ID: 900562828

View in Genome Browser
Species Human (GRCh38)
Location 1:3316135-3316157
Sequence GACTGAGGGCGGGTGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2199
Summary {0: 1, 1: 0, 2: 7, 3: 113, 4: 2078}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900562817_900562828 14 Left 900562817 1:3316098-3316120 CCTTTTTAAACGTTTCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG 0: 1
1: 0
2: 7
3: 113
4: 2078
900562815_900562828 20 Left 900562815 1:3316092-3316114 CCTGTTCCTTTTTAAACGTTTCA 0: 1
1: 1
2: 0
3: 21
4: 297
Right 900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG 0: 1
1: 0
2: 7
3: 113
4: 2078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900562828 Original CRISPR GACTGAGGGCGGGTGGGGGC GGG Intronic
Too many off-targets to display for this crispr