189 TCTGGCCTTGGGGAGCAGCCAGG - Intergenic
996527540 5:124494625-124494647 TGTTGCATGGGTGAGTAGTCTGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001515122 5:172350245-172350267 TGGAGGATGGGGGAGCAGCTGGG + Intronic
1006459752 6:34151564-34151586 GGGCGCCAGGGGGAGCAGCCAGG + Intronic
1008483432 6:52009862-52009884 TGTGCCATGGGGGAGCAGAGTGG - Intronic
1008541800 6:52552206-52552228 CTTTGCATGGGGGAGGAGCCTGG - Intronic
1008935515 6:56987664-56987686 TGGTGCATGGAGGAGGAGCCTGG - Intronic
1009306924 6:62102659-62102681 TGTCACATGGGGTGGCTGCCAGG + Intronic
1017498350 6:155001220-155001242 TGTCATATGGGTGAGCAGCCTGG - Intronic
1019462813 7:1170043-1170065 TGCCGCCAGGGGGAGCTGCCAGG - Intergenic
1019887619 7:3919212-3919234 TATGGCCTGGGGGAGAAGCCGGG - Intronic
1022679041 7:32526899-32526921 TGCCGCAGTGGGGAGGAGCCTGG - Intronic
1023219077 7:37899830-37899852 GGTGGCCTGGGGGAGCAGCTGGG - Intronic
1031980536 7:128121747-128121769 TGGCGTCTGGGGGAGCCGCCAGG - Intergenic
1034274952 7:149819941-149819963 TGGCCCATGAGGTAGCAGCCAGG - Intergenic
1035039773 7:155919437-155919459 TGTGGGATGTGGGAGCAGCAGGG + Intergenic
1036695947 8:10975261-10975283 TGGGTGATGGGGGAGCAGCCTGG - Intronic
1039162624 8:34639555-34639577 TGTTGCATGGGGCACCAGCAAGG - Intergenic
1045277358 8:100720859-100720881 AGTCGCCTGGGGGAGCCACCAGG - Intronic
1046132902 8:109990351-109990373 CTTTGCATGGGGGAGAAGCCTGG - Intergenic
1057124760 9:92608229-92608251 TGTCCCACGGGGGCTCAGCCAGG + Intronic
1059395972 9:114034361-114034383 GGACGCATGGGGGTGCAGCATGG - Intronic
1062096485 9:134706491-134706513 AGGCGGATGGGAGAGCAGCCAGG + Intronic
1062232200 9:135487786-135487808 TGTCTCCTGGGGGGGCAGGCAGG + Exonic
1062277954 9:135739522-135739544 GGGGGCATGGAGGAGCAGCCAGG - Intronic
1062732031 9:138115455-138115477 TGTGGCATGGGGCAAAAGCCAGG - Intronic
1187449095 X:19381336-19381358 TCTGGGATGGGAGAGCAGCCCGG + Intronic
1189350953 X:40275346-40275368 TGTCTCATGAGGTTGCAGCCAGG + Intergenic
1194583817 X:95708828-95708850 TTTGGCATGGGGCAGAAGCCAGG - Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic